Disrupting antibiotic resistance propagation by inhibiting
... strains (reviewed in ref. 1), as first described for the Escherichia coli F plasmid by Lederberg and Tatum in 1946 (2). Conjugative DNA transfer is also the central mechanism by which antibiotic resistance and virulence factors are propagated in bacterial populations (reviewed in ref. 3). Indeed, it ...
... strains (reviewed in ref. 1), as first described for the Escherichia coli F plasmid by Lederberg and Tatum in 1946 (2). Conjugative DNA transfer is also the central mechanism by which antibiotic resistance and virulence factors are propagated in bacterial populations (reviewed in ref. 3). Indeed, it ...
Slides
... (automatically) from a multiple alignment of the highest scoring hits in an initial BLAST search. The PSSM is generated by calculating position-specific scores for each position in the alignment. Highly conserved positions receive high scores and weakly conserved positions receive scores near zero. ...
... (automatically) from a multiple alignment of the highest scoring hits in an initial BLAST search. The PSSM is generated by calculating position-specific scores for each position in the alignment. Highly conserved positions receive high scores and weakly conserved positions receive scores near zero. ...
Specific Combinations of Zein Genes and Genetic Backgrounds
... In the case of Bo2It, the mutant line from which the o2-Italian allele has been recovered and first described in the sixties (Nelson, 1967), a proper comparison is not possible because its O2 isogenic line is not available in any collection. The two GBs, W22 and Oh43, carrying the o2-676 allele (Auk ...
... In the case of Bo2It, the mutant line from which the o2-Italian allele has been recovered and first described in the sixties (Nelson, 1967), a proper comparison is not possible because its O2 isogenic line is not available in any collection. The two GBs, W22 and Oh43, carrying the o2-676 allele (Auk ...
Lesson title: Nucleic acids Lesson date: 30.12.2013 One sentence
... After explanations and playing a nucleic acids puzzle; 1. Students will be able to model and describe the general structure of nucleic acids. 2. Students will be able to apply base pairing rules to assemble nucleic acids and state differences between DNA and RNA. 3. Students will be able to infer th ...
... After explanations and playing a nucleic acids puzzle; 1. Students will be able to model and describe the general structure of nucleic acids. 2. Students will be able to apply base pairing rules to assemble nucleic acids and state differences between DNA and RNA. 3. Students will be able to infer th ...
Inheritance of Aldehyde Oxidase in Drosophila melanogaster
... The haploid (N) number of chromosomes is 4 and the chromosomes are designated X(1), 2, 3, and 4. The 2, 3, and 4 chromosomes are the same in both sexes and are referred to as autosomes to distinguish them from the X and Y sex chromosomes. Female Drosophila are characterized by having two X chromosom ...
... The haploid (N) number of chromosomes is 4 and the chromosomes are designated X(1), 2, 3, and 4. The 2, 3, and 4 chromosomes are the same in both sexes and are referred to as autosomes to distinguish them from the X and Y sex chromosomes. Female Drosophila are characterized by having two X chromosom ...
Reconstruction of a 450-My-old ancestral vertebrate protokaryotype
... segments with three or more genes in the sample were considered. Genome data from pufferfish [10] and medaka [9] provided most of the information. The principle used to reconstruct the teleost protokaryotype is illustrated in Figure 2 (Table 2, and Table S2 in supplementary online material). For sim ...
... segments with three or more genes in the sample were considered. Genome data from pufferfish [10] and medaka [9] provided most of the information. The principle used to reconstruct the teleost protokaryotype is illustrated in Figure 2 (Table 2, and Table S2 in supplementary online material). For sim ...
Michigan State University Plant Genomics Program
... • Since even moving the plants between the filter paper and the plate to the 50mL reaction tube could cause some form of wounding to the small seedlings, to eliminate the chances of RNA levels changing because of those minor stresses, we are treating the seedlings with water on filter paper, which s ...
... • Since even moving the plants between the filter paper and the plate to the 50mL reaction tube could cause some form of wounding to the small seedlings, to eliminate the chances of RNA levels changing because of those minor stresses, we are treating the seedlings with water on filter paper, which s ...
Te gades
... Why Te#gades? • *Not all Te#gades species studied has this double lineage of Hodgkina • To look at this phenomena phylogene0cally, we decided to sequence the cicadas harboring these bacteria • Thus we ...
... Why Te#gades? • *Not all Te#gades species studied has this double lineage of Hodgkina • To look at this phenomena phylogene0cally, we decided to sequence the cicadas harboring these bacteria • Thus we ...
