• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Cell-Type Specific Channelopathies in the Prefrontal Cortex of the
Cell-Type Specific Channelopathies in the Prefrontal Cortex of the

... label PT neurons and a green tracer into either the contralateral striatum or contralateral mPFC to label IT neurons. In both genotypes, IT neurons were found throughout L2– 6, whereas PT neurons were restricted to L5/6. Within the deep layers, PT and IT neurons could be observed within close proxim ...
Citron-Kinase, a Protein Essential to Cytokinesis in Neuronal
Citron-Kinase, a Protein Essential to Cytokinesis in Neuronal

... follows: kinase domain: GAGTCGGTAGCGGAGAGATGTT and CCCGACACAACAGAC TCAGATC; C itron-nonkinase (N) domain: GTGTGC TAGAGAAGTGAC TGCG and CC TCATCGAGTTGTTTGGACAG, TCGCAACAGC TGTAC TGTCATC and CATC TGC TTTGGC TGTATTTGC, TATC TATTCATGGTGCCGTTG and AGGAGGAGTTC TTCAGGC TGAG. PCR products were cloned into T ...
PDF
PDF

... indirect, methods to measure dopamine concentration in the striatum. By contrast, many other studies track the firing of dopaminergic neurons by recording electrical activity in the midbrain, where the cell bodies lie (Fig. 1a). Such recordings from rats running through mazes have yet to be reported ...
Chapter 2: Biological Bases of Behavior MULTIPLE CHOICE 1
Chapter 2: Biological Bases of Behavior MULTIPLE CHOICE 1

... OBJ: LO5 Identify the various parts of the neuron and explain how a neuron functions. MSC: TYPE: Easy 22. Electrical messages can be transmitted in the neuron up to: a. 2 miles per hour c. 2000 miles per hour b. 200 miles per hour d. 20,000 miles per hour ANS: B PTS: 1 DIF: Bloom's: Remember REF: 2. ...
Dispatch Vision: How to Train Visual Cortex to Predict Reward Time
Dispatch Vision: How to Train Visual Cortex to Predict Reward Time

... auditory cortex — and could contribute to this effect [14]. On the other hand, Chubykin et al. [2] also demonstrated that cholinergic-specific lesions of basal forebrain prevent the acquisition of reward timing activity in V1. In addition, even an isolated V1 slice in vitro could express reward timi ...
Comparative neuronal morphology of the
Comparative neuronal morphology of the

... cetartiodactyls (humpback whale, giraffe), and primates (human, common chimpanzee). Although there are many representative freehand and camera lucida drawings of cerebellar cortex neurons (Ramón y Cajal, 1909, 1911; Chan-Palay and Palay, 1970, 1972; Palay and ChanPalay, 1974; Braak and Braak, 1983; ...
Proc. Natl. Acad. Sci. USA
Proc. Natl. Acad. Sci. USA

... under aseptic conditions and anesthesia with sodium pentobarbital (25–30 mgykg). The right hemisphere was retracted from the falx with a brain spoon. An aspirator was used to make a sagittal incision #5 mm in length in the corpus callosum, entering the lateral ventricle at the level of the intervent ...
No Slide Title - Computer Science Home
No Slide Title - Computer Science Home

... recognition, perception, and motor control), e.g., it takes a brain 100-200 msec to recognize a familiar face embedded in an unfamiliar scene (will take days for the computer to do the similar tasks) ...
Hello. I`m Michael Farries, a graduate student of David Perkel. I have
Hello. I`m Michael Farries, a graduate student of David Perkel. I have

... pallium is extremely contentious, there has been general agreement that the basal ganglia (BG) can be more easily compared, and thus a homology-based system of nomenclature for the avian BG is within reach. Since there has been disagreement about virtually every other aspect of the nomenclature, it’ ...
PowerPoint Slides - Portland State University
PowerPoint Slides - Portland State University

... • State space analysis and synthesis of vocalizations to aid in stimulus design • Comparison of neural responses from both a spike rate and spike timing perspective • Improved methods for creating input>output models of individual neurons provided the pure tone responses of these neurons – Used to a ...
322 Neuroscience I - Jordan University of Science and Technology
322 Neuroscience I - Jordan University of Science and Technology

... seminars topics, and self-directed learning methods. The overall goal of the Neuroscience I course is to provide basic knowledge and understanding of the structure, function of the nervous system, biochemical basis of human behavior, as well as the pathological basis of neurological and mental disor ...
Stable propagation of synchronous spiking in cortical neural networks
Stable propagation of synchronous spiking in cortical neural networks

... animals were young adult gerbils. A gerbil was deeply anaesthetized and its left cochlea was exposed. Tones from a loudspeaker were delivered to the ear via a tube ®tted to the left ear canal. The level of the tones was calibrated in the ear canal at the beginning of each experiment. Basal scala tym ...
Cortical cfos Expression Reveals Broad Receptive Field Excitatory
Cortical cfos Expression Reveals Broad Receptive Field Excitatory

