• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Translation
Translation

... Two major stages involved: • The first stage is called transcription – The 2 strands of the DNA molecule unwind and mRNA copies the genetic code (letters A, C, G and T) from DNA, the master molecule. ...
Lec. 25 - Translation 3
Lec. 25 - Translation 3

... • Are there any potential deficiencies with this model or the data that support it? • How could it be made stronger? ...
Translation and Protiens
Translation and Protiens

... cellbio.utmb.edu/cellbio/ribosome.htm ...
Making Proteins
Making Proteins

... mRNA codon in the “A” site aligning the appropriate amino acid next to “Met.” • Ribosome forms a peptide bond between “Met” and the 2nd amino acid and it passes the elongating polypetide chain to the tRNA in the “A” site ...
Genes - University of Arizona | Ecology and Evolutionary Biology
Genes - University of Arizona | Ecology and Evolutionary Biology

... •Genes that encode proteins are transcribed and the transcript is processed to make mRNA. •Next the base sequence in the mRNA must be translated into amino acid sequences in a polypeptide. •Once polypeptides are formed, they fold up and combine with other molecules, but this is the realm of biochemi ...
Translasyon
Translasyon

... • Have extensive 2o structure • Acceptor arm – position where amino acid attached • Anticodon – complementary to mRNA • Several covalently modified bases • Gray bases are conserved between tRNAs ...
DNA, RNA, and Protein
DNA, RNA, and Protein

... DNA:5’TACCGACTTGATCATTTAGGTAGACAT…3’ mRNA:AUGGCUGAACUAGUAAAUCCAUCUGUA… • mRNA exits nucleus after processing cap & tail • mRNA on ribosome is translated via tRNAs. • tRNA anticodons pair with mRNA codons (UAA, UAG, UGA). • Each tRNA carries a specific amino acid or a stop signal. ...
The Central Dogma of Genetics
The Central Dogma of Genetics

... processed, then leaves nucleus through pores in nuclear envelope. ...
Three-Point Binding Model
Three-Point Binding Model

... template synthesis): Ribosome holds pieces together  Ribosome is cellular “workbench” ...
Protein Synthesis (DNA) Vocab
Protein Synthesis (DNA) Vocab

... Protein Synthesis (DNA) ...
Unit I
Unit I

... processes, transcription and translation, that make use of another nucleic acid, RNA. RNA, like DNA, is made up of a chain of nucleotides. I transcription, enzymes catalyze the transfer of DNA’s information to messenger RNA (mRNA) molecules. The mRNA molecules then move out of the nucleus to the rib ...
Name
Name

... d. the rbs binds to a complementary region within the small ribosomal subunit e. none of the above 4. Which of the following is not a property of an anticodon? a. corresponds to the amino acid it carries b. complementary to the codon c. modified bases are often found within it d. the wobble position ...
Chapter 17 Power Point
Chapter 17 Power Point

... genome than what was expected • The human genome contains about 21,000 protein-encoding genes, but the total number of proteins in human cells is estimated to be between 250,000 to one million. ...
CHAPTER 12
CHAPTER 12

... C9. The codon is 5–CCA–3, which specifies proline. C10. It can recognize 5–GGU–3, 5–GGC–3, and 5–GGA–3. All of these specify glycine. C12. All tRNA molecules have some basic features in common. They all have a cloverleaf structure with three stemloop structures. The second stem-loop contains ...
Protein Synthesis: A Real Adventure
Protein Synthesis: A Real Adventure

... 4. The tRNA student will bring the word back to the ribosome. 5. The rRNA student will write down each word as delivered by the tRNA 6. After completing the sentence, a student in the group will tell your teacher the sentence. If correct, you may pick another DNA template, if not the group may go ov ...
Translation and the Genetic Code
Translation and the Genetic Code

... responsible for nit picky details like "How many proteins are there in the small subunit of a eukaryotic ribosome?" The process of translation can be divided into three main phases: initiation, during which the ribosomal subunits join the mRNA and locate the AUG initiator (start) codon; elongation, ...
Lecture 24 – PDF
Lecture 24 – PDF

