jmm.sgmjournals.org - Journal of Medical Microbiology
... second signalling system, based on an unrelated autoinducer (AI-2), that was species non-specific (Bassler et al., 1994). The luxS gene encoding AI-2 synthase revealed no similarity to other autoinducer synthase genes (Surette et al., 1999). Moreover, by using a mutant strain of V. harveyi able to d ...
... second signalling system, based on an unrelated autoinducer (AI-2), that was species non-specific (Bassler et al., 1994). The luxS gene encoding AI-2 synthase revealed no similarity to other autoinducer synthase genes (Surette et al., 1999). Moreover, by using a mutant strain of V. harveyi able to d ...
PART 10 - Mike South
... including a specific fluorescent in situ hybridization (FISH) test for this microdeletion, which confirmed the diagnosis. 90% of children with this condition are the first person in their family to be affected. However, 10% have inherited the condition from a parent, who may be unaware they are aff ...
... including a specific fluorescent in situ hybridization (FISH) test for this microdeletion, which confirmed the diagnosis. 90% of children with this condition are the first person in their family to be affected. However, 10% have inherited the condition from a parent, who may be unaware they are aff ...
thalassaemia mutations in Sardinians
... were: HincII 3' to the E globin gene,13 HindIII within the Gy and Ay globin genes,'4 HincII within and 5' to the VP globin gene,' 3 Avall within the second intervening sequence of the 3 globin gene,'5 and BamHI 3' to the ( globin gene.'6 The presence of a polymorphic site is indicated as (+) and its ...
... were: HincII 3' to the E globin gene,13 HindIII within the Gy and Ay globin genes,'4 HincII within and 5' to the VP globin gene,' 3 Avall within the second intervening sequence of the 3 globin gene,'5 and BamHI 3' to the ( globin gene.'6 The presence of a polymorphic site is indicated as (+) and its ...
overview of inheritance - American Heart Association
... that the cause is an error or mistake in a gene. Genes are the blueprints or instructions that determine how the parts of our bodies will be formed and how they will function. Genes are encoded in our DNA found within each cell and passed down to our children. Mistakes in these coded instructions ca ...
... that the cause is an error or mistake in a gene. Genes are the blueprints or instructions that determine how the parts of our bodies will be formed and how they will function. Genes are encoded in our DNA found within each cell and passed down to our children. Mistakes in these coded instructions ca ...
An Interaction-Dependent Model for Transcription Factor Binding
... interaction-dependent functionality is the basis for transcriptional modules [7-9]. In some cases, this dependency is involved in protein modifications, like phosphorylation. However, there are other cases where the binding of the TF itself is interaction-dependent [10, 11]. This interaction-depende ...
... interaction-dependent functionality is the basis for transcriptional modules [7-9]. In some cases, this dependency is involved in protein modifications, like phosphorylation. However, there are other cases where the binding of the TF itself is interaction-dependent [10, 11]. This interaction-depende ...
Brochure
... P53 is a nuclear protein produced by the cells when DNA is damaged in order to protect the integral structure of the genome. Composed of 3 subunits, this protein plays 2 roles: it either stops the cellular cycle to allow for DNA repair when possible or it triggers cellular suicide (apoptosis) when t ...
... P53 is a nuclear protein produced by the cells when DNA is damaged in order to protect the integral structure of the genome. Composed of 3 subunits, this protein plays 2 roles: it either stops the cellular cycle to allow for DNA repair when possible or it triggers cellular suicide (apoptosis) when t ...
LNA-PNA Comparison4
... Applications of peptide nucleic acid probes 1) PNA fluorescent insitu hybridisationThe PNA-FISH technique was first developed for quantitative telomere analysis. Using a unique fluorescein-labelled PNA probe thus one can map the sequence onto a chromosome. In FISH applications PNA probes have severa ...
... Applications of peptide nucleic acid probes 1) PNA fluorescent insitu hybridisationThe PNA-FISH technique was first developed for quantitative telomere analysis. Using a unique fluorescein-labelled PNA probe thus one can map the sequence onto a chromosome. In FISH applications PNA probes have severa ...
spectroscopic studies of mosquito iridescent virus, its capsid
... acid inside the virion (RNA or DNA), and the concentration of virions in the environment or in the tissues of an infected animal. In particular, the fluorescence may be a novel tool to detect viruses and to monitor a viral infection of cells and may be part of a biodefense application [2]. Different ...
