Automated extraction of mutation data from the literature: application
... terms with their true contextual meanings. For example, the term ‘T47D’ will be ignored if it is found close to the terms ‘cell line’, ‘tumour’, ‘tumor’ or ‘cancer’. This list will have to be updated manually as other point mutation-like terms are detected in the documents subsequently processed. Ho ...
... terms with their true contextual meanings. For example, the term ‘T47D’ will be ignored if it is found close to the terms ‘cell line’, ‘tumour’, ‘tumor’ or ‘cancer’. This list will have to be updated manually as other point mutation-like terms are detected in the documents subsequently processed. Ho ...
Fluorescence Spectroscopy
... Reduction in the quenching of Trp residues bound to proteins versus that of free Trp is observed, and this can arise from two factors. •quenching of Trp is reduced to that of free Trp (or indole) because the Trp is now attached to a molecule with a smaller diffusion co-efficient. For proteins greate ...
... Reduction in the quenching of Trp residues bound to proteins versus that of free Trp is observed, and this can arise from two factors. •quenching of Trp is reduced to that of free Trp (or indole) because the Trp is now attached to a molecule with a smaller diffusion co-efficient. For proteins greate ...
Blamires SJ, Wu CL, Tso IM (2012)
... protein intake regimes: high, low or no protein intake. While the relative genetic inputs into the silks of these species are unknown, species of the former two genera have been reported to exhibit high proline (,9–12%), hence most likely MaSp2 predominant, MA silks [20,21,41,42]. Species from the l ...
... protein intake regimes: high, low or no protein intake. While the relative genetic inputs into the silks of these species are unknown, species of the former two genera have been reported to exhibit high proline (,9–12%), hence most likely MaSp2 predominant, MA silks [20,21,41,42]. Species from the l ...
The Pseudomonas syringae HrpJ protein controls the secretion of
... fractions. Interestingly, the two additional putative translocator proteins, the HopAK1 harpin and HrpK1, were not detectable in the supernatant fraction of the mutant indicating that HrpJ is required for their secretion (Fig. 1B). The HopP1 harpin was secreted by the hrpJ mutant (Fig. 1B) indicatin ...
... fractions. Interestingly, the two additional putative translocator proteins, the HopAK1 harpin and HrpK1, were not detectable in the supernatant fraction of the mutant indicating that HrpJ is required for their secretion (Fig. 1B). The HopP1 harpin was secreted by the hrpJ mutant (Fig. 1B) indicatin ...
Presentation @3:30pm - Bioinformatics at School of Informatics
... target for anti-cancer therapy. Adv Exp Med Biol 472, 187-198. Demirev, P.A., Lin, J.S., Pineda, F.J., and Fenselaut, C. (2001). Bioinformatics and mass spectrometry for microorganism identification: proteome-wide posttranslational modifications and database search algorithms for characterization of ...
... target for anti-cancer therapy. Adv Exp Med Biol 472, 187-198. Demirev, P.A., Lin, J.S., Pineda, F.J., and Fenselaut, C. (2001). Bioinformatics and mass spectrometry for microorganism identification: proteome-wide posttranslational modifications and database search algorithms for characterization of ...
MORINGA OLEIFERA IN SILICO Research Article
... 3D structure of HER-2 of maximum resolution with A and B chains and with sequence from 23 to 646. Similarly, the PDB structure with ID: 2E14 was the 3D structure of ERK-2 of maximum resolution with A chain and with sequence from 1 to 360. 2E14 was later superseded by 3W55 [32]. 1S78 was the 3.2 Å X- ...
... 3D structure of HER-2 of maximum resolution with A and B chains and with sequence from 23 to 646. Similarly, the PDB structure with ID: 2E14 was the 3D structure of ERK-2 of maximum resolution with A chain and with sequence from 1 to 360. 2E14 was later superseded by 3W55 [32]. 1S78 was the 3.2 Å X- ...
Cloning, Expression and Interaction Studies of the Potential
... Halothiobacillus neapolitanus chromosomal DNA, 10 µM of the forward primer (5’GGATCCATGACACAAAATGCAGATCAATATCG3’Tm= 59.4 ºC), 10 µM of the reverse primer (5’AAGCTTTTAAAAGAACGTTTTGACGACGG3’ Tm= 58.4 ºC), 10 µL of the 5x Reaction Buffer, 1 µL of Deep Vent DNA polymerase (NEB), 2.5 mM dNTPs, and steril ...
... Halothiobacillus neapolitanus chromosomal DNA, 10 µM of the forward primer (5’GGATCCATGACACAAAATGCAGATCAATATCG3’Tm= 59.4 ºC), 10 µM of the reverse primer (5’AAGCTTTTAAAAGAACGTTTTGACGACGG3’ Tm= 58.4 ºC), 10 µL of the 5x Reaction Buffer, 1 µL of Deep Vent DNA polymerase (NEB), 2.5 mM dNTPs, and steril ...
power-point slides
... The world of B-cell epitopes is 3 dimensional and therefore more sophisticated methods must be developed ...
