• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Hardy-Weinberg Practice Problems
Hardy-Weinberg Practice Problems

... Odds of having two recessive alleles? ...
Screening for colorectal cancer
Screening for colorectal cancer

... a first-degree relative with colon cancer or adenomatous polyp diagnosed at age <60 years or two first-degree relatives diagnosed at any age should be advised to have screening colonoscopy starting at age 40 years or 10 years younger than the earliest diagnosis in ...
Arabidopsis Gene Project Slides
Arabidopsis Gene Project Slides

... You are working on an Arabidopsis gene discovery project, and your job is to sequence cDNAs and then learn all you can about the genes from all types of databases: DNA sequence, genome, and publication databases. Query sequence: TCCTGCATTCAATGTGATCAATGGAGGCAGTCATGCTGGGAATAGTTT GGCTATGCAAGAGTTTATGATA ...
Study Sheet 3-A
Study Sheet 3-A

... from each of the tall selected plants were grown out in the F3 generation. How many of the F3 plants would you expect to be short (dwarfs)? Well, only 200 (¼) of the F2 plants will be recessive short (tt) and these are discarded. The rest (600, made up from 200 TT and 400 Tt) are tall as so selected ...
Assignment 2
Assignment 2

... Only when both A &B are carriers for the disease causing gene, their child would manifest the disease since LD is autosomal recessive. The chance of A being a carrier is 2/3. Chance of B being carrier is 1/2. And chance of their child being homozygous recessive is 1/4. Hence 2/3 x ½ x 1/4 = 1/12, as ...
two ald “mutations”
two ald “mutations”

... Gly “fits” within DNA contact loop Asn>Tyr may provide new DNA contact (Y with PO4) Ser>Asn may provide new stabilizing H-bond to loop ...
ppt
ppt

... observed that adrenal cells of ALD patients contained characteristic lipid inclusions (fat droplets), and showed that these fat droplets consisted of cholesterol esters that contained VLCFAs (Engelen & Kemp, 2010). • 1986: Lorenzo’s Oil • 1988: First successful bone marrow transplant • 1993: ABCD1 m ...
Autoimmune and Hereditary Pancreatitis David C. Whitcomb, MD
Autoimmune and Hereditary Pancreatitis David C. Whitcomb, MD

... – Genotype: CFTRx/CFTRX (x = CFTRsev, CFTRmv or CFTRBD)*** – Diagnosis: Clinical features, + Sweat chloride or nasal potential difference + abnormal CFTR genotype. – Consider referral to a CF Center to make the diagnosis. * CFTR/SPINK1 genotypes represents a complex disorder ** BD, bicarbonate condu ...
click here
click here

... 1. The specified karyotype has two X chromosomes and no Y chromosome, so the person is a female. The female carries three copies of chromosome 21, i.e. trisomy 21 or Down Syndrome. Ans: (c) female with Down Syndrome 2, Albinism is an autosomal recessive disorder- one copy of the wild type allele is ...
Mouse Genetics
Mouse Genetics

... Chemical Mutagenesis in ES Cells  Advantages: can directly screen for mutations in gene of interest and then make mice from the mutant cells;can create an allelic series of mutations, can also vary the mutagen to induce different types of lesions  Disadvantages: like gene traps, it takes some wor ...
Slide 1
Slide 1

... transforming the native plastome into a TRANSPLASTOME (a). One of the selectable genes (aadA) is designed for exclusive expression in the chloroplast and incorporation of this marker confers spectinomycin resistance. The other gene, a neomycin phosphotransferase gene neoSTLS2 , includes a nuclear pr ...
Arrowsmith extensions to bioinformatics
Arrowsmith extensions to bioinformatics

... Linking to microarray experimental data  A = set of microarray experiments that measured reelin  C = set of microarray experiments that measured tooth ...
Alzheimer disease - GEC-KO
Alzheimer disease - GEC-KO

