Repression by RAZ of Epstein-Barr virus bZIP transcription factor
... The 3' primer, 5' GCAAGCTTCGGTAGTGCTGCAGCAG 3', was complementary to the Z8 cDNA sequences at 622 bp from the ATG. The PCR amplified product was digested by BamHI and XmaI, and cloned into plasmid pRc-CMV to generate pCMV-FLAG-ZS. Reporter genes. The pZ-CAT reporter gene (see Fig. 2a) has been descr ...
... The 3' primer, 5' GCAAGCTTCGGTAGTGCTGCAGCAG 3', was complementary to the Z8 cDNA sequences at 622 bp from the ATG. The PCR amplified product was digested by BamHI and XmaI, and cloned into plasmid pRc-CMV to generate pCMV-FLAG-ZS. Reporter genes. The pZ-CAT reporter gene (see Fig. 2a) has been descr ...
MEF2 activity during embryogenesis - Development
... by translational and post-translational mechanisms, it has been unclear whether the presence of MEF2 transcripts in the embryo reflects transcriptionally active MEF2 proteins. To define the temporospatial expression pattern of transcriptionally active MEF2 proteins during mouse embryogenesis, we gen ...
... by translational and post-translational mechanisms, it has been unclear whether the presence of MEF2 transcripts in the embryo reflects transcriptionally active MEF2 proteins. To define the temporospatial expression pattern of transcriptionally active MEF2 proteins during mouse embryogenesis, we gen ...
Auxin Biosynthesis and Its Role in Plant Development
... There have been no reported forward genetic screens conducted systematically for the purpose of isolating auxin-deficient mutants in any systems. Part of the reason is the lack of knowledge of the developmental consequences associated with auxin deficiency. Therefore, no robust auxin-deficient trait wa ...
... There have been no reported forward genetic screens conducted systematically for the purpose of isolating auxin-deficient mutants in any systems. Part of the reason is the lack of knowledge of the developmental consequences associated with auxin deficiency. Therefore, no robust auxin-deficient trait wa ...
Analysis of the Molecular Basis of Flowering Time Variation in
... on allele functionality requires more extensive genetic analysis or transformation of the different alleles into a common genetic background. The five accessions were crossed to Col, which carries a nonfunctional FRI and a strong FLC allele (Koornneef et al., 1994) and in some cases to FRI (Sf-2)flc ...
... on allele functionality requires more extensive genetic analysis or transformation of the different alleles into a common genetic background. The five accessions were crossed to Col, which carries a nonfunctional FRI and a strong FLC allele (Koornneef et al., 1994) and in some cases to FRI (Sf-2)flc ...
Water SA
... The genus Legionella comprises more than 40 species and 64 serogroups with approximately half of those species associated with human diseases. Legionella pneumophila Serogroup 1 is the most common pathogenic species and is responsible for up to 80% of legionellosis cases in the world. Legionella lev ...
... The genus Legionella comprises more than 40 species and 64 serogroups with approximately half of those species associated with human diseases. Legionella pneumophila Serogroup 1 is the most common pathogenic species and is responsible for up to 80% of legionellosis cases in the world. Legionella lev ...
Wolbachia–host interactions: connecting phenotype to genotype
... of Wolbachia infection is rapidly expanding, our knowledge of the molecular mechanisms that mediate these outcomes is very rudimentary. A key step forward has been the recent sequencing of two complete Wolbachia genomes, that of the wMel strain that induces CI in D. melanogaster [27] and that of t ...
... of Wolbachia infection is rapidly expanding, our knowledge of the molecular mechanisms that mediate these outcomes is very rudimentary. A key step forward has been the recent sequencing of two complete Wolbachia genomes, that of the wMel strain that induces CI in D. melanogaster [27] and that of t ...
Biology 30
... Use the following information to answer the next three questions. Clomiphene citrate is a fertility drug used to induce ovulation in women. Clomiphene citrate, generally taken daily from day 3 to day 7 of the menstrual cycle, decreases the naturally circulating estrogen. The pituitary responds by i ...
... Use the following information to answer the next three questions. Clomiphene citrate is a fertility drug used to induce ovulation in women. Clomiphene citrate, generally taken daily from day 3 to day 7 of the menstrual cycle, decreases the naturally circulating estrogen. The pituitary responds by i ...
Using genetic markers to orient the edges in quantitative trait
... While gene expression traits (profiles) and clinical traits represent different quantities, both can be described in undirected trait networks. By definition, undirected association networks cannot be used to describe causal relationships between the traits. Causal information is encoded by directed ...
... While gene expression traits (profiles) and clinical traits represent different quantities, both can be described in undirected trait networks. By definition, undirected association networks cannot be used to describe causal relationships between the traits. Causal information is encoded by directed ...