... acid inside the virion (RNA or DNA), and the concentration of virions in the environment or in the tissues of an infected animal. In particular, the fluorescence may be a novel tool to detect viruses and to monitor a viral infection of cells and may be part of a biodefense application [2]. Different ...
COMPLETE BIOLOGY Table of contents I. Chemistry II. Cells III
... - Channel proteins: provide passageway through membrane for hydrophilic (water-soluble) substances (polar, and charged). **- Recognition proteins: such as major-histocompatibility complex on macrophage to distinguish between self and foreign; they are glycoproteins due to oligosaccharides attached. ...
... - Channel proteins: provide passageway through membrane for hydrophilic (water-soluble) substances (polar, and charged). **- Recognition proteins: such as major-histocompatibility complex on macrophage to distinguish between self and foreign; they are glycoproteins due to oligosaccharides attached. ...
the complete Genetics Booklet
... Ichthyosis genes to pass on, that's true. But like any other parent, he will contribute only one half of his children's genes, and his child would need two “b”genes to display the disorder. That child could get another “b” gene only if his other parent were a carrier for that same disorder. Since La ...
... Ichthyosis genes to pass on, that's true. But like any other parent, he will contribute only one half of his children's genes, and his child would need two “b”genes to display the disorder. That child could get another “b” gene only if his other parent were a carrier for that same disorder. Since La ...
Metabolic transformation in cancer
... (complete lack of oxygen) are both present in most, if not all solid tumours. Hypoxia specifically is thought to be an important factor in supporting and directing tumour progression. However, contrary to being under constant hypoxia, one important facet of the tumour environment is that the hypoxia ...
... (complete lack of oxygen) are both present in most, if not all solid tumours. Hypoxia specifically is thought to be an important factor in supporting and directing tumour progression. However, contrary to being under constant hypoxia, one important facet of the tumour environment is that the hypoxia ...
Lecture 3: Prokaryotic and Eukaryotic Cells
... and outer membrane, known as intermembrane space and second inside the inner membrane known as matrix. The proteins present in intermembrane space have a role in executing “programmed cell death” or “apoptosis”. Matrix is the liquid part present in the inner most compartment of the mitochondria and ...
... and outer membrane, known as intermembrane space and second inside the inner membrane known as matrix. The proteins present in intermembrane space have a role in executing “programmed cell death” or “apoptosis”. Matrix is the liquid part present in the inner most compartment of the mitochondria and ...
C. elegans Life Cycle
... Six chromosomes (I-VI) – about same size No defined centromere – holocentric Detailed physical map of cosmids and YACs Recombination rates vary considerably 1 gene every 5 kb 19,000 genes Proteins match homologous sequences of other organisms 20% proteins carry out core biological functions Rest inv ...
... Six chromosomes (I-VI) – about same size No defined centromere – holocentric Detailed physical map of cosmids and YACs Recombination rates vary considerably 1 gene every 5 kb 19,000 genes Proteins match homologous sequences of other organisms 20% proteins carry out core biological functions Rest inv ...
module 12: mendelian genetics 2 - Peer
... Module 11. Mammals, birds, plants like garden peas and insects have thousands of different genes in their genomes. Frequently scientists wish to study inheritance patterns for two or more genes simultaneously. When two different genes are involved, dihybrid crosses are made and the distribution of t ...
... Module 11. Mammals, birds, plants like garden peas and insects have thousands of different genes in their genomes. Frequently scientists wish to study inheritance patterns for two or more genes simultaneously. When two different genes are involved, dihybrid crosses are made and the distribution of t ...
this PDF file
... primordial germ cells inhibits the apoptosis of ectopic primordial germ cells [3]. Germ cell tumours are also thought to arise from the physiologically distributed germ cells to the liver, brain and bone marrow [1]. As the overall incidence of germ cell tumours is higher in males, the prevalence of ...
... primordial germ cells inhibits the apoptosis of ectopic primordial germ cells [3]. Germ cell tumours are also thought to arise from the physiologically distributed germ cells to the liver, brain and bone marrow [1]. As the overall incidence of germ cell tumours is higher in males, the prevalence of ...
