• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
What is Life? - Home Page for Ross Koning
What is Life? - Home Page for Ross Koning

... 1. All living organisms consist of one or more cells. 2. Some organisms are unicellular, so cells are the fundamental unit of life. 3. New cells come from pre-existing cells by cell division. We can now add: 4. Cells must show all the properties of life. 5. All cells are basically similar in chemica ...
Job - Cloudfront.net
Job - Cloudfront.net

... ancestor and multiply apart the chloroplasts larger cell become dependent on one another ...
Book Review - Journal of Cell Science
Book Review - Journal of Cell Science

Cell structure Part 1
Cell structure Part 1

... Peripheral proteinsare located on both the interior surface and the exterior surface of the cell membrane, they are linked to lipids or other proteins. Integral proteinsextend through the cell membrane exposing it both to the outside and inside of the membrane. This allows the integral proteins to a ...
Plant and Animal Cell Poster
Plant and Animal Cell Poster

... Divide your poster paper in half. Draw the outline of an animal with an animal cell inside. Fill the space. Give it a title. Draw the outline of a plant with a plant cell inside. Fill the space. Give it a title. Label all the plant and animal organelles listed below. Use numbers and a ruler to point ...
2. Biological systems utilize free energy and molecular building
2. Biological systems utilize free energy and molecular building

... B. Growth, reproduction and dynamic homeostasis require that cells create and maintain internal environments that are different from their external environments. C. Organisms use feedback mechanisms to regulate growth and reproduction, and to maintain dynamic homeostasis. D. Growth and dynamic homeo ...
Chapt 7 Cell Structure
Chapt 7 Cell Structure

... 7. Cell Theory – The theory that explains the relationship between cells and living things is called the cell theory. The cell theory states: (1) All living things are made from one or more cells. (2) Cells come only from other cells that already exist. (3) All of an organism’s life functions occur ...
MITOTIC CELL DIVISION
MITOTIC CELL DIVISION

... • chromatids are separated at the centromere ...
Biology 123 Dr. Raut`s Class Session 6
Biology 123 Dr. Raut`s Class Session 6

... hydrophobic region with no problem. They simply follow their concentration gradient and diffuse across the membrane. Examples: oxygen and CO2 Osmosis: defined as the movement of water from an area of high free water concentration to an area of low free water molecule concentration across a selective ...
Mitosis Lab Activity
Mitosis Lab Activity

... Part B: Number of Cells in Interphase vs. M Phase How can dividing cells (in M phase) be identified when compared to non-dividing cells (in interphase)? ...
nuclear membrane
nuclear membrane

... 4. ____________________ 8. ____________________ 5. ____________________ 7. ____________________ ...
Chapter 5
Chapter 5

... considered to be a chromosome  Telophase  One complete set of chromosomes is now at each pole. A membrane forms around each set of chromosomes.  Now there are two nuclei in one cell and the new cells are ready to divide ...
cell-a-brate life
cell-a-brate life

... composed of cells. Cells are the basic building blocks of all life as we know it. Thanks to the invention of the microscope, Robert Hooke in the late 1600's was the first to named the tiny compartments of cork tree, cells. Just like we have organs that perform certain tasks, cells have tiny organs c ...
5cap` AAUGAGUACCGGGCGAUAAUC AGAAA 3`
5cap` AAUGAGUACCGGGCGAUAAUC AGAAA 3`

... List the pathway of organelles throught which it would travel before it was secreted from the cell. 1) pinches off enclosed in a vesicle 2) vesicle travels to Golgi complex where the two membranes join 3) protein moves inside Golgi complex where carbohydrates are added making the protein a glycoprot ...
Mitosis (cell division)
Mitosis (cell division)

... • Cell spends the majority of life in interphase – G1: Cells grow to mature size (growth phase) – S: Cell’s DNA is copied (synthesis phase) – G2: Cell prepares for division – G0: Cell exits cell cycle. Cells are not copying DNA or preparing to divide. (The vast majority of the body’s cells are in G0 ...
Cells (ScienceGHSGT1)
Cells (ScienceGHSGT1)

