Article (Author postprint)
... adaptive immune response, DCs are an attractive target for therapeutic manipulation of the immune system [3]. In fact, DC physiology is one of the research areas where basic knowledge has been more readily translated into clinical applications. DC-based vaccines have been rapidly transferred from th ...
... adaptive immune response, DCs are an attractive target for therapeutic manipulation of the immune system [3]. In fact, DC physiology is one of the research areas where basic knowledge has been more readily translated into clinical applications. DC-based vaccines have been rapidly transferred from th ...
Fc receptors: Cell activators of antibody functions
... while FcγRIIB has a different tyrosine-containing motif involved in negative signaling. This motif is known as ITIM, for immunoreceptor tyrosine-based inhibition motif [27]. FcγRIII has two isoforms: FcγRIIIA is a receptor with a transmembrane portion and a cytoplasmic tail, associated with an ITAM- ...
... while FcγRIIB has a different tyrosine-containing motif involved in negative signaling. This motif is known as ITIM, for immunoreceptor tyrosine-based inhibition motif [27]. FcγRIII has two isoforms: FcγRIIIA is a receptor with a transmembrane portion and a cytoplasmic tail, associated with an ITAM- ...
Veterinary Immunology and Immunopathology
... CD21 and IgM in these tissues in both newborns and 7-month-old calves. Because CD21 is the receptor for complement C3d, these findings suggest that B cells in the lymphoid tissues of newborns can be activated by complement-containing antigen or adjuvants (Pihlgren et al., 2004). A recent study has sh ...
... CD21 and IgM in these tissues in both newborns and 7-month-old calves. Because CD21 is the receptor for complement C3d, these findings suggest that B cells in the lymphoid tissues of newborns can be activated by complement-containing antigen or adjuvants (Pihlgren et al., 2004). A recent study has sh ...
Bile acids in regulation of inflammation and immunity: friend or foe?
... endocrine functions. As such BAs are natural ligands for several nuclear hormone receptors and G-protein-coupled receptors. Through activating various signalling pathways, BAs not only regulate their own synthesis, enterohepatic recirculation and metabolism, but also immune homeostasis. This makes B ...
... endocrine functions. As such BAs are natural ligands for several nuclear hormone receptors and G-protein-coupled receptors. Through activating various signalling pathways, BAs not only regulate their own synthesis, enterohepatic recirculation and metabolism, but also immune homeostasis. This makes B ...
The function of Fcγ receptors in dendritic cells and macrophages
... neonatal FcR (FcRn)3 and the intracellular FcR tripartite motif-containing protein 21 (TRIM21)4,5, which bind to immunoglobulins following their internalization. The various FcγRs are functionally divided into activating and inhibitory receptors. Activating FcγRs have an immunoreceptor tyrosine-base ...
... neonatal FcR (FcRn)3 and the intracellular FcR tripartite motif-containing protein 21 (TRIM21)4,5, which bind to immunoglobulins following their internalization. The various FcγRs are functionally divided into activating and inhibitory receptors. Activating FcγRs have an immunoreceptor tyrosine-base ...
The Role of Indoleamine 2, 3-Dioxygenase in Immune Suppression
... cells), myocytes (muscle cells) and adipocytes (fat cells). Mesenchymal stem cells provide a basis for improved tissue regeneration and gene therapy [17,18]. Although MSCs are mostly noted for their progenitor abilities, they also possess a broad immunological capacity. Earlier studies indicate that ...
... cells), myocytes (muscle cells) and adipocytes (fat cells). Mesenchymal stem cells provide a basis for improved tissue regeneration and gene therapy [17,18]. Although MSCs are mostly noted for their progenitor abilities, they also possess a broad immunological capacity. Earlier studies indicate that ...
Beta 1-adrenergic receptor-directed autoimmunity as a cause of
... autoantibodies directed against these loops can (a) interfere with ligand binding, (b) alter receptor conformation, and thereby also (c) affect receptor activity [16,30]. The sequence of pathophysiological events, however, which leads to the generation of functionally active anti-β1AR in the human h ...
... autoantibodies directed against these loops can (a) interfere with ligand binding, (b) alter receptor conformation, and thereby also (c) affect receptor activity [16,30]. The sequence of pathophysiological events, however, which leads to the generation of functionally active anti-β1AR in the human h ...
