• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Enhancers reside in a unique epigenetic environment during early
Enhancers reside in a unique epigenetic environment during early

... expression are characterized by relatively low levels of DNA methylation (hypo-methylation), while inactive enhancers display hyper-methylation of the underlying DNA. The direct functional significance of the DNA methylation state of enhancers is, however, unclear for most loci. Results: In contrast ...
View Poster - Technology Networks
View Poster - Technology Networks

... Four miRNA candidates out of 8 tested by northern blot showed differential expression in gametes and vegetative cells Potential targets for four out of 18 tested candidate miRNAs could be verified by 5’ RACE analysis, showing cleavage in the centre of the predicted miRNA target site. This is similar ...
Comprehensive and Rapid Genotyping of Mutations - HAL
Comprehensive and Rapid Genotyping of Mutations - HAL

... majority of mutations in CBAVD are not detected by routine panels, designed to test up to 30 common severe CF mutations; they are scattered over the whole gene, so that all the exons and their flanking introns have to be extensively scanned to reach acceptable rates of mutation detection [8, 9]. The ...
DNA-Based Technologies
DNA-Based Technologies

... those bulls that do not share common alleles with the calf. Because paternity identification is a process of excluding potential sires on the basis of their genotype, it is therefore important that DNA from all possible sires be included in paternity tests. While parents can be excluded using this p ...
Shallow Gene Pool – No Diving! The Study of Cell Reproduction
Shallow Gene Pool – No Diving! The Study of Cell Reproduction

... 1. DNA – deoxyribonucleic acid, which is the genetic material of all organisms, made up of two twisted strands of sugar-phosphate molecules and nitrogen bases. 2. gene – section of DNA on a chromosome that contains instructions for making specific proteins. 3. mutation – any permanent change in a ge ...
Lab #2
Lab #2

... of difference, so use the T-test whenever it is valid. • K-S test and WMW can give you different answers: K-S detects difference of distributions, WMW detects difference of medians • Rare problem: Tied scores and small # of observations can be a problem for some implementations of the WMW test ...
Mutations
Mutations

... Incorporation of incorrect bases by DNA polymerase is exceedingly rare (< ( 10-9 in bacteria and humans) Two ways y that replication ...
Familial Adenomatous Polyposis (FAP)
Familial Adenomatous Polyposis (FAP)

... genetics service and they can be contacted for help via your GP or directly for advice. ...
What traits are carried on mobile
What traits are carried on mobile

... Despite a large and growing body of research into the molecular mechanisms of HGT, the ecological and evolutionary forces that drive these basic divisions of mobility and function are poorly understood (see, for example, Slater et al., 2008). Horizontal transfer exists largely because some MGEs can ...
General remarks: A biodesign is a man made, mostly computer
General remarks: A biodesign is a man made, mostly computer

... customer’s requirements for the biological or other like technical functionality of the DNAs or its gene products of interest. The results for this assessment of the best mode for the biodesign of gene variants are presented to the customer in a detailed report and discussed before starting the real ...
Site-Directed Mutagenesis Using Oligonucleotide
Site-Directed Mutagenesis Using Oligonucleotide

... and was preferable to the similar pKD20. However, both harbor the Red system under a well-regulated promoter to avoid undesired reactions under non-inducing conditions and a temperature-sensitive replicon to allow for easy curing of the respective plasmid after recombination (Datsenko et al., 2000). ...
disease revealed by a metagenomic approach Reduced diversity of
disease revealed by a metagenomic approach Reduced diversity of

... As most intestinal commensals cannot be cultured,4 5 genomic strategies have therefore been developed to overcome this limitation. Using classical techniques, such as temporal temperature gradient gel electrophoresis6 and single strand conformation polymorphism,7 a few studies have shown alteration ...
Genetic identification of eleven aquatic bacteria using the 16S rDNA
Genetic identification of eleven aquatic bacteria using the 16S rDNA

... To identify microorganisms by the 16S rDNA gene, PCR (polymerase chain reaction) is utilized to amplify the gene. Many database libraries, such as Entrez Gene from Refseq (Reference sequence) are used to compare gene sequences for identification and to study phylogeny and taxonomy. For example, Entr ...
1 Gene trees and species trees The lines of organismal descent that
1 Gene trees and species trees The lines of organismal descent that

