Flowering Newsletter bibliography for 2007
... exhibit complex interactions during Arabidopsis development. Genetics 176, 231–242. Allnutt GV, Rogers HJ, Francis D, Herbert RJ. 2007. A LEAFY-like gene in the long-day plant, Silene coeli-rosa is dramatically up-regulated in evoked shoot apical meristems but does not complement the Arabidopsis lfy ...
... exhibit complex interactions during Arabidopsis development. Genetics 176, 231–242. Allnutt GV, Rogers HJ, Francis D, Herbert RJ. 2007. A LEAFY-like gene in the long-day plant, Silene coeli-rosa is dramatically up-regulated in evoked shoot apical meristems but does not complement the Arabidopsis lfy ...
Using Transcriptional Control To Increase Titers of Secreted
... measuring secreted titer, cultures were grown for 8 h. For all other experiments, cultures were grown for 6 h. Supernatant samples were harvested from the cell culture by two sequential centrifugation steps of 2,272 ⫻ g for 10 min. Samples were precipitated in 20% trichloroacetic acid (TCA) overnigh ...
... measuring secreted titer, cultures were grown for 8 h. For all other experiments, cultures were grown for 6 h. Supernatant samples were harvested from the cell culture by two sequential centrifugation steps of 2,272 ⫻ g for 10 min. Samples were precipitated in 20% trichloroacetic acid (TCA) overnigh ...
NUCLEIC ACID CATALYSTS: COMPARING THE MECHANISMS OF
... the amount of RNA substrate and DNAzyme to be used in the dilutions were calculated for a total reaction volume of 10μL, and these dilutions were prepared. The DNAzyme sequence used was: CGCACCCAGGCTAGCTACAACGACTC, and the RNA substrate sequence used was: GGCGGAGAGAGAUGGGUG. DNAzyme and RNA Substra ...
... the amount of RNA substrate and DNAzyme to be used in the dilutions were calculated for a total reaction volume of 10μL, and these dilutions were prepared. The DNAzyme sequence used was: CGCACCCAGGCTAGCTACAACGACTC, and the RNA substrate sequence used was: GGCGGAGAGAGAUGGGUG. DNAzyme and RNA Substra ...
Expression of Allene Oxide Synthase Determines - Bio
... 4.2.1.92) catalyzes the first step in the biosynthesis of jasmonic acid from lipoxygenase-derived hydroperoxides of free fatty acids. Using the AOS cDNA from tomato (Lycopersicon esculentum), in which the role of jasmonic acid in wound-induced defense gene activation has been best described, we exam ...
... 4.2.1.92) catalyzes the first step in the biosynthesis of jasmonic acid from lipoxygenase-derived hydroperoxides of free fatty acids. Using the AOS cDNA from tomato (Lycopersicon esculentum), in which the role of jasmonic acid in wound-induced defense gene activation has been best described, we exam ...
The rapidly emerging ESBL-producing Escherichia coli O25
... (Table 2), while the WaaQ protein encoded by the MG1655 allele was identical to that of a representative R2 strain, F632. Because the function of this protein as a heptosyltransferase is completely conserved in all core types (Muller-Loennies et al., 2007), we surmise that this sequence variation is ...
... (Table 2), while the WaaQ protein encoded by the MG1655 allele was identical to that of a representative R2 strain, F632. Because the function of this protein as a heptosyltransferase is completely conserved in all core types (Muller-Loennies et al., 2007), we surmise that this sequence variation is ...
Temperate and lytic bacteriophages programmed to sensitize and
... threat of antibiotic-resistant bacteria that evades the above shortcomings. Instead of directly killing the pathogens, we propose to sensitize the pathogens on surfaces or in the human skin flora while concomitantly enriching for these sensitized populations. Patients infected by these antibiotic-se ...
... threat of antibiotic-resistant bacteria that evades the above shortcomings. Instead of directly killing the pathogens, we propose to sensitize the pathogens on surfaces or in the human skin flora while concomitantly enriching for these sensitized populations. Patients infected by these antibiotic-se ...
Ectopic induction and reorganization of Wnt-1
... 1987), Xenopus (Noordermeer et al., 1989), and zebrafish (Molven et al., 1991)). In the mouse embryo, expression in this region is very dynamic (Wilkinson et al., 1987; Bally-Cuif et al., 1992; Paar et al., 1993): it starts at the one-somite stage as a broad domain encompassing what is probably most ...