O-Linked Glycoproteins - Sigma
... Golgi, and no oligosaccharide precursor is required for protein transfer. The serine/threonine residues are modified directly by covalent addition of N-acetylgalactosamine residues. Initiation of mucin-type O-glycosylation is dependent upon polypeptide N-acetylgalactosyl transferase (ppGalNAcT); at ...
... Golgi, and no oligosaccharide precursor is required for protein transfer. The serine/threonine residues are modified directly by covalent addition of N-acetylgalactosamine residues. Initiation of mucin-type O-glycosylation is dependent upon polypeptide N-acetylgalactosyl transferase (ppGalNAcT); at ...
Regulated MIP-3/CCL20 production by human intestinal epithelium
... that intestinal epithelium may also have the capacity to play a role in signaling host adaptive immunity. The CC chemokine macrophage inflammatory protein (MIP)-3␣/CCL20 is chemotactic for immature dendritic cells and CD45RO⫹ T cells that are important components of the host adaptive immune system. ...
... that intestinal epithelium may also have the capacity to play a role in signaling host adaptive immunity. The CC chemokine macrophage inflammatory protein (MIP)-3␣/CCL20 is chemotactic for immature dendritic cells and CD45RO⫹ T cells that are important components of the host adaptive immune system. ...
Cytochrome P450s in human immune cells regulate IL-22
... responses, and thus, translates environmental signals into immunological actions16. However, AHR activation by different ligands do not result in one specific immune response but rather in divergent, ligand-dependent immunological outcomes such as inflammation or tolerogenic responses17–19. AHR is w ...
... responses, and thus, translates environmental signals into immunological actions16. However, AHR activation by different ligands do not result in one specific immune response but rather in divergent, ligand-dependent immunological outcomes such as inflammation or tolerogenic responses17–19. AHR is w ...
No Slide Title - University of Nottingham
... Variable regions is likely to be only one factor controlling the immunogenicity of therapeutic antibodies. However it is the final sequence of the antibodies which matters and not the route by which they were made. For example it is possible to come up with alternative humanised sequences for the sa ...
... Variable regions is likely to be only one factor controlling the immunogenicity of therapeutic antibodies. However it is the final sequence of the antibodies which matters and not the route by which they were made. For example it is possible to come up with alternative humanised sequences for the sa ...
Review Article - clinicalevidence
... tion in T cells. PepG is also reported to stimulate endothelial cells directly (80). When a mixed suspension of PepG and LTA was added to endothelial cells in vitro, enhanced adhesiveness for granulocytes were noted after 24 h. This corresponded with increased expression of intracellular adhesion mo ...
... tion in T cells. PepG is also reported to stimulate endothelial cells directly (80). When a mixed suspension of PepG and LTA was added to endothelial cells in vitro, enhanced adhesiveness for granulocytes were noted after 24 h. This corresponded with increased expression of intracellular adhesion mo ...
Insights into Seven and Single Transmembrane
... regulating the innate and adaptive immune responses by secreting CCL3, CCL4, CCL5, or XCL1 chemokines (Taub et al., 1995; Inngjerdingen et al., 2001) or cytokines such as granulocyte-macrophage colony-stimulating factor, tumor necrosis factor-␣, or IFN-␥ (Biron et al., 1999; Cooper et al., 2001). In ...
... regulating the innate and adaptive immune responses by secreting CCL3, CCL4, CCL5, or XCL1 chemokines (Taub et al., 1995; Inngjerdingen et al., 2001) or cytokines such as granulocyte-macrophage colony-stimulating factor, tumor necrosis factor-␣, or IFN-␥ (Biron et al., 1999; Cooper et al., 2001). In ...
MORINGA OLEIFERA IN SILICO Research Article
... Prostate cancer is the most prevalent cancer afflicting men. The cancer cells may metastasize from the prostate to other parts of the body, particularly bones and lymph nodes [1]. The risk increase when the cancer progresses from androgen-dependent to androgenindependent stage [2]. PC3 cell lines ar ...
... Prostate cancer is the most prevalent cancer afflicting men. The cancer cells may metastasize from the prostate to other parts of the body, particularly bones and lymph nodes [1]. The risk increase when the cancer progresses from androgen-dependent to androgenindependent stage [2]. PC3 cell lines ar ...
Lactobacillus paracasei Lpc-37
... with pathogens for adhesion sites or nutritional sources, inhibition of the production or action of bacterial toxins, ability to coaggregate with pathogens, and the stimulation of the immune system. ...
... with pathogens for adhesion sites or nutritional sources, inhibition of the production or action of bacterial toxins, ability to coaggregate with pathogens, and the stimulation of the immune system. ...
Type i and type ii Fc receptors regulate innate and adaptive immunity
... and sialic acid residues compared with bulk antibodies present in the steady state23,26,27. These differences are observed in not only mouse models of autoimmunity, such as the K/BxN and MRL/lpr strains that develop rheumatoid arthritis–like disease, but also cohorts of patients with rheumatoid arth ...
... and sialic acid residues compared with bulk antibodies present in the steady state23,26,27. These differences are observed in not only mouse models of autoimmunity, such as the K/BxN and MRL/lpr strains that develop rheumatoid arthritis–like disease, but also cohorts of patients with rheumatoid arth ...
Enhanced anti-tumor immune responses and delay of tumor development in human
... Introduction: Cancer vaccines have the potential to induce curative anti-tumor immune responses and better adjuvants may improve vaccine efficacy. We have previously shown that Hp91, a peptide derived from the B box domain in high-mobility group box protein 1 (HMGB1), acts as a potent immune adjuvan ...
... Introduction: Cancer vaccines have the potential to induce curative anti-tumor immune responses and better adjuvants may improve vaccine efficacy. We have previously shown that Hp91, a peptide derived from the B box domain in high-mobility group box protein 1 (HMGB1), acts as a potent immune adjuvan ...
Immunodeficient Mouse Models
... component deficiency in mice is less severe than the Xlinked combined immunodeficiency disease (SCIDX1), which is lethal to humans [20]. The creation of IL2rg-/mouse strain has allowed the development of many alymphoid mice strains that are much less efficient in human cells and tissue rejection [ ...
... component deficiency in mice is less severe than the Xlinked combined immunodeficiency disease (SCIDX1), which is lethal to humans [20]. The creation of IL2rg-/mouse strain has allowed the development of many alymphoid mice strains that are much less efficient in human cells and tissue rejection [ ...
C-type lectins in immunity: recent developments
... (ITAM)-like motif within their cytoplasmic tails (such as Dectin-1, Clec-2, and DNGR-1), or via association with ITAM-bearing FcRg adaptor molecules (such as Dectin2, CLECSF8 and Mincle) [3,4] (see Table 1). Activation of these receptors leads to intracellular signalling through Syk-dependent and S ...
... (ITAM)-like motif within their cytoplasmic tails (such as Dectin-1, Clec-2, and DNGR-1), or via association with ITAM-bearing FcRg adaptor molecules (such as Dectin2, CLECSF8 and Mincle) [3,4] (see Table 1). Activation of these receptors leads to intracellular signalling through Syk-dependent and S ...
The Antiallergic Mast Cell Stabilizers Lodoxamide and Bufrolin as
... Cloning of Human GPR35b. Human GPR35b, containing a FLAG epitope (amino acid sequence DYKDDDDK) at the N terminus, was produced from cDNA generated from HT29 cells by polymerase chain reaction using the following primers: sense, 59ACTCAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGCTGAGTGGTTCCCGGG 39; and a ...
... Cloning of Human GPR35b. Human GPR35b, containing a FLAG epitope (amino acid sequence DYKDDDDK) at the N terminus, was produced from cDNA generated from HT29 cells by polymerase chain reaction using the following primers: sense, 59ACTCAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGCTGAGTGGTTCCCGGG 39; and a ...
The Antiallergic Mast Cell Stabilizers Lodoxamide and Bufrolin as
... Cloning of Human GPR35b. Human GPR35b, containing a FLAG epitope (amino acid sequence DYKDDDDK) at the N terminus, was produced from cDNA generated from HT29 cells by polymerase chain reaction using the following primers: sense, 59ACTCAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGCTGAGTGGTTCCCGGG 39; and a ...