... Spontaneous Firing Rates in fosGFP+ Neurons In the fosGFP mouse, approximately 10% to 20% of layer 2 excitatory neurons in somatosensory (barrel) cortex exhibit nuclear labeling for fosGFP and can be visualized and targeted using in vivo two photon imaging (Barth et al., 2004; Yassin et al., 2010) ( ...
Context Dependency in the Globus Pallidus Internal Segment
Context Dependency in the Globus Pallidus Internal Segment

... 1993). All of these studies provide evidence for the great ...
Capturing Brain Dynamics: a combined neuroscience and
Capturing Brain Dynamics: a combined neuroscience and

... Lobes of the brain Frontal lobe ...
Effect of sodium fluoride on the grey matter of spinal cord in the
Effect of sodium fluoride on the grey matter of spinal cord in the

... of protected rats. (a) Ventral horn showing many more or less normal motor neurons (thick arrows). Some have long processes (arrowheads). However, some shrunken cells with loss of nuclear details (curved arrows) could be observed. A fewer number of astrocytes (dashed arrows), a small thin walled blo ...
Webb et al 2002 - User Web Areas at the University of York
Webb et al 2002 - User Web Areas at the University of York

... classical receptive field (Fig. 1A, left) is suppressed by the addition of a large annular grating beyond the classical receptive field (Fig. 1B, left). The spontaneous activity (Fig. 1D, left) is slightly suppressed when the annular grating is presented alone (Fig. 1C, left). However, the suppressi ...
Stimulation-Induced Functional Decoupling (SIFD)
Stimulation-Induced Functional Decoupling (SIFD)

... Intuitively, electrical stimulation of neurons should increase spiking activity (assumed in Rubin and Terman, 2004) However: in vivo recordings in MPTP monkeys show a decrease in STN neurons activity! (Meissner et al., 2005) Furthermore: GPi cells (target of STN cells) are activated at high-frequenc ...
Frog Vision
Frog Vision

... • The four tectal sheets of neurons essentially provide a recoding of the retinal image. • The retinal image is specified in terms of luminance at each receptor - this description is redundant and not useful to frog. • Tectal neurons recode each small region on retina in terms of 4 basic features or ...
ch_16_lecture_presentation
ch_16_lecture_presentation

... 1. Most often, these two divisions have opposing effects • If the sympathetic division causes excitation, the ...
Categories in the Brain - Rice University -
Categories in the Brain - Rice University -

... • We have to examine how our information about categories is represented in the brain • The brain is where our linguistic and cultural knowledge is represented • This recommendation is in line with a suggestion first made to linguists by Norman Geschwind in 1964 – Geschwind: a great neurologist – Sa ...
Integrating Optogenetic and Pharmacological Approaches to Study
Integrating Optogenetic and Pharmacological Approaches to Study

... 2010; Yizhar et al., 2011b; Marin, 2012). More specifically, dysfunctional circuit mechanisms within the FS interneurons that selectively express the calciumbinding protein, parvalbumin, are hypothesized to underlie a range of symptoms of these neuropsychiatric diseases. Optogenetic manipulations ha ...
Werkstuk Biologie The Tongue  <strong style="line
Werkstuk Biologie The Tongue
Lecture #1 - University of Utah
Lecture #1 - University of Utah

... : output of receptors is modulated by the central nervous system 1) Functions of Efferent Control a) ‘smoothing’ of motor responses e.g. muscle spindle - stretch reflex b) Compensation for Reafference ...
Maruska & Tricas 2011
Maruska & Tricas 2011

... 2009). In fishes and other vertebrates, the terminal nerve GnRH system also modulates processing of visual and olfactory information at the periphery (i.e., retina and olfactory epithelium) (Eisthen et al., 2000; Kawai et al., 2009; Park and Eisthen, 2003; Stell et al., 1987; Zhang and Delay, 2007). ...
< 1 ... 134 135 136 137 138 139 140 141 142 ... 631 >

Neuroanatomy



Neuroanatomy is the study of the anatomy and stereotyped organization of nervous systems. In contrast to animals with radial symmetry, whose nervous system consists of a distributed network of cells, animals with bilateral symmetry have segregated, defined nervous systems, and thus we can make much more precise statements about their neuroanatomy. In vertebrates, the nervous system is segregated into the internal structure of the brain and spinal cord (together called the central nervous system, or CNS) and the routes of the nerves that connect to the rest of the body (known as the peripheral nervous system, or PNS). The delineation of distinct structures and regions of the nervous system has been critical in investigating how it works. For example, much of what neuroscientists have learned comes from observing how damage or ""lesions"" to specific brain areas affects behavior or other neural functions.For information about the composition of animal nervous systems, see nervous system. For information about the typical structure of the human nervous system, see human brain or peripheral nervous system. This article discusses information pertinent to the study of neuroanatomy.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report