Worksheet
... evidence that DNA is a double helix. (1.8) Rosalind Franklin’s careful observation and interpretation of the photographic evidence was crucial to Crick’s and Watson’s successful discovery of the structure of DNA. Her work and her calculations were shown to Crick and Watson without her permission and ...
... evidence that DNA is a double helix. (1.8) Rosalind Franklin’s careful observation and interpretation of the photographic evidence was crucial to Crick’s and Watson’s successful discovery of the structure of DNA. Her work and her calculations were shown to Crick and Watson without her permission and ...
7.03 Fall 2003 Problem Set #3 Solutions
... 5'TGA3' coding strand (codes for UGA stop codon) 3'ATC5' template strand 5'TAG3' coding strand (codes for UAG stop codon) Notice that for UGA and UAG, the two candidate sequences for mutation both encode amino acids, whereas for UAA, only one of its candidate sequences encodes an amino acid. The oth ...
... 5'TGA3' coding strand (codes for UGA stop codon) 3'ATC5' template strand 5'TAG3' coding strand (codes for UAG stop codon) Notice that for UGA and UAG, the two candidate sequences for mutation both encode amino acids, whereas for UAA, only one of its candidate sequences encodes an amino acid. The oth ...
Linkage, Recombination, and Crossing Over
... • The frequency of recombination measures the intensity of linkage. In the absence of linkage, this frequency is 50 percent; for very tight linkage, it is close to zero. ...
... • The frequency of recombination measures the intensity of linkage. In the absence of linkage, this frequency is 50 percent; for very tight linkage, it is close to zero. ...
Nucleic Acid Interaction
... dependent on the DNA sequence. Some sequences introduce bends in DNA for example These structural features are recognised by proteins, much like in the ‘lock and key model’ for enzymes ...
... dependent on the DNA sequence. Some sequences introduce bends in DNA for example These structural features are recognised by proteins, much like in the ‘lock and key model’ for enzymes ...
AN INTRODUCTION TO RECOMBINATION AND LINKAGE ANALYSIS
... Linkage Analysis • Key to linkage analysis: – The smaller the amount of recombination observed between genes, i.e. the more tightly linked they are, the closer we could infer that they lie on a chromosome. ...
... Linkage Analysis • Key to linkage analysis: – The smaller the amount of recombination observed between genes, i.e. the more tightly linked they are, the closer we could infer that they lie on a chromosome. ...
pdf slides
... Linkage Analysis • Key to linkage analysis: – The smaller the amount of recombination observed between genes, i.e. the more tightly linked they are, the closer we could infer that they lie on a chromosome. ...
... Linkage Analysis • Key to linkage analysis: – The smaller the amount of recombination observed between genes, i.e. the more tightly linked they are, the closer we could infer that they lie on a chromosome. ...
Introduction to Nucleic Acids
... commonly 260 vs. 280 allows one to assess the purity of the nucleic acid solution. Additionally, the OD of a particular concentration of nucleic acid bases depends on the structure into which they are assembled. Hence absorbance can be used as a structural probe of nucleic acids (see below). Sugars. ...
... commonly 260 vs. 280 allows one to assess the purity of the nucleic acid solution. Additionally, the OD of a particular concentration of nucleic acid bases depends on the structure into which they are assembled. Hence absorbance can be used as a structural probe of nucleic acids (see below). Sugars. ...
Research news
... In early studies of empiric structure–activity relationships, monodentate PtII complexes were considered to be biologically inactive. Examples of such inactive monodentate PtII compounds are [PtCl(dien)]+ (dien=diethylentriamine) and [PtCl(NH3)3]+. DNA is considered the major biological target of pl ...
... In early studies of empiric structure–activity relationships, monodentate PtII complexes were considered to be biologically inactive. Examples of such inactive monodentate PtII compounds are [PtCl(dien)]+ (dien=diethylentriamine) and [PtCl(NH3)3]+. DNA is considered the major biological target of pl ...
An Introduction to DNA Computing
... DNA (Deoxyribose Nucleic Acid) computing, also known as molecular computing is a new approach to massively parallel computation based on groundbreaking work by Adleman. DNA computing was proposed as a means of solving a class of intractable computational problems in which the computing time can grow ...