... 1987), Xenopus (Noordermeer et al., 1989), and zebrafish (Molven et al., 1991)). In the mouse embryo, expression in this region is very dynamic (Wilkinson et al., 1987; Bally-Cuif et al., 1992; Paar et al., 1993): it starts at the one-somite stage as a broad domain encompassing what is probably most ...
PROCUSTE1 Encodes a Cellulose Synthase Required for Normal
... Red (Figure 2C) or other stains. This structure presumably corresponds to cell membranes surrounding polysaccharidic material. The study of two other alleles ( prc1-3 and prc1-7; data not shown) confirmed the presence of such incomplete cell walls. In some sections (both transverse and longitudinal) ...
... Red (Figure 2C) or other stains. This structure presumably corresponds to cell membranes surrounding polysaccharidic material. The study of two other alleles ( prc1-3 and prc1-7; data not shown) confirmed the presence of such incomplete cell walls. In some sections (both transverse and longitudinal) ...
Recombination in large RNA viruses: Coronaviruses
... The effects of recombination on the evolution of coronavirus DI RNAs have also been demonstrated.25,28,29 Furthermore, in natural coronavirus infections, recombination also serves as an evolutionary tool. This is particularly evident for IBV, many field isolates of which are recombinants between var ...
... The effects of recombination on the evolution of coronavirus DI RNAs have also been demonstrated.25,28,29 Furthermore, in natural coronavirus infections, recombination also serves as an evolutionary tool. This is particularly evident for IBV, many field isolates of which are recombinants between var ...
Exam 2
... b. Would this trick work if the only selectable marker on pPH1JI was TetR? [Explain why or why not]. ...
... b. Would this trick work if the only selectable marker on pPH1JI was TetR? [Explain why or why not]. ...
SARS Outbreaks in Ontario, Hong Kong and Singapore
... • Diploid (2n): An organism or cell having two sets of chromosomes or twice the haploid number • Haploid (n): An organism or cell having only one complete set of chromosomes • Gamete: Reproductive cells involved in fertilization. The ovum is the female gamete; the spermatozoon is the male gamete. • ...
... • Diploid (2n): An organism or cell having two sets of chromosomes or twice the haploid number • Haploid (n): An organism or cell having only one complete set of chromosomes • Gamete: Reproductive cells involved in fertilization. The ovum is the female gamete; the spermatozoon is the male gamete. • ...
The Mitochondrial Genome of Chara vulgaris
... Analysis of codon usage in conserved genes and unique ORFs indicates that Chara mtDNA is more like Marchantia mtDNA than Chaetosphaeridium mtDNA. The high similarity of codon usage observed for these mtDNAs also is seen at the level of stop codons. Five of the 11 Chara mitochondrial genes ending wit ...
... Analysis of codon usage in conserved genes and unique ORFs indicates that Chara mtDNA is more like Marchantia mtDNA than Chaetosphaeridium mtDNA. The high similarity of codon usage observed for these mtDNAs also is seen at the level of stop codons. Five of the 11 Chara mitochondrial genes ending wit ...
hag expression in Bacillus subtilis is both negatively
... Miller units) (Table 3A), indicating that ScoC negatively regulates hag transcription. This result was in contrast to that observed from the transcription profiles of B. subtilis 168 and scoC4, which demonstrated decreased hag transcription in scoC4 (Caldwell et al., 2001). To determine if the negat ...
... Miller units) (Table 3A), indicating that ScoC negatively regulates hag transcription. This result was in contrast to that observed from the transcription profiles of B. subtilis 168 and scoC4, which demonstrated decreased hag transcription in scoC4 (Caldwell et al., 2001). To determine if the negat ...
PDF
... In Arabidopsis, Aux/IAA genes are one of the early auxin response gene families (Hagen and Guilfoyle, 2002). Aux/IAA proteins are short-lived transcription repressors that involve in the regulation of auxin signaling (Guilfoyle and Hagen, 2007; Guilfoyle, 2015). Most of the Aux/IAA proteins contain ...
... In Arabidopsis, Aux/IAA genes are one of the early auxin response gene families (Hagen and Guilfoyle, 2002). Aux/IAA proteins are short-lived transcription repressors that involve in the regulation of auxin signaling (Guilfoyle and Hagen, 2007; Guilfoyle, 2015). Most of the Aux/IAA proteins contain ...
