• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Website #1: http://sheppardsoftware.com/health/anatomy/cell/index
Website #1: http://sheppardsoftware.com/health/anatomy/cell/index

... 8. Nucleus is called the ______________________ of the cell. It is a large __________ spot in eukaryotic cells. It ___________________ all cell activity. The nuclear membrane has many _________________. The thick ropy strands are the _______________________. The large solid spot is the _____________ ...
Cell Structure and Function Chapter 4 Biology 100
Cell Structure and Function Chapter 4 Biology 100

... In exocytosis a membrane-bound sac (a vesicle) fuses with a membrane and dumps the fluid contents outside the membrane (usually outside the cell).  Endocytosis is the reverse of exocytosis. ...
L2 Magnification and cell components
L2 Magnification and cell components

... • There is a space between these two membranes • The inner membrane has folds which are called CRISTAE. These are surrounded by the MATRIX – a jelly-like substance which contains mitochondrial DNA and RIBOSOMES. ...
Microbiology
Microbiology

... a triangle. A pH range from 3.5 (H+) to 10 (OH-) was used for the isoelectric focusing. The estimated molecular masses of the standard proteins are shown. ...
Unicellular Organisms - hrsbstaff.ednet.ns.ca
Unicellular Organisms - hrsbstaff.ednet.ns.ca

... Most people become aware of microorganisms when they get sick. However, it is unfair to think of microorganisms just in terms of disease. It’s true that they cause many diseases, but most are harmless and many are even helpful, as you can see in Figure 1. Dairy products such as buttermilk, cottage c ...
Introduction to Biology Chapter 3 Notes: Cell Structure
Introduction to Biology Chapter 3 Notes: Cell Structure

... membranes forming channels within the cell. Covered with ribosomes (causing the "rough" appearance) which are in the process of synthesizing proteins. ...
Prokaryotic and Eukaryotic Cells Student Guide
Prokaryotic and Eukaryotic Cells Student Guide

... reticulum, mitochondria, and vacuoles. •  Has nucleus – DNA enclosed inside a membrane-bound nucleus. •  Can be unicellular organisms or found in multi-cellular organism. •  Plants and animals are examples of multi-celled eukaryotic organisms. Use your constructed booklet and this Student Guide to c ...
PROPERTY OF: BIOLOGY – UNIT 3 – CHAPTER 18 NOTES
PROPERTY OF: BIOLOGY – UNIT 3 – CHAPTER 18 NOTES

... EX: homologous structures (similar body parts that evolved from a common ancestor) vs. analogous structures (similar body parts that evolved from different origins) genetic similarities = similarities in DNA or protein sequences EX: cytochrome c = a protein found on the electron transport chain, fou ...
Cell structure and functions
Cell structure and functions

...  Differences between Procaryotic & ...
A Tour of the Cell www.probes.com
A Tour of the Cell www.probes.com

... Atoms ...
Cell Analogy Worksheet
Cell Analogy Worksheet

... Task 1: Create analogies between a plant cell’s parts and a city’s (or any analogy’s) parts by completing the Cell Analogy worksheet. A must: When making the analogies between your cell and your city (or other analogy), the functions of the city part and cell part must match, not the appearance! Thi ...
Ενδοκυττάρια ∆ιαµερίσµατα, ∆ιαλογή και µεταφορά πρωτεινών
Ενδοκυττάρια ∆ιαµερίσµατα, ∆ιαλογή και µεταφορά πρωτεινών

... • Genetic analyses (fungal genetics) • In vitro import assay system with isolated functional mitochondria – Chemical Crosslinking – Biochemical reconstitution ...
Cell Features
Cell Features

... Enable movement Rotate and propel bacteria through its environment at speeds of up to 20 cell lengths per second ...
Early History of Earth
Early History of Earth

... • Over time, these heterotrophs would have used up the food supply. • Heterotrophs are organisms which obtain their food from other heterotrophs or autotrophs (plants). ...
Organization of the Cell
Organization of the Cell