... A. uses ATP from the cell's mitochondria. B. requires twice as much energy to take place. C. uses energy from the cell's energy reserves. D. does not require energy from ATP to take place. ...
Title - Iowa State University
Title - Iowa State University

... 3.Hydrogen bond= a hydrogen covalently bound to one electronegative atom is attracted to another electronegative atom (such as N or O) ...
Unit 3 - Cells
Unit 3 - Cells

... Objective – I will compare unicellular and multicellular organisms, and give examples and advantages of each. Reference – Unit 3 book, pg. 6 Required Activity – Unicellular vs multicellular Cell Structure Objective – I will diagram various cells and discuss differences in structure. Reference – Unit ...
CHAPTER 3 NOTES – CELLS
CHAPTER 3 NOTES – CELLS

... network of membranes that produces materials for the cell. ER can be rough, meaning that is has ribosomes on it. ER can also be smooth, meaning that is does not have ribosomes on it. 3) Golgi Apparatus – Golgi is a series of flat, membrane-bound sacs where molecules are modified, packages, and distr ...
Cell Structure & Function
Cell Structure & Function

... • Is covered by a membrane which allows materials to pass. • Is the control center of the cell • Stores DNA (Which makes protein) ...
Cell Biology 2
Cell Biology 2

... small, with a plasma membrane surrounded by a rigid cell wall in many the cell wall is made of _____________ - a carbohydrate cross-linked with polypeptides cell wall may be covered with a capsule made of polysaccharides few or no membrane enclosed spaces within the cytoplasm no nucleus - DNA is in ...
TOpic 2 Revision - REVISION-IB2
TOpic 2 Revision - REVISION-IB2

... a. Animal cells are round whereas plant cells are square b. Plant cell walls are enclosed in membrane. c. Both plant and animal cells have ribosomes. d. Animal cells contain more organelles than plant cells. 6. The data in the table below shows the normal concentration of two ions inside and outside ...
Slide 1
Slide 1

...  If a cell needs a lot of energy…it will have more mitochondria ...
Unit 3: Study Guide Test Date: Objectives: Can you….? List the
Unit 3: Study Guide Test Date: Objectives: Can you….? List the

... ________________ - tough outer layer that protects bacteria, often associated with harmful bacteria ...
File
File

... In anaphase, the replicated sister chromatids which make up the chromosome are Sister separated form each other as chromatids the centromere splits. The are pulled spindle fibres shorten, pulling towards opposite poles the sister chromatids further of the cell away from each other towards the poles. ...
< 1 ... 323 324 325 326 327 328 329 330 331 ... 674 >

Cytosol



The cytosol or intracellular fluid (ICF) or cytoplasmic matrix is the liquid found inside cells. It is separated into compartments by membranes. For example, the mitochondrial matrix separates the mitochondrion into many compartments.In the eukaryotic cell, the cytosol is within the cell membrane and is part of the cytoplasm, which also comprises the mitochondria, plastids, and other organelles (but not their internal fluids and structures); the cell nucleus is separate. In prokaryotes, most of the chemical reactions of metabolism take place in the cytosol, while a few take place in membranes or in the periplasmic space. In eukaryotes, while many metabolic pathways still occur in the cytosol, others are contained within organelles.The cytosol is a complex mixture of substances dissolved in water. Although water forms the large majority of the cytosol, its structure and properties within cells is not well understood. The concentrations of ions such as sodium and potassium are different in the cytosol than in the extracellular fluid; these differences in ion levels are important in processes such as osmoregulation, cell signaling, and the generation of action potentials in excitable cells such as endocrine, nerve and muscle cells. The cytosol also contains large amounts of macromolecules, which can alter how molecules behave, through macromolecular crowding.Although it was once thought to be a simple solution of molecules, the cytosol has multiple levels of organization. These include concentration gradients of small molecules such as calcium, large complexes of enzymes that act together to carry out metabolic pathways, and protein complexes such as proteasomes and carboxysomes that enclose and separate parts of the cytosol.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report