Neisseria meningitidis: an overview of the carriage state
... meningitidis in the nasopharynx. Since N. meningitidis is a strict human pathogen and most patients have not been in contact with other cases, asymptomatic carriers are presumably the major source of the pathogenic strains. Most carrier isolates are shown to lack capsule production. The capsule defi ...
... meningitidis in the nasopharynx. Since N. meningitidis is a strict human pathogen and most patients have not been in contact with other cases, asymptomatic carriers are presumably the major source of the pathogenic strains. Most carrier isolates are shown to lack capsule production. The capsule defi ...
11-2 Genetics Notes
... At the beginning of the 1900s, American geneticist Thomas Hunt Morgan decided to use the common fruit fly as a model organism in his genetics experiments. The fruit fly was an ideal organism for genetics because it could produce plenty of offspring, and it did so quickly in the laboratory. ...
... At the beginning of the 1900s, American geneticist Thomas Hunt Morgan decided to use the common fruit fly as a model organism in his genetics experiments. The fruit fly was an ideal organism for genetics because it could produce plenty of offspring, and it did so quickly in the laboratory. ...
CHROMOTHRIPSIS FROM DNA DAMAGE IN MICRONUCLEI The
... The translocation junctions for long-range rearrangements had several notable features. Unlike control chromosomes, microhomology was observed at >50% of the junctions from the missegregated chromosomes, a higher frequency than expected by chance21 (Extended Data Fig. 7a). Microhomology could origin ...
... The translocation junctions for long-range rearrangements had several notable features. Unlike control chromosomes, microhomology was observed at >50% of the junctions from the missegregated chromosomes, a higher frequency than expected by chance21 (Extended Data Fig. 7a). Microhomology could origin ...
biofilm as a basic life form of bacteria
... Figure 3. Biofilm of a second day of culture (CLSM images, 2D) DISCUSSION Biofilms play an important role in the environment. In the laboratory, you can use several methods of breeding of this structure, in our experiment 6-well plates and Drip Flow Reactor in the breeding were used[16, 20,8]. In ou ...
... Figure 3. Biofilm of a second day of culture (CLSM images, 2D) DISCUSSION Biofilms play an important role in the environment. In the laboratory, you can use several methods of breeding of this structure, in our experiment 6-well plates and Drip Flow Reactor in the breeding were used[16, 20,8]. In ou ...
The Genetic, Developmental, and Molecular Bases
... is known about the alteration of fruit development during tomato domestication and to set forth a series of questions that need to be answered before we can claim any general understanding of this topic. HISTORY OF TOMATO FRUIT DOMESTICATION L. esculentum was domesticated by native Americans, possib ...
... is known about the alteration of fruit development during tomato domestication and to set forth a series of questions that need to be answered before we can claim any general understanding of this topic. HISTORY OF TOMATO FRUIT DOMESTICATION L. esculentum was domesticated by native Americans, possib ...
Heredity & Human Affairs
... In your F2 generation of flies, you count 54 red-eyed males, 50 white-eyed males, 54 red- eyed females, 50 white-eyed females. Your X2 is 0.308 . • What is the probability associated with this chi-square value? • Do you accept or reject the hypothesis? ...
... In your F2 generation of flies, you count 54 red-eyed males, 50 white-eyed males, 54 red- eyed females, 50 white-eyed females. Your X2 is 0.308 . • What is the probability associated with this chi-square value? • Do you accept or reject the hypothesis? ...
The use of genetic markers in poultry breeding
... plants. For livestock species completely inbred lines are not available. Methods using information from segregating populations have been developed in human genetics (Morton 1955; Ott 1991). Here, the influence oftheresearcher ontheexperimental design is limited. Therefore, emphasis has been on deve ...
... plants. For livestock species completely inbred lines are not available. Methods using information from segregating populations have been developed in human genetics (Morton 1955; Ott 1991). Here, the influence oftheresearcher ontheexperimental design is limited. Therefore, emphasis has been on deve ...
Male Sterility in Tomato (Lycopersicon esculentum Mill.) and Brinjal
... each in Solanum integrifolium (Habib and Swamy Rao 1973) and Solanum melongena (Chauhan 1984) however, limited number of male sterile alleles causing functional male sterility due to non-dehiscent anthers could be identified (Jasmin 1954; Nuttall 1963; Kaul 1988; Phatak and Jaworski 1989; Phatak et ...
... each in Solanum integrifolium (Habib and Swamy Rao 1973) and Solanum melongena (Chauhan 1984) however, limited number of male sterile alleles causing functional male sterility due to non-dehiscent anthers could be identified (Jasmin 1954; Nuttall 1963; Kaul 1988; Phatak and Jaworski 1989; Phatak et ...
Identification and Isolation of Dominant Susceptibility Loci for
... Rheumatoid arthritis is a chronic inflammatory autoimmune disorder, controlled by multiple genes as well as environmental factors. With animal models, like the pristane-induced arthritis (PIA) in rats, it is possible to reduce the environmental effects and the genetic heterogeneity to identify chrom ...
