• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
PowerPoint 簡報
PowerPoint 簡報

... product, removing the error-containing sequence. • Hydrolytic editing is stimulated by Gre factors, which also serves as elongation stimulating factors. ...
Genome Databases and Open Access Resources
Genome Databases and Open Access Resources

... Contig ...
Arabidopsis Gene Project Slides
Arabidopsis Gene Project Slides

... You are working on an Arabidopsis gene discovery project, and your job is to sequence cDNAs and then learn all you can about the genes from all types of databases: DNA sequence, genome, and publication databases. Query sequence: TCCTGCATTCAATGTGATCAATGGAGGCAGTCATGCTGGGAATAGTTT GGCTATGCAAGAGTTTATGATA ...
Editing the Mushroom
Editing the Mushroom

... THE TELLTALE SIGN of any transformational technology is how quickly researchers apply it to their own scientific problems. By that standard, CRISPR ranks among the most powerful additions to biology’s tool kit in the past half a century. The geneedited mushroom is a case in point. Yinong Yang—his fi ...
Transcription Translation PowerPoint
Transcription Translation PowerPoint

... 4. Every three nucleotides on mRNA is called a ____. (You may need to come back for this) ...
Press Release - (ITbM), Nagoya University
Press Release - (ITbM), Nagoya University

... immunoprecipitation (ChIP), and analyzed the DNA sequence by rapid DNA sequencing.” Although rapid DNA sequencing is a well-known technique, comprehensive analysis of the DNA sequences can be a rather complicated process. “We actually had to go back and forth many times until we were able to identif ...
Control of Gene Activity
Control of Gene Activity

... are DNA sequences that may be far away from a gene or even located in an intron  Some transcription factors function as A repressor is a protein that prevents the expression of a particular gene  Some activators and repressors act indirectly by influencing chromatin structure to promote or silenc ...
08.seg_dup_els - NYU Computer Science
08.seg_dup_els - NYU Computer Science

... hypothesis that recombination between homologous repeats from a family X, e.g., Alu or L1, contributes to the recent segmental duplication processes in mammalian genomes. The model reflects following intuitive observations: If some of the segmental duplication were caused by repeat recombination, th ...
Transcribed Ultra Conserved Regions real-time
Transcribed Ultra Conserved Regions real-time

Tracing the origin of our species through palaeogenomics
Tracing the origin of our species through palaeogenomics

... this case the one of present-day humans, since a de novo assemblage of an ancient genome based on these short molecules is not possible. The sequences may contain mistakes due to the damages that occur in DNA over time, therefore a higher coverage is required. Ideally each base should be sequenced a ...
Preparation of MyoD mRNA for the differentiation of stem cells into
Preparation of MyoD mRNA for the differentiation of stem cells into

... and stem cells is triggered by transcription factors. The transcription factor could be a protein or a piece of RNA. To induce cell differentiation in a lab, the targeted cell will have to be transfected with the transcription factor. Through a number of studies, it is found that transfecting the ce ...
The Origin of Life - Frederick H. Willeboordse
The Origin of Life - Frederick H. Willeboordse

DNA Replication and Telomere Maintenance
DNA Replication and Telomere Maintenance

... It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material. James D. Watson and Francis Crick, Nature (1953), ...
CHAPTER 1 Genetics: An Introduction
CHAPTER 1 Genetics: An Introduction

... • Each nucleotide is formed of three components: A phosphate group (PO4-3), a pentose (5C sugar) and a nitrogen base (A, G, C, T). The arrangement of the nucleotides in the chain forms a double helix. • GENES (which Mendel called factors) are specific sequences of nucleotides. • The full sequence of ...
Gene regulation I Biochemistry 302
Gene regulation I Biochemistry 302

... – β operon contains genes encoding RNAP subunits – str operon contain genes encoding translational elongation factors ...
Fluctuation-Facilitated Charge Migration along DNA
Fluctuation-Facilitated Charge Migration along DNA

... the oscillator frequency of the rotation mode, while M and Vy are the reduced mass and natural frequency of the displacement mode. The values of M, I, Vu , Vy , and the damping coefficients are obtained by comparing the Fourier power spectra of y共t兲 and u共t兲 obtained from Eqs. (1) and (2), to power ...
Horizontal gene transfer and the origin of species: lessons from
Horizontal gene transfer and the origin of species: lessons from

... micro-geographical terms that will spring from bacterial genomics: we could soon have islets, peninsulas or even genetic archipelagos! Armed with the awareness that HGT is so important in bacterial speciation, it is now possible to examine completely sequenced chromosomes in a new light and assess t ...
Slide 1
Slide 1

... Romanovs DNA fingerprinting analysis  DNA fingerprinting showed that 9 persons were buried in the Ekaterinburg grave.  Romanovs would be more similar in pattern to each other than to nonrelatives.  All of a child’s bands must be present in one or both of the parents. ...
Gill: Genes Enrichment, Gene Regulation I
Gill: Genes Enrichment, Gene Regulation I

... http://cs273a.stanford.edu [Bejerano Fall16/17] ...
Genetics Notes.notebook
Genetics Notes.notebook

... In DNA fingerprinting, the DNA is cut into  several fragments and organized according  to fragment size ...
hybrid DNA molecules
hybrid DNA molecules

... recombination at the his3 locus. Hinnen et al. (5) reported that most transformation events by a hybrid DNA molecule containing the yeast leu2 gene could be accounted for by homologous recombination at the leu2 locus. They also found transformants in which the leu2 + character was unlinked to leu2 ( ...
Expressed Sequence Tags: Any Prior Art Effect?
Expressed Sequence Tags: Any Prior Art Effect?

Document
Document

Prokaryotic Regulatory RNAs Cole Franks Proteins have been
Prokaryotic Regulatory RNAs Cole Franks Proteins have been

... pairs (reviewed in Brantl, 2007). Cis-encoded sRNA does not usually need hfq to help it anneal with the target mRNA; it anneals more easily because of how thoroughly complementary it is to the target. Though the sRNA and its target mRNA are encoded from the same stretch of DNA, they act as two sepa ...
Variant terminology and exon numbering
Variant terminology and exon numbering

... variation information is not an impediment to diagnosis and treatment; where the burden of genetic disease on the human population is significantly decreased; and where the sharing of genetic variation information is standard clinical practice. To facilitate worldwide and interoperable sharing of ge ...
< 1 ... 230 231 232 233 234 235 236 237 238 ... 983 >

Non-coding DNA

  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report