Radiation_Unit - Sites@Duke
... (Figures 9 and 10, top). So p53 comes to the cells’ defense—it promotes apoptosis of cells with damaged DNA, thereby eliminating cells that might go on to develop into cancerous cells. In this sense, p53 is considered a “tumor suppressor” protein. Under normal conditions, tumor suppressors slow down ...
... (Figures 9 and 10, top). So p53 comes to the cells’ defense—it promotes apoptosis of cells with damaged DNA, thereby eliminating cells that might go on to develop into cancerous cells. In this sense, p53 is considered a “tumor suppressor” protein. Under normal conditions, tumor suppressors slow down ...
A1986A459700001
... a-amylase in half-grains of barley was proportional to the logarithm of the gibberellie acid concentration and could be detected at hormone concentrations as low as 1 x 10— 10 M. This assay was not sensitive to reducing agents such as those found in organic solvents. Since this bioassay was a simple ...
... a-amylase in half-grains of barley was proportional to the logarithm of the gibberellie acid concentration and could be detected at hormone concentrations as low as 1 x 10— 10 M. This assay was not sensitive to reducing agents such as those found in organic solvents. Since this bioassay was a simple ...
Leukaemia Section t(2;3)(p21;q26) THADA/MECOM Atlas of Genetics and Cytogenetics in Oncology and Haematology
... have been found in thyroid adenomas; it would compete with normal THADA, thereby disturbing normal apoptosis of follicular cells (Rippe et al., 2003; Kloth et al., 2011). ...
... have been found in thyroid adenomas; it would compete with normal THADA, thereby disturbing normal apoptosis of follicular cells (Rippe et al., 2003; Kloth et al., 2011). ...
The construction of an enhanced green fluorescence protein
... Here we describe the construction of eGFP reporter plasmids under control of consitutively active or muscle specific promoters (Figure 6). After eGFP and pCDNA3/pDRIVE vector ligation, analytical digest of transformed colonies provided evidence that eGFP was inserted into the plasmid. For all plasmi ...
... Here we describe the construction of eGFP reporter plasmids under control of consitutively active or muscle specific promoters (Figure 6). After eGFP and pCDNA3/pDRIVE vector ligation, analytical digest of transformed colonies provided evidence that eGFP was inserted into the plasmid. For all plasmi ...
10-2008-SAB-Davis
... – New code looks for polyA runs >10nt – Evaluate sequence post polyA and score. ...
... – New code looks for polyA runs >10nt – Evaluate sequence post polyA and score. ...
Engineering of steroid biotransformation in rhodococcus van
... SQ1, encoding the enzymes involved in AD degradation. The genomic loci of these genes appear to be scattered over the genome of R. erythropolis SQ1. No operon (-like) organization was apparent and therefore all four genes needed to be cloned individually. As an exception, a divergently transcribed T ...
... SQ1, encoding the enzymes involved in AD degradation. The genomic loci of these genes appear to be scattered over the genome of R. erythropolis SQ1. No operon (-like) organization was apparent and therefore all four genes needed to be cloned individually. As an exception, a divergently transcribed T ...
Systematic Mutational Analysis of the Yeast ACT1 Gene.
... acid residues.The resulting structure of the EcoRI fragment is depicted in Figure 2B in its genomic context. Oligonucleotide-directed mutagenesis: Thirty-six syntheticoligonucleotideswereusedtochange75selected charged amino acidsin yeast actin to alanine. Oligonucleotides were designed to contain at ...
... acid residues.The resulting structure of the EcoRI fragment is depicted in Figure 2B in its genomic context. Oligonucleotide-directed mutagenesis: Thirty-six syntheticoligonucleotideswereusedtochange75selected charged amino acidsin yeast actin to alanine. Oligonucleotides were designed to contain at ...
Essential role of conserved DUF177A protein in plastid 23S rRNA
... DUF177A and DUF177B clades arose via duplication of an ancestral algal DUF177 gene, because some algal sequences grouped with bacterial DUF177 proteins, the alternative possibility that either DUF177A or DUF177B was acquired separately from bacteria by horizontal gene transfer could not be ruled out ...
... DUF177A and DUF177B clades arose via duplication of an ancestral algal DUF177 gene, because some algal sequences grouped with bacterial DUF177 proteins, the alternative possibility that either DUF177A or DUF177B was acquired separately from bacteria by horizontal gene transfer could not be ruled out ...
Designer Babies and 21st Century Cures
... While defending the use of embryonic science and cloning technology to treat or prevent serious diseases, he argues that the compulsion to use the same science to enhance physical or mental attributes in the unborn is not morally