... Gene trees and species trees The lines of organismal descent that make up the tree of life serve as conduits for the passage of genetic material from generation to generation. Understanding how genes pass through lines of descent is therefore needed to fully understand how traits are transmitted dow ...
926 presentation
926 presentation

... methylated and required for the silencing of H19. On the maternal chromosome the region is unmethylated and required for silencing of the Igf2 gene 90 kilobases upstream. We have proposed that the unmethylated imprinted-control region acts as a chromatin boundary that blocks the interaction of Igf2 ...
glycan associated protein of Legionella (PpiA)
glycan associated protein of Legionella (PpiA)

... PCR amplification. A 523 bp fragment encoding solely PpiA13 was amplified by polymerase chain reaction (PCR) using the bio-med Thermocycler 60 (Braun, Göttingen, Germany). Primers were selected according the sequence published by Ludwig et a/.: 13 5'GCCGGATCGTTTTATAAACTGGG 3' (position 116-139) and ...
Splice Site Prediction Using Artificial Neural Networks
Splice Site Prediction Using Artificial Neural Networks

... is in the middle of the sliding window. There are two outputs from the neural network: One for indicating acceptor splice site and one for indicating donor splice site. However, if it is only a 1.0 output when a splice site is in the middle of the window, and 0.0 when a splice site is not in the mid ...
Model Worksheet Teacher Key
Model Worksheet Teacher Key

... Model Worksheet Teacher Key Introduction Despite the complexity of life on Earth, the most important large molecules found in all living things (biomolecules) can be classified into only four main categories: carbohydrates, lipids, proteins and nucleic acids. Three of these four classes of biomolecu ...
Interactive Visualization of Gene Regulatory Networks with
Interactive Visualization of Gene Regulatory Networks with

... for visualization of gene regulatory networks. Gene regulatory networks can be represented by graphs, in which nodes represent genes, and edges represent interactions between a gene product (a regulator protein) and its target genes. The nodes have several attributes, such as position on the chromos ...
Directions and Questions for Lab 9 - San Diego Unified School District
Directions and Questions for Lab 9 - San Diego Unified School District

... three billion base pairs in length. How many fragments will be generated by digesting the DNA with the above enzyme? ...
Hypercholesterolemia
Hypercholesterolemia

... sample is cooled to a temperature between 42°C and 65°C. This “cooling” allows hybridization of a set of two small (15-30) synthetic oligonucleotides, known as “primers”, to the target region to be amplified. In this experiment, the target is the FH gene. In the third step (extension), the temperatur ...
Lecture 19 POWERPOINT here
Lecture 19 POWERPOINT here

... 10_15_DNA.microarrays .jpg ...
Lecture 1
Lecture 1

... • What are chromosomes? It is a threadlike structure found in the nucleus of the cell which is made from a long strand of DNA. Different organisms have a different number of chromosomes in their cells. • Thomas Morgan(1920s) - Evidence that genes are located on chromosomes was discovered by genetic ...
Chapter 13 - Sonoma Valley High School
Chapter 13 - Sonoma Valley High School

... Resources ...
MB_13_win
MB_13_win

... Resources ...
< 1 ... 84 85 86 87 88 89 90 91 92 ... 873 >

Helitron (biology)

A helitron is a transposon found in eukaryotes that is thought to replicate by a so-called ""rolling-circle"" mechanism. This category of transposons was discovered by Vladimir Kapitonov and Jerzy Jurka in 2001. The rolling-circle process begins with a break being made at the terminus of a single strand of the helitron DNA. Transposase then sits at this break and at another break where the helitron targets as a migration site. The strand is then displaced from its original location at the site of the break and attached to the target break, forming a circlular heteroduplex. This heteroduplex is then resolved into a flat piece of DNA via replication. During the rolling-circle process, DNA can be replicated beyond the initial helitron sequence, resulting in the flanking regions of DNA being ""captured"" by the helitron as it moves to a new location.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report