Automatic detection of conserved gene clusters in
... Generally speaking there are two representative clustering algorithms: single linkage and complete linkage. When single linkage is applied to our problem, many gene clusters tend to be merged into a small number of large groups. In the worst case, two unrelated clusters may be merged in the same gro ...
... Generally speaking there are two representative clustering algorithms: single linkage and complete linkage. When single linkage is applied to our problem, many gene clusters tend to be merged into a small number of large groups. In the worst case, two unrelated clusters may be merged in the same gro ...
The arbuscular mycorrhizal fungal protein glomalin is
... that codes for it. Various GRSP fractions are obtained using harsh extraction methods (autoclaving in citrated buffer; Wright & Upadhyaya, 1996); also, the potential complexity associated with the protein-material extracted from soil may explain why attempts to define glomalin biochemically thus far ...
... that codes for it. Various GRSP fractions are obtained using harsh extraction methods (autoclaving in citrated buffer; Wright & Upadhyaya, 1996); also, the potential complexity associated with the protein-material extracted from soil may explain why attempts to define glomalin biochemically thus far ...
pSAT vectors: a modular series of plasmids for autofluorescent
... Supplement 2. A detailed description of plasmid construction methods. Construction of pSAT vectors The original MCS of pUC18 (Norrander et al., 1983) was replaced by PCR amplification of the entire plasmid backbone using the primers 5’AAATACTGCAGCCATGGAATTCTAGAGCGGCCGCGTAATCATGGTCATAGCTGTTT CC3’ and ...
... Supplement 2. A detailed description of plasmid construction methods. Construction of pSAT vectors The original MCS of pUC18 (Norrander et al., 1983) was replaced by PCR amplification of the entire plasmid backbone using the primers 5’AAATACTGCAGCCATGGAATTCTAGAGCGGCCGCGTAATCATGGTCATAGCTGTTT CC3’ and ...
Archives of Microbiology
... exhibits chemotaxis toward a variety of oxidizable substrates including sugars, amino acids and organic acids, oxygen, and redox molecules (Alexandre et al. 2000; Barak et al. 1983). Non-Xagellated mutants as well as a mutant strain impaired in chemotactic response showed reduced colonization of the ...
... exhibits chemotaxis toward a variety of oxidizable substrates including sugars, amino acids and organic acids, oxygen, and redox molecules (Alexandre et al. 2000; Barak et al. 1983). Non-Xagellated mutants as well as a mutant strain impaired in chemotactic response showed reduced colonization of the ...
DNA cloning
... eral different enzymes. If the sticky end contains a 5¢ overhang, then any one of several different DNA polymerases can be used to add the missing bases to the 3¢ OH using the 5¢ overhang as a template. A 3¢ overhang cannot be filled in, rather the overhang must be removed. Many DNA polymerases have ...
... eral different enzymes. If the sticky end contains a 5¢ overhang, then any one of several different DNA polymerases can be used to add the missing bases to the 3¢ OH using the 5¢ overhang as a template. A 3¢ overhang cannot be filled in, rather the overhang must be removed. Many DNA polymerases have ...
Document
... -How can a mixture of molecules, too small to be seen with even a high-powered microscope, be separated from one another? Such was the dilemma facing scientists until the development of a process that has now become standard in many laboratories worldwide- gel electrophoresis. -Laboratories rely hea ...
... -How can a mixture of molecules, too small to be seen with even a high-powered microscope, be separated from one another? Such was the dilemma facing scientists until the development of a process that has now become standard in many laboratories worldwide- gel electrophoresis. -Laboratories rely hea ...
Molecular Basis for the Recently Described Hereditary
... ERRITIN is an ubiquitous iron storage protein present in every cell of nearly all organisms. It is a multimer shell composed of 24 heavy (H, Mr 21,000) and light (L, Mr 19,000) subunits, surrounding a cavity that can accommodateup to 4,500 iron atoms in a readily available but nontoxic form.’ The hu ...
... ERRITIN is an ubiquitous iron storage protein present in every cell of nearly all organisms. It is a multimer shell composed of 24 heavy (H, Mr 21,000) and light (L, Mr 19,000) subunits, surrounding a cavity that can accommodateup to 4,500 iron atoms in a readily available but nontoxic form.’ The hu ...