... Rheumatoid arthritis is a chronic inflammatory autoimmune disorder, controlled by multiple genes as well as environmental factors. With animal models, like the pristane-induced arthritis (PIA) in rats, it is possible to reduce the environmental effects and the genetic heterogeneity to identify chrom ...
This document has been downloaded from Tampub – The
... be interviewed in 147 cases. The questionnaire included a review of risk factors including hypertension, diabetes, past and recent smoking, drinking habits and previous illnesses. On the basis of these interviews, men were classified as smokers or non-smokers. Ex-smokers were included in the categor ...
... be interviewed in 147 cases. The questionnaire included a review of risk factors including hypertension, diabetes, past and recent smoking, drinking habits and previous illnesses. On the basis of these interviews, men were classified as smokers or non-smokers. Ex-smokers were included in the categor ...
Reprint
... In the early years of the twentieth century, the Danish biologist Wilhelm Johannsen laid the conceptual foundations of modern genetics and evolutionary biology by differentiating the phenotype—the traits expressed by an organism—from the genotype—the “sequestered” library of hereditary information t ...
... In the early years of the twentieth century, the Danish biologist Wilhelm Johannsen laid the conceptual foundations of modern genetics and evolutionary biology by differentiating the phenotype—the traits expressed by an organism—from the genotype—the “sequestered” library of hereditary information t ...
LOCATION OF THE CENTROMERES ON THE LINKAGE
... long arm. Translocation I-7b is far out on the long arm of chromosome I and about one-fifth of the way out on the long arm of chromosome 7. The map position of the break in chromosome I is a little to the right of br; in chromosome 7 it is a trifle less than one unit to the left of ra. This is confi ...
... long arm. Translocation I-7b is far out on the long arm of chromosome I and about one-fifth of the way out on the long arm of chromosome 7. The map position of the break in chromosome I is a little to the right of br; in chromosome 7 it is a trifle less than one unit to the left of ra. This is confi ...
LATHYROIDES, encoding a WUSCHEL
... single mutant has no visible phenotype but the prs wox1 double mutant has been shown to cause lamina reduction (Vandenbussche et al., 2009). In Petunia, a mutation of the WOX1-like gene, maewest (maw), can cause a narrowing of the lamina and defective petal fusion phenotype (Vandenbussche et al., 2 ...
... single mutant has no visible phenotype but the prs wox1 double mutant has been shown to cause lamina reduction (Vandenbussche et al., 2009). In Petunia, a mutation of the WOX1-like gene, maewest (maw), can cause a narrowing of the lamina and defective petal fusion phenotype (Vandenbussche et al., 2 ...
Gregor Mendel was a 19th century priest and botanist who
... monohybrid experiment as A + 2Aa + a, instead of AA + 2Aa + aa. Mendel may have concluded that like elements (alleles) do not pair with one another and do not segregate in plants that are not hybrids (i.e., are not heterozygotes), and that therefore a single letter was an accurate way to represent s ...
... monohybrid experiment as A + 2Aa + a, instead of AA + 2Aa + aa. Mendel may have concluded that like elements (alleles) do not pair with one another and do not segregate in plants that are not hybrids (i.e., are not heterozygotes), and that therefore a single letter was an accurate way to represent s ...
Optimal estimation of diffusion coefficients from single
... may overestimate diffusion coefficients by several times their actual values if the fluctuations are not taken into account. The increased resolution that our method offers enables us to see a clear negative correlation between a protein’s residence time on the DNA molecule and its diffusion coeffic ...
... may overestimate diffusion coefficients by several times their actual values if the fluctuations are not taken into account. The increased resolution that our method offers enables us to see a clear negative correlation between a protein’s residence time on the DNA molecule and its diffusion coeffic ...
Virulence factors of Salmonella enterica serovar Enteritidis
... humans, the infection can manifest as a non-bloody diarrhea with abdominal pain, nausea, vomiting and fever. The disease (non-typhoidal fever) is usually self-limiting and recovery follows within a few days to a week but, occasionally, systemic infection may occur in vulnerable human patients such a ...
... humans, the infection can manifest as a non-bloody diarrhea with abdominal pain, nausea, vomiting and fever. The disease (non-typhoidal fever) is usually self-limiting and recovery follows within a few days to a week but, occasionally, systemic infection may occur in vulnerable human patients such a ...
Supplementary Legends - Word file
... cytokinesis. Sister-chromatid separation defect – regression of the furrow. Several gene knockouts lead to a defect in spindle midzone formation and sister chromatid separation. These mutant embryos specify and ingress a furrow but do not complete cytokinesis. Most of the genes with this phenotype b ...
... cytokinesis. Sister-chromatid separation defect – regression of the furrow. Several gene knockouts lead to a defect in spindle midzone formation and sister chromatid separation. These mutant embryos specify and ingress a furrow but do not complete cytokinesis. Most of the genes with this phenotype b ...