Normal-Incidence Photoemission Electron Microscopy (NI
... same phase, which will result in constructive interference. One will find the largest electron yield at these positions. In the case “C” of Fig. 4, the fields of the laser pulse and the SPP are always of opposite phase, which will result in destructive interference and minimal electron emission. All ...
... same phase, which will result in constructive interference. One will find the largest electron yield at these positions. In the case “C” of Fig. 4, the fields of the laser pulse and the SPP are always of opposite phase, which will result in destructive interference and minimal electron emission. All ...
12. confocal microscopy.
... where we recover the dependence on angle squared, encountered in Eq. 6b. Thus, Eqs. 7c and 8 can be used as measures of transverse and longitudinal resolution, respectively, for the idealized case of infinitely broad Gaussian beams. Of course, other conventions for resolution can be used, but the de ...
... where we recover the dependence on angle squared, encountered in Eq. 6b. Thus, Eqs. 7c and 8 can be used as measures of transverse and longitudinal resolution, respectively, for the idealized case of infinitely broad Gaussian beams. Of course, other conventions for resolution can be used, but the de ...
WAVE OPTICS Jaan Kalda 1 Basics. Double slit diffraction.
... ating from a single source (this will be discussed in more details e below). Now, if all the waves originate from the same source, rc l1 ou ...
... ating from a single source (this will be discussed in more details e below). Now, if all the waves originate from the same source, rc l1 ou ...
Full-Spectrum, Angle-Resolved Reflectance and
... light from, or direct light into, non-normal angles—it is vital to characterize the wavelength-, angle-, and polarization-resolved reflectance and transmittance. The PerkinElmer Automated Reflectance/Transmittance Analyzer (ARTA) is a drop-in accessory for the LAMBDA™ 950 and LAMBDA 1050 UV/VIS/ NIR ...
... light from, or direct light into, non-normal angles—it is vital to characterize the wavelength-, angle-, and polarization-resolved reflectance and transmittance. The PerkinElmer Automated Reflectance/Transmittance Analyzer (ARTA) is a drop-in accessory for the LAMBDA™ 950 and LAMBDA 1050 UV/VIS/ NIR ...
Real-Time Multicolor DNA Detection with Chemoresponsive
... To investigate the sequence specificity of the diffraction-based assay, the hybridization of a noncomplementary target strand (an HIV target;18 5′ AGAAGATATTTGGAATAACATGACCTGGAT 3′) was monitored. Under identical hybridization conditions, using a 633 nm probe beam, a 100 nM solution of the noncomple ...
... To investigate the sequence specificity of the diffraction-based assay, the hybridization of a noncomplementary target strand (an HIV target;18 5′ AGAAGATATTTGGAATAACATGACCTGGAT 3′) was monitored. Under identical hybridization conditions, using a 633 nm probe beam, a 100 nM solution of the noncomple ...
219_cha.pdf
... Three dimensional shape measurements by non-contact optical methods have been extensively studied because of its importance in automated manufacturing, quality control of components, robotics and modeling application. Several optical surface contouring methods interferometry, light scattering, speck ...
... Three dimensional shape measurements by non-contact optical methods have been extensively studied because of its importance in automated manufacturing, quality control of components, robotics and modeling application. Several optical surface contouring methods interferometry, light scattering, speck ...
Measurement of The Nonlinear Refractive Index by Z
... coefficient n2 has units cm2 /W and values from 10−16 to 10−14 in glasses, 10−14 to 10−7 in doped glasses, 10−10 to 10−8 in organic materials and 10−10 to 10−2 in semiconductors. It depends on the polarization state of the optical beam and it is sensitive to the operating wavelength. In most cases t ...
... coefficient n2 has units cm2 /W and values from 10−16 to 10−14 in glasses, 10−14 to 10−7 in doped glasses, 10−10 to 10−8 in organic materials and 10−10 to 10−2 in semiconductors. It depends on the polarization state of the optical beam and it is sensitive to the operating wavelength. In most cases t ...
BPM Blatt 7
... by moving the specimen or by moving the beam. Specimen can be positioned in the x-y plane by moving the microscope stage in the conventional way while leaving the trap fixed on the optic axis. This is especially useful when large-scale movements are required. For small but accurate displacements, th ...
... by moving the specimen or by moving the beam. Specimen can be positioned in the x-y plane by moving the microscope stage in the conventional way while leaving the trap fixed on the optic axis. This is especially useful when large-scale movements are required. For small but accurate displacements, th ...
Two-Photon Excited Fluorescence Microscopy - Spectra
... objective on the left is focusing 405 nm light from a CW diode laser while the objective on the right is focusing 800 nm light from a femtosecond pulsed laser. When the solution is excited by a one- photon process at 405 nm, fluorescence is generated everywhere along the optical axis. Upon twophoton ...
... objective on the left is focusing 405 nm light from a CW diode laser while the objective on the right is focusing 800 nm light from a femtosecond pulsed laser. When the solution is excited by a one- photon process at 405 nm, fluorescence is generated everywhere along the optical axis. Upon twophoton ...
Controlling light-with-light without nonlinearity
... desired levels at any visible/infrared wavelength. Figure 3c shows modulation of total output intensity resulting from modulation of control intensity in the time domain. When the control beam is blocked, only the signal wave is present at the metamaterial and the standing wave regime of light–metam ...