... Small molecules Atoms ...
Cell City Analogy - Rochester Community Schools
Cell City Analogy - Rochester Community Schools

... export. Sometimes bolts don't turn out right, and the "rejects" are sent to the scrap yard/recycling center where they are broken down for parts or destroyed altogether. The town powers the bolt shops and carts from a hydraulic dam that is the city’s power station. A large wooden fence encloses the ...
Introduction to Cells
Introduction to Cells

... cell transport materials in and out. Carbohydrate chains attached to some membrane proteins help the cell communicate with other cells. ...
Honors Biology Topic #3: Eukaryotic Kingdoms
Honors Biology Topic #3: Eukaryotic Kingdoms

... spores to reproduce. It has a fuzzy appearance when it grows over the surface of its food source. What kingdom does it belong to? How do you know? This is a mold and belongs to kingdom Fungi. While it is multicellular and heterotrophic, the presence of cell walls means it cannot be an animal. 17) Wh ...
Name____________________________________________
Name____________________________________________

... The movement of a particle up a concentration gradient helped by active pumping. ...
5cap` AAUGAGUACCGGGCGAUAAUC AGAAA 3`
5cap` AAUGAGUACCGGGCGAUAAUC AGAAA 3`

... Shown below is the base sequence of the coding strand of a region of a DNA molecule. Draw the complementary (template) strand in the space provided. (Label the 5’ and 3’ ends) ...
Ch. 3 Notes: Membrane Physiology Page | 1 Cellular Physiology
Ch. 3 Notes: Membrane Physiology Page | 1 Cellular Physiology

... Filtration -- Water and solutes are forced through a membrane by fluid, or hydrostatic pressure ...
test assessment - URIteacherknowledge
test assessment - URIteacherknowledge

... ____ semi-permeable; it controls what moves in and out of the cell ...
cell - MrsEhrhardScience
cell - MrsEhrhardScience

... Composed of microtubules (thin, hollow cylinders of protein) and microfilaments (thin, solid fibers or protein). Cilia – short, numerous, hair-like projections, move in a sweeping motion. Flagella – long, whip-like motion for locomotion. ...
CELL MEMBRANE
CELL MEMBRANE

... water both inside and outside the cell. • Phospholipid tails are hydrophobic (water hating) they orient toward each other ...
Bio I Lab Instructor: Dr. Rana Tayyar Lab X Kingdoms Bacteria
Bio I Lab Instructor: Dr. Rana Tayyar Lab X Kingdoms Bacteria

... ►Antibacterial properties of household items. Protista: The kingdom Protista is the most diverse kingdom. Members do not have a lot in common. However, all protists are eukaryotes. Most species of protists are unicellular. Colonial and multicellular species are also found. Both types of reproduction ...
< 1 ... 117 118 119 120 121 122 123 124 125 ... 265 >

Flagellum



A flagellum (/fləˈdʒɛləm/; plural: flagella) is a lash-like appendage that protrudes from the cell body of certain prokaryotic and eukaryotic cells. The word flagellum in Latin means whip. The primary role of the flagellum is locomotion but it also often has function as a sensory organelle, being sensitive to chemicals and temperatures outside the cell. Flagella are organelles defined by function rather than structure. There are large differences between different types of flagella; the prokaryotic and eukaryotic flagella differ greatly in protein composition, structure, and mechanism of propulsion. However, both are used for swimming.An example of a flagellate bacterium is the ulcer-causing Helicobacter pylori, which uses multiple flagella to propel itself through the mucus lining to reach the stomach epithelium. An example of a eukaryotic flagellate cell is the mammalian sperm cell, which uses its flagellum to propel itself through the female reproductive tract. Eukaryotic flagella are structurally identical to eukaryotic cilia, although distinctions are sometimes made according to function and/or length.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report