... 2. Transfer RNAs: small molecules that are 4S or 70-90 nucleotides long. a) There are from 1-4 tRNA genes for each of the common 20 amino acid molecules. b) Amino amino acids are “loaded” onto tRNAs by amino acid-activating enzymes called amino-acyl tRNA synthetases. There is at least one amino-acid ...
Protein Synthesis
Protein Synthesis

... Before mRNA leaves the nucleus • When the mRNA molecule is created, there are 2 sections of the molecule, INTRONS and EXONS. • Exons = the code that is useful for transcripting into proteins • Introns = are not useful • An enzyme splices the introns, puts together the useful sections (exons) ...
DNA Quiz Review - OG-Science
DNA Quiz Review - OG-Science

... mRNA – carries code from DNA out into cytoplasm; codons on mRNA code for 1 amino acid tRNA – transfers amino acids to the ribosome based on mRNA codons ...
Translation Details
Translation Details

... DNA and Translation • Gene: section of DNA that creates a specific protein – Approx 25,000 human genes • Proteins are used to build cells and tissue • Protein synthesis involves two processes: 1) Transcription 2) Translation ...
Protein Synthesis Worksheet
Protein Synthesis Worksheet

... 15. (tRNA / mRNA) brings amino acids to the ribosome. 16. tRNA is found in the (nucleus / cytoplasm). 17. (Translation / Transcription) converts mRNA into a protein. 18. Translation takes place in the (cytoplasm / nucleus). 19. (one / three) codons equals one amino acid. 20. (amino acids / nucleotid ...
Protein Synthesis Poster
Protein Synthesis Poster

... Folding allows the Protein to reach its 3D (Tertiary Shape) which influences its function ...
Revision - Mr C Biology
Revision - Mr C Biology

... Folding allows the Protein to reach its 3D (Tertiary Shape) which influences its function ...
Valyl tRNA-Synthestase - Illinois State University
Valyl tRNA-Synthestase - Illinois State University

... Coiled-Coil Domain ...
Protein synthesis
Protein synthesis

... polypeptide chains  Many polypeptide chains are covalently modified, either while they are still attached to the ribosome (cotranslational) or after their synthesis has been completed (posttranslational).  These modifications may include removal of part of the translated sequence, or the covalent ...
< 1 ... 67 68 69 70 71 72 73 74 75 ... 84 >

Transfer RNA



A transfer RNA (abbreviated tRNA and archaically referred to as sRNA, for soluble RNA) is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length, that serves as the physical link between the mRNA and the amino acid sequence of proteins. It does this by carrying an amino acid to the protein synthetic machinery of a cell (ribosome) as directed by a three-nucleotide sequence (codon) in a messenger RNA (mRNA). As such, tRNAs are a necessary component of translation, the biological synthesis of new proteins according to the genetic code.The specific nucleotide sequence of an mRNA specifies which amino acids are incorporated into the protein product of the gene from which the mRNA is transcribed, and the role of tRNA is to specify which sequence from the genetic code corresponds to which amino acid. One end of the tRNA matches the genetic code in a three-nucleotide sequence called the anticodon. The anticodon forms three base pairs with a codon in mRNA during protein biosynthesis. The mRNA encodes a protein as a series of contiguous codons, each of which is recognized by a particular tRNA. On the other end of the tRNA is a covalent attachment to the amino acid that corresponds to the anticodon sequence. Each type of tRNA molecule can be attached to only one type of amino acid, so each organism has many types of tRNA (in fact, because the genetic code contains multiple codons that specify the same amino acid, there are several tRNA molecules bearing different anticodons which also carry the same amino acid).The covalent attachment to the tRNA 3’ end is catalyzed by enzymes called aminoacyl tRNA synthetases. During protein synthesis, tRNAs with attached amino acids are delivered to the ribosome by proteins called elongation factors (EF-Tu in bacteria, eEF-1 in eukaryotes), which aid in decoding the mRNA codon sequence. If the tRNA's anticodon matches the mRNA, another tRNA already bound to the ribosome transfers the growing polypeptide chain from its 3’ end to the amino acid attached to the 3’ end of the newly delivered tRNA, a reaction catalyzed by the ribosome.A large number of the individual nucleotides in a tRNA molecule may be chemically modified, often by methylation or deamidation. These unusual bases sometimes affect the tRNA's interaction with ribosomes and sometimes occur in the anticodon to alter base-pairing properties.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report