... desired levels at any visible/infrared wavelength. Figure 3c shows modulation of total output intensity resulting from modulation of control intensity in the time domain. When the control beam is blocked, only the signal wave is present at the metamaterial and the standing wave regime of light–metam ...
Diffusion-controlled optical elements for
... ⬍500 nm兲. 共2兲 It is possible to control the residence time of the liquids in the channel and the separation between the two liquid cores in real time. This capability determines the extent of diffusive mixing of the L2 waveguide components, and thus the refractive index gradient. 共3兲 The dye molecul ...
... ⬍500 nm兲. 共2兲 It is possible to control the residence time of the liquids in the channel and the separation between the two liquid cores in real time. This capability determines the extent of diffusive mixing of the L2 waveguide components, and thus the refractive index gradient. 共3兲 The dye molecul ...
What you will need to remember from year 10…
... when waves ____ __, wavelength and direction due to entering a _________ (substance) of different optical density. When a pen is placed in water it looks like this: In this case the light rays are slowed down by the water and are _____, causing the pen to look odd. The two mediums in this example ar ...
... when waves ____ __, wavelength and direction due to entering a _________ (substance) of different optical density. When a pen is placed in water it looks like this: In this case the light rays are slowed down by the water and are _____, causing the pen to look odd. The two mediums in this example ar ...
Advances in Environmental Biology
... different numerical techniques has been the subject of intense investigation and research, recently. Employing an optimum method by regarding the condition governing these sorts of problems is a really crucial subject. Generalized Mie theory has been introduced as a regular analytical solution for s ...
... different numerical techniques has been the subject of intense investigation and research, recently. Employing an optimum method by regarding the condition governing these sorts of problems is a really crucial subject. Generalized Mie theory has been introduced as a regular analytical solution for s ...
Get PDF - OSA Publishing
... organelles is deemed to bring valuable information about cells morphology, cellular internal processes or organelles spatial distribution. A good review of the available techniques and refractive indices in the literature can be found in Ref. 1. Besides the techniques quoted in Ref. 1, different app ...
... organelles is deemed to bring valuable information about cells morphology, cellular internal processes or organelles spatial distribution. A good review of the available techniques and refractive indices in the literature can be found in Ref. 1. Besides the techniques quoted in Ref. 1, different app ...
Ellipsometer Manual
... refraction index and the extinction coefficients becomes more complicated. Phase shift and amplitude change of the light upon reflection are now also influenced by the optical properties of the substrate and the thickness of the thin film. So now we have suddenly 6 parameters that can influence an ...
... refraction index and the extinction coefficients becomes more complicated. Phase shift and amplitude change of the light upon reflection are now also influenced by the optical properties of the substrate and the thickness of the thin film. So now we have suddenly 6 parameters that can influence an ...
Electro-optical photonic circuits for classical and
... photon flux. So our aim is the use of funnel waveguides to modulate light at the single photon level, introducing artificially a dead time in the photo events so as to create a sub Poissonian distribution of photodetection. Specifically as shown in FIG.(4) we want to regularize a photon flux by inte ...
... photon flux. So our aim is the use of funnel waveguides to modulate light at the single photon level, introducing artificially a dead time in the photo events so as to create a sub Poissonian distribution of photodetection. Specifically as shown in FIG.(4) we want to regularize a photon flux by inte ...
The Focusing and Talbot Effect of Periodic Arrays of Metallic
... composed of nanoholes [1, 4, 5], nanoparticles [6, 7], nanowires [8, 9], etc. have been developed, and they allow to reduce the size of optical elements for applications such as focusing, waveguiding, sensing, and light trapping [10–12]. Arrays of metallic nanoapertures have been extensively investi ...
... composed of nanoholes [1, 4, 5], nanoparticles [6, 7], nanowires [8, 9], etc. have been developed, and they allow to reduce the size of optical elements for applications such as focusing, waveguiding, sensing, and light trapping [10–12]. Arrays of metallic nanoapertures have been extensively investi ...
Surface plasmon resonance microscopy
Surface Plasmon Resonance Microscopy (SPRM) is a label free analytical tool that combines the surface plasmon resonance of metallic surfaces with imaging of the metallic surface.The heterogeneity of the refractive index of the metallic surface imparts high contrast images, caused by the shift in the resonance angle.SPRM can achieve a thickness sensitivity of few tenths of nanometer and lateral resolution achieves values of micrometer scale.SPRM is used to characterize surfaces, self-assembled monolayers, multilayer films, metal nanoparticles, oligonucleotides arrays, binding and reduction reactions.Surface Plasmon polaritons are surface electromagnetic waves coupled to oscillating free electrons of a metallic surface that propagate along a metal/dielectric interface.Since polaritons are highly sensitive to small changes in the refractive index of the metallic material,it can be used as a biosensing tool that does not require labeling. SPRM measurements can be made in real-time.Wang and collaborators studied the binding kinetics of membrane proteins in single cells.The experimental setup of an SPRM can be seen in the Figure 1, where an adherent cell is grown on a gold film and placed in an inverted microscope, p-polarized light was used to create the surface plasmons on the gold film and a CCD camera was used to create the SPR image.