... The world of B-cell epitopes is 3 dimensional and therefore more sophisticated methods must be developed ...
A1071 GM Canola MON88302 AppR SD1
... The identity of MON88302-derived CP4 EPSPS was confirmed by a number of analytical techniques, namely recognition by anti-CP4 EPSPS antibody, MALDI-TOF analysis, Nterminal sequencing and enzymatic activity. Bioinformatic studies have confirmed the lack of any significant amino acid sequence similari ...
... The identity of MON88302-derived CP4 EPSPS was confirmed by a number of analytical techniques, namely recognition by anti-CP4 EPSPS antibody, MALDI-TOF analysis, Nterminal sequencing and enzymatic activity. Bioinformatic studies have confirmed the lack of any significant amino acid sequence similari ...
Classification Scheme of Eukaryotic Transcription Factors
... factors [I, 2]. They interact with the DNA of prornoters and enhancers in a more or less sequence-specific manner, recognizing defined sequence patterns and/or structural features. In contrast to prokaryotes, where the major control mechanism is to repress the normally active transcription machinery ...
... factors [I, 2]. They interact with the DNA of prornoters and enhancers in a more or less sequence-specific manner, recognizing defined sequence patterns and/or structural features. In contrast to prokaryotes, where the major control mechanism is to repress the normally active transcription machinery ...
Enzyme Hydrolyzed Collagen Protein
... Enzyme Hydrolyzed Collagen Protein Why should everyone take Hydrolyzed Collagen Protein? After water, protein is the next most plentiful component of our bodies. The body manufactures proteins to make up hair, muscles, nails, tendons, ligaments, and other body structures such as body fluids; but not ...
... Enzyme Hydrolyzed Collagen Protein Why should everyone take Hydrolyzed Collagen Protein? After water, protein is the next most plentiful component of our bodies. The body manufactures proteins to make up hair, muscles, nails, tendons, ligaments, and other body structures such as body fluids; but not ...
Assessing Side-chain Perturbations of the Protein Backbone: A
... Classification of the 20 amino acids simplifies analysis and helps uncover relationships that are important to protein structure, folding and function. Such an understanding is especially important in explaining the less-than-straightforward plasticity found between sequence and structure space. Man ...
... Classification of the 20 amino acids simplifies analysis and helps uncover relationships that are important to protein structure, folding and function. Such an understanding is especially important in explaining the less-than-straightforward plasticity found between sequence and structure space. Man ...
The role of calcium and other ions in sorting and delivery in the late
... The role of luminal H+ and Na+ ions in sorting in the endocytic pathway The acid lumen of endosomes and lysosomes is generated by the activity of the vacuolar H+ -ATPase, acting as a proton pump, present in the limiting membrane of the organelles of the endocytic pathway [1,2]. To maintain electrone ...
... The role of luminal H+ and Na+ ions in sorting in the endocytic pathway The acid lumen of endosomes and lysosomes is generated by the activity of the vacuolar H+ -ATPase, acting as a proton pump, present in the limiting membrane of the organelles of the endocytic pathway [1,2]. To maintain electrone ...
PPt Chapter 5 - columbusisd.org
... • Tertiary structure is determined by interactions between R groups, rather than interactions between backbone constituents • These interactions between R groups include hydrogen bonds, ionic bonds, hydrophobic interactions, and van der Waals interactions • Strong covalent bonds called disulfide br ...
... • Tertiary structure is determined by interactions between R groups, rather than interactions between backbone constituents • These interactions between R groups include hydrogen bonds, ionic bonds, hydrophobic interactions, and van der Waals interactions • Strong covalent bonds called disulfide br ...
Biochemistry of Sulfur
... a leader peptide with a twin-arginine translocation motif (TAT) not present in the mature protein suggesting a transport across the membrane (Fig. 7). Fe and Ni were present in membrane and in enriched hydrogenase fractions in accordance with the observed sequence similarity. The Ac. ambivalens SR g ...
... a leader peptide with a twin-arginine translocation motif (TAT) not present in the mature protein suggesting a transport across the membrane (Fig. 7). Fe and Ni were present in membrane and in enriched hydrogenase fractions in accordance with the observed sequence similarity. The Ac. ambivalens SR g ...
and phylogenetic characterization of Shuni virus Genomic
... Library Preparation Kit (Epicentre Biotechnologies, Wisconsin, United States). Both the protocol for FFPE samples and the protocol for alternative fragmentation (2 min at 85 C instead of 5 min) were utilized according to manufacturer’s instructions unless otherwise stated. The quality of the librar ...