... Who will be offered genetic testing and what do the test results mean? • Clinical testing is currently not available for lateonset AD (LOAD) or sporadic cases • When there are multiple related affected individuals, research testing may be available • APOE 4 testing is not recommended for risk asse ...
Leukaemia Section t(12;20)(q15;q11.2) Atlas of Genetics and Cytogenetics in Oncology and Haematology
Leukaemia Section t(12;20)(q15;q11.2) Atlas of Genetics and Cytogenetics in Oncology and Haematology

... DOI: 10.4267/2042/38228 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2005 Atlas of Genetics and Cytogenetics in Oncology and Haematology ...
Your view on genetics - University of Colorado Boulder
Your view on genetics - University of Colorado Boulder

... B: I am not too familiar with genetics, but I am eager to learn more. C: I am not too familiar with genetics and I do not like it much. ...
GENE REGULATION IN HIGHER ORGANSIMS Although eukaryotes
GENE REGULATION IN HIGHER ORGANSIMS Although eukaryotes

... globin gene is beside the beta globin gene. These genes are turned on in bone marrow only, which is where all of our blood cells originate. During most of the gestation period, a fetus has fetal hemoglobin or H b - F. Hb-F is a combination of alpha2/gamma2 gene products. There are two gamma genes ju ...
Assay Summary ATM Gene Mutation Analysis
Assay Summary ATM Gene Mutation Analysis

... ATM sequence: The mutation analysis will not detect mutations located in regions of the ATM gene that are not analyzed (non-coding exon regions, intron regions other than the splice junctions, and upstream and downstream regions). The method also will not detect gross genetic alterations including d ...
Personalized Medicine Background and Challenges Geoffrey S
Personalized Medicine Background and Challenges Geoffrey S

... Although there are no applications of personalized medicine being routinely used in cardiology yet, examples from other specialties suggest what’s on the horizon E.g., HLA-B*5701 allele testing is now done before abacavir therapy to reduce the risk of hypersensitivity reactions Genetic counselors wi ...
Points /40 Grade Science 7 Quiz: Chapter 4
Points /40 Grade Science 7 Quiz: Chapter 4

... D. Sex-linked trait. Failure to blood c lot. ...
DOC
DOC

... has the disease. Since most males with the disease do not survive to reproductive age, this is an extremely unlikely event. d. A female could get the disease only by having parents who are both carriers of the disease. Because females cannot be carriers, this is an impossible event. ...
problem set5
problem set5

... 2. Why is the rate of fixation of neutral mutations (µ) independent of population size? 3. In order to root the tree of life an outgroup is required. Obviously, the entire tree of life isn’t going to have an outgroup; all life is part of the ingroup. Scientists circumvented this problem by using dup ...
Notes
Notes

... ● the result could be:  a new trait (beneficial or harmful);  a protein that does not work correctly;  miscarriage ...
NOTES: 13.3
NOTES: 13.3

... ● the result could be:  a new trait (beneficial or harmful);  a protein that does not work correctly;  miscarriage ...
von Hippel
von Hippel

... Mapped to chromosome 3p25-26 using genetic linkage analysis Has 3 exons encoding 4.7 kb mRNA Highly conserved sequence in rodents and primates Homologs in C. elegans and Drosphila ...
Final Case Study - Cal State L.A. - Cal State LA
Final Case Study - Cal State L.A. - Cal State LA

... • CD18 were not expressed. LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18) were not expressed. • Parents are carriers, and patient had two truncated mutation that interrupted highly conserved regions, losing cysteine rich transmembrane and cytoplasma domains ...
< 1 ... 245 246 247 248 249 250 251 252 253 ... 342 >

Neuronal ceroid lipofuscinosis

Neuronal ceroid lipofuscinoses (NCL) is the general name for a family of at least eight genetically separate neurodegenerative disorders that result from excessive accumulation of lipopigments (lipofuscin) in the body's tissues. These lipopigments are made up of fats and proteins. Their name comes from the word stem lipo-, which is a variation on ""lipid"" or ""fat"", and from the term pigment, used because the substances take on a greenish-yellow color when viewed under an ultraviolet light microscope. These lipofuscin materials build up in neuronal cells and many organs, including the liver, spleen, myocardium, and kidneys.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report