The Mycobacterium tuberculosis katG promoter region contains a
... restriction sites present in the insert. These are summarized in Table 1 and Fig. 2. The construct pANIIIW (a gift from Karen Kempsall, Glaxo-Wellcome), consisting of a 170 bp PCR fragment containing the PAN promoter cloned into the T-tailed EcoRV restriction site of the vector pT7Blue (Novagen), wa ...
... restriction sites present in the insert. These are summarized in Table 1 and Fig. 2. The construct pANIIIW (a gift from Karen Kempsall, Glaxo-Wellcome), consisting of a 170 bp PCR fragment containing the PAN promoter cloned into the T-tailed EcoRV restriction site of the vector pT7Blue (Novagen), wa ...
Gene Section ALK (anaplastic lymphoma kinase) Atlas of Genetics and Cytogenetics
... 680 amino acids, 80 kDa; N-term 116 amino acids from NPM1 fused to the 563 C-term aminoacids of ALK (i.e. composed of the oligomerization domain and the metal binding site of NPM1, and the entire cytoplasmic portion of ALK); no apparent expression of the ALK/NPM1 counterpart. Characteristic localisa ...
... 680 amino acids, 80 kDa; N-term 116 amino acids from NPM1 fused to the 563 C-term aminoacids of ALK (i.e. composed of the oligomerization domain and the metal binding site of NPM1, and the entire cytoplasmic portion of ALK); no apparent expression of the ALK/NPM1 counterpart. Characteristic localisa ...
FTZFactor1 and Fushi tarazu interact via conserved nuclear receptor
... by proline residues on each side, and further away by charged residues. We now note that the central portion of this sequence matches the LXXLL consensus motif referred to as a nuclear receptor box (Heery et al., 1997). Nuclear receptor boxes are found in most coactivators of nuclear receptors. This ...
... by proline residues on each side, and further away by charged residues. We now note that the central portion of this sequence matches the LXXLL consensus motif referred to as a nuclear receptor box (Heery et al., 1997). Nuclear receptor boxes are found in most coactivators of nuclear receptors. This ...
Supplementary Table 1 Entrez Gene (http://www.ncbi.nlm.nih.gov
... with eight other POZ proteins. Specific class I and II histone deacetylases (HDACs) have been shown to interact with this protein, which suggests a possible link between the two classes of HDACs. Several transcript variants encoding different isoforms have been found for this gene. A pseudogene of t ...
... with eight other POZ proteins. Specific class I and II histone deacetylases (HDACs) have been shown to interact with this protein, which suggests a possible link between the two classes of HDACs. Several transcript variants encoding different isoforms have been found for this gene. A pseudogene of t ...
FTZ-Factor1 and Fushi tarazu interact via conserved nuclear
... by proline residues on each side, and further away by charged residues. We now note that the central portion of this sequence matches the LXXLL consensus motif referred to as a nuclear receptor box (Heery et al., 1997). Nuclear receptor boxes are found in most coactivators of nuclear receptors. This ...
... by proline residues on each side, and further away by charged residues. We now note that the central portion of this sequence matches the LXXLL consensus motif referred to as a nuclear receptor box (Heery et al., 1997). Nuclear receptor boxes are found in most coactivators of nuclear receptors. This ...
Protein A gene expression is regulated by DNA supercoiling which
... inhibitor, which relaxes DNA. Strain RN6390BF containing pE194 was grown at 37 uC in TSB medium containing different concentrations of novobiocin and the topoisomer distribution of pE194 was examined. No differences in DNA supercoiling were observed between the peak of distribution of plasmids from ...
... inhibitor, which relaxes DNA. Strain RN6390BF containing pE194 was grown at 37 uC in TSB medium containing different concentrations of novobiocin and the topoisomer distribution of pE194 was examined. No differences in DNA supercoiling were observed between the peak of distribution of plasmids from ...
The tightly regulated promoter of the xanA gene of
... homologues are present in a number of fungi, including many yeasts able to utilize oxidized purines as sole nitrogen sources. Many fungi contain homologues of xanA and we have shown that the one from Neurospora crassa fully complements a xanA deletion (Cultrone et al., 2005). In this article we inve ...
... homologues are present in a number of fungi, including many yeasts able to utilize oxidized purines as sole nitrogen sources. Many fungi contain homologues of xanA and we have shown that the one from Neurospora crassa fully complements a xanA deletion (Cultrone et al., 2005). In this article we inve ...
Missouri Western State University
... – Hin recombinase inducible expression cassette – HixC sites bracketing each pancake – RE may be needed ...
... – Hin recombinase inducible expression cassette – HixC sites bracketing each pancake – RE may be needed ...