... Cloning of Human GPR35b. Human GPR35b, containing a FLAG epitope (amino acid sequence DYKDDDDK) at the N terminus, was produced from cDNA generated from HT29 cells by polymerase chain reaction using the following primers: sense, 59ACTCAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGCTGAGTGGTTCCCGGG 39; and a ...
Internalization of the Granulocyte-Macrophage
... Receptor internalization appears to be a general property of the hematopoietin receptors, either in response to binding of specific ligandz4"' or in response to activation of a receptor for another CSF (receptor tran~modulation).~~"~ It has previously been shown that there is a hierarchical transmod ...
... Receptor internalization appears to be a general property of the hematopoietin receptors, either in response to binding of specific ligandz4"' or in response to activation of a receptor for another CSF (receptor tran~modulation).~~"~ It has previously been shown that there is a hierarchical transmod ...
Activin Receptor IIB human (A9579) - Datasheet - Sigma
... homology of their kinase domains and other structural and functional features. To date, seven type I and five type II activin receptors have been cloned from mammals, including activin receptor IA, activin receptor IIA, activin receptor IB, and activin receptor IIB. In addition, two splice variants ...
... homology of their kinase domains and other structural and functional features. To date, seven type I and five type II activin receptors have been cloned from mammals, including activin receptor IA, activin receptor IIA, activin receptor IB, and activin receptor IIB. In addition, two splice variants ...
Acid-Base_Handling
... – Low filtered [Cl-] increases H+ secretion • Cl- is passively cosecreted with H+ secretion via H+ATPase to maintain electroneutrality thus ability to secrete H+ is enhanced with low tubular fluid [Cl-] • In setting of low tubular fluid [Cl-], Na+ reabsorption must be accompanied by H+ or K+ secreti ...
... – Low filtered [Cl-] increases H+ secretion • Cl- is passively cosecreted with H+ secretion via H+ATPase to maintain electroneutrality thus ability to secrete H+ is enhanced with low tubular fluid [Cl-] • In setting of low tubular fluid [Cl-], Na+ reabsorption must be accompanied by H+ or K+ secreti ...
Activation the Human Diseases Associated with Immune
... (26), and Siglec-H has been shown to affect signaling in plasmacytoid dendritic cells (34). For T cell activation to occur, two signals are usually required: engagement of the TCR after recognition of the Ag/MHC-complex on the surface of APCs and costimulation of CD28 by its natural ligands, CD80 an ...
... (26), and Siglec-H has been shown to affect signaling in plasmacytoid dendritic cells (34). For T cell activation to occur, two signals are usually required: engagement of the TCR after recognition of the Ag/MHC-complex on the surface of APCs and costimulation of CD28 by its natural ligands, CD80 an ...
12-Hydroxyeicosatetraenoic acid
12-Hydroxyeicosatetraenoic acid (12-HETE) is a derivative of the 20 carbon polyunsaturated fatty acid, arachidonic acid, containing a Hydroxyl residue at carbon 12 and a 5Z,8Z,10E,14Z Cis–trans isomerism configuration (Z=cis, E=trans) in its four double bonds. It was first found as a product of arachidonic acid metabolism made by human and bovine platelets. However, the term 12-HETE is ambiquous in that it has been used to indicate not only the initially detected ""S"" stereoisomer, 12(S)-hydroxy-5Z,8Z,10E,14Z-eicosatetraenoic acid (12(S)-HETE or 12S-HETE), made by platelets, but also the later detected R stereoisomer, 12(R)-hydroxy-5Z,8Z,10E,14Z-eicosatetraenoic acid (12(R)-HETE or 12R-HETE) made by other tissues. The two isomers, either directly or after being further metabolized, have been suggested to be involved in a variety of human physiological and pathological reactions. Unlike hormones which are secreted by cells, travel in the circulation to alter the behavior of distant cells, and thereby act as Endocrine signalling agents, these arachidonic acid metabolites act locally as Autocrine signalling agents to regulate the behavior of their cells of origin or as Paracrine signalling agents to regulate the function of nearby cells. In these roles, they may amplify or dampen, expand or contract cellular and tissue responses to disturbances.