... Library Preparation Kit (Epicentre Biotechnologies, Wisconsin, United States). Both the protocol for FFPE samples and the protocol for alternative fragmentation (2 min at 85 C instead of 5 min) were utilized according to manufacturer’s instructions unless otherwise stated. The quality of the librar ...
Plasmodium falciparum enolase - Tata Institute of Fundamental
... in high titers in Japanese and Thai P. falciparum patient sera and use of yeast enolase for immunodiagnostic purposes [15]. The activity of enolase in parasite-infected red blood cells increases 15-fold [16]. The gene for P. falciparum (strain K1) enolase (Pfen) has been cloned and characterized [ ...
... in high titers in Japanese and Thai P. falciparum patient sera and use of yeast enolase for immunodiagnostic purposes [15]. The activity of enolase in parasite-infected red blood cells increases 15-fold [16]. The gene for P. falciparum (strain K1) enolase (Pfen) has been cloned and characterized [ ...
Isotopic fractionation in proteins as a measure of hydrogen bond
... this simple model to hydrogen bonds in proteins, which are certainly complex and diverse chemical systems. First, our focus is on a small (but potentially important) sub-class of hydrogen bonds: short strong bonds. Second, we consider the simplest possible model that might capture the essential feat ...
... this simple model to hydrogen bonds in proteins, which are certainly complex and diverse chemical systems. First, our focus is on a small (but potentially important) sub-class of hydrogen bonds: short strong bonds. Second, we consider the simplest possible model that might capture the essential feat ...
Engineering subunit association of multisubunit proteins
... the high hydrophobicity of the dimer–dimer interface, which would be exposed to solvent in a dimeric streptavidin, suggests that the resulting molecule would have very low solubility in aqueous media. In agreement with the calculations, a streptavidin containing the H127D mutation formed insoluble a ...
... the high hydrophobicity of the dimer–dimer interface, which would be exposed to solvent in a dimeric streptavidin, suggests that the resulting molecule would have very low solubility in aqueous media. In agreement with the calculations, a streptavidin containing the H127D mutation formed insoluble a ...
Chemistry STUDY OF VOLUMETRIC AND VISCOMETRIC
... 0 reflects the volume change of the solute arising from the solute–solvent interactions. It means that the change in 0 at different [AcA] and temperature should reflect the changes occurring in its environment in the solution. The parameter Sv provides information regarding solute–solute interac ...
... 0 reflects the volume change of the solute arising from the solute–solvent interactions. It means that the change in 0 at different [AcA] and temperature should reflect the changes occurring in its environment in the solution. The parameter Sv provides information regarding solute–solute interac ...
UvA-DARE (Digital Academic Repository) The role of yeast NAD+
... Too characterize the RNA-binding property of Idh, we wanted to analyze RNAbindingg mutants which were still enzymatically active. Since no obvious RNAbindingg domain was found in Idh, we screened two other yeast species (K. lactis and S.S. pombe) for the RNA-binding capacity of their NAD-Idh's (chap ...
... Too characterize the RNA-binding property of Idh, we wanted to analyze RNAbindingg mutants which were still enzymatically active. Since no obvious RNAbindingg domain was found in Idh, we screened two other yeast species (K. lactis and S.S. pombe) for the RNA-binding capacity of their NAD-Idh's (chap ...
A Multiscale Approach to Modelling Drug Metabolism by Membrane
... limitations on both the timescale of the simulation, and the level of detail that can be studied. Computational approaches that utilise more than one type of method (socalled ‘multiscale methods’) allow the size of system, and timescale of study, to be increased. Membrane-bound proteins, such as cyt ...
... limitations on both the timescale of the simulation, and the level of detail that can be studied. Computational approaches that utilise more than one type of method (socalled ‘multiscale methods’) allow the size of system, and timescale of study, to be increased. Membrane-bound proteins, such as cyt ...
Protein–protein interaction
Protein–protein interactions (PPIs) refer to physical contacts established between two or more proteins as a result of biochemical events and/or electrostatic forces.In fact, proteins are vital macromolecules, at both cellular and systemic levels, but they rarely act alone. Diverse essential molecular processes within a cell are carried out by molecular machines that are built from a large number of protein components organized by their PPIs. Indeed, these interactions are at the core of the entire interactomics system of any living cell and so, unsurprisingly, aberrant PPIs are on the basis of multiple diseases, such as Creutzfeld-Jacob, Alzheimer's disease, and cancer.PPIs have been studied from different perspectives: biochemistry, quantum chemistry, molecular dynamics, signal transduction, among others. All this information enables the creation of large protein interaction networks – similar to metabolic or genetic/epigenetic networks – that empower the current knowledge on biochemical cascades and disease pathogenesis, as well as provide putative new therapeutic targets.