... DNA (Deoxyribose Nucleic Acid) computing, also known as molecular computing is a new approach to massively parallel computation based on groundbreaking work by Adleman. DNA computing was proposed as a means of solving a class of intractable computational problems in which the computing time can grow ...
Figure 1 - genomics-lab
... sequences, demonstrate their high level of polymorphism due to variations in the number of tandem repeats (1 - typical heterozygosities in cattle), abundance and even distribution across the genome. Microsatellites are genotyped using the polymerase chain reaction (1 ) using primers targeted to the ...
... sequences, demonstrate their high level of polymorphism due to variations in the number of tandem repeats (1 - typical heterozygosities in cattle), abundance and even distribution across the genome. Microsatellites are genotyped using the polymerase chain reaction (1 ) using primers targeted to the ...
Aim: What happens during meiosis?
... 1. During prophase I, homologous chromosomes pair up in a process called synapsis. – A protein zipper, the synaptonemal complex, holds homologous chromosomes together tightly. – Later in prophase I, the joined homologous chromosomes are visible as a tetrad. – At X-shaped regions called chiasmata, se ...
... 1. During prophase I, homologous chromosomes pair up in a process called synapsis. – A protein zipper, the synaptonemal complex, holds homologous chromosomes together tightly. – Later in prophase I, the joined homologous chromosomes are visible as a tetrad. – At X-shaped regions called chiasmata, se ...
Meiosis II
... • Crossing over: segments of nonsister chromatids break and reattach to the other chromatids • Chismata (chiasma) are the sites of crossing over. ...
... • Crossing over: segments of nonsister chromatids break and reattach to the other chromatids • Chismata (chiasma) are the sites of crossing over. ...
- Fairview High School
... Preparation of labelled bacteria for autoradiography. The bacteria were grown with aeration to 1o8jml., centrifuged and resuspended in an equal volume of medium containing 2 pgjml. [3H]TDR (9 ejm.mole). In pulse-labelling experiments, incorporation of label was stopped by diluting the bacteria eithe ...
... Preparation of labelled bacteria for autoradiography. The bacteria were grown with aeration to 1o8jml., centrifuged and resuspended in an equal volume of medium containing 2 pgjml. [3H]TDR (9 ejm.mole). In pulse-labelling experiments, incorporation of label was stopped by diluting the bacteria eithe ...
BLOOM HELICASE (and BLOOM SYNDROME)
... Maps to 15q26.1 Many types of mutations can occur: missense, frameshift, nonsense, splice-site, etc.. Most common mutation is delATCTGA/insTAGATTC @ position 2281 which is known as a blmAsh mutation ...
... Maps to 15q26.1 Many types of mutations can occur: missense, frameshift, nonsense, splice-site, etc.. Most common mutation is delATCTGA/insTAGATTC @ position 2281 which is known as a blmAsh mutation ...
PCR: Polymerase Chain Reaction
... Add single stranded primers that match to sequences of the target DNA. The single-stranded primers bind to their complementary single-stranded bases on the denaturated DNA. ...
... Add single stranded primers that match to sequences of the target DNA. The single-stranded primers bind to their complementary single-stranded bases on the denaturated DNA. ...
Gene Section MRE11A (MRE11 meiotic recombination 11 homolog A (S. cerevisiae))
... domain of each Rad50 unit. As the Zinc-hook of Rad50 is located at the end of a long coiled-coil domain, this provides a flexible structure in which each DNA end is accessible to additional repair enzymes while being held in close proximity to each other in preparation for re-ligation. Cells lacking ...
... domain of each Rad50 unit. As the Zinc-hook of Rad50 is located at the end of a long coiled-coil domain, this provides a flexible structure in which each DNA end is accessible to additional repair enzymes while being held in close proximity to each other in preparation for re-ligation. Cells lacking ...
letters The homing endonuclease I-CreI uses three metals
... also important in the LAGLIDADG homing endonuclease ICeuI7. These residues primarily interact with a network of solvent molecules that surround the nucleophilic water molecule (Fig. 4) and extend around the scissile phosphate to the 3′ oxygen leaving group. This network includes a water molecule (nu ...
... also important in the LAGLIDADG homing endonuclease ICeuI7. These residues primarily interact with a network of solvent molecules that surround the nucleophilic water molecule (Fig. 4) and extend around the scissile phosphate to the 3′ oxygen leaving group. This network includes a water molecule (nu ...
Presentation 1 Guidelines
... GGCATGCATTACGGCATCACACTAGGGATC–3. The promoter would be to the left (in the 3 direction) of the template strand. C14. Transcriptional termination occurs when the hydrogen bonding is broken between the DNA and the part of the newly made RNA transcript that is located in the open complex. C15. In ρ- ...
... GGCATGCATTACGGCATCACACTAGGGATC–3. The promoter would be to the left (in the 3 direction) of the template strand. C14. Transcriptional termination occurs when the hydrogen bonding is broken between the DNA and the part of the newly made RNA transcript that is located in the open complex. C15. In ρ- ...
pdf, 1.3 MB - DNA and Natural Algorithms Group
... the superduplexes contain one parental strand and one daughter strand. All that remains to be done in this step is to remove the motor apparatus and separate the two superduplexes to allow another round of replication. This is achieved with the addition of the four motor removal strands Y, Y¢, Z, an ...
... the superduplexes contain one parental strand and one daughter strand. All that remains to be done in this step is to remove the motor apparatus and separate the two superduplexes to allow another round of replication. This is achieved with the addition of the four motor removal strands Y, Y¢, Z, an ...
Ch9_DNA-notes
... DNA Replication • When cells divide, the two resulting daughter cells must have exactly the same DNA as the original cell. • Therefore, before cell division happens, the cell must replicate (copy) its DNA. ...
... DNA Replication • When cells divide, the two resulting daughter cells must have exactly the same DNA as the original cell. • Therefore, before cell division happens, the cell must replicate (copy) its DNA. ...
dna and protein synthesis - YISS
... strand by separating the nitrogen base pairs. 2. DNA polymerase pairs free DNA nucleotides with the exposed bases on both strands following the base pair rules. • each strand from the parent molecule serve as a template ...
... strand by separating the nitrogen base pairs. 2. DNA polymerase pairs free DNA nucleotides with the exposed bases on both strands following the base pair rules. • each strand from the parent molecule serve as a template ...
f^*Co*e -z`
... It is not known whether or not these enzymes have 5, to 3, exonucrease activity. only 6, e and y have been shown to have proofreading (3, to 5, exonuclease) activity. ...
... It is not known whether or not these enzymes have 5, to 3, exonucrease activity. only 6, e and y have been shown to have proofreading (3, to 5, exonuclease) activity. ...
PowerPoint-RNA
... beginning of an mRNA molecule 2. A tRNA molecule carrying an amino acid matches up to a complementary triplet on mRNA on the ribosome 3. The ribosome attaches one amino acid to another as it moves along the mRNA molecule 4. The tRNA molecules are released after the amino acids they carry are attache ...
... beginning of an mRNA molecule 2. A tRNA molecule carrying an amino acid matches up to a complementary triplet on mRNA on the ribosome 3. The ribosome attaches one amino acid to another as it moves along the mRNA molecule 4. The tRNA molecules are released after the amino acids they carry are attache ...
Holliday junction
A Holliday junction is a branched nucleic acid structure that contains four double-stranded arms joined together. These arms may adopt one of several conformations depending on buffer salt concentrations and the sequence of nucleobases closest to the junction. The structure is named after the molecular biologist Robin Holliday, who proposed its existence in 1964.In biology, Holliday junctions are a key intermediate in many types of genetic recombination, as well as in double-strand break repair. These junctions usually have a symmetrical sequence and are thus mobile, meaning that the four individual arms may slide though the junction in a specific pattern that largely preserves base pairing. Additionally, four-arm junctions similar to Holliday junctions appear in some functional RNA molecules.Immobile Holliday junctions, with asymmetrical sequences that lock the strands in a specific position, were artificially created by scientists to study their structure as a model for natural Holliday junctions. These junctions also later found use as basic structural building blocks in DNA nanotechnology, where multiple Holliday junctions can be combined into specific designed geometries that provide molecules with a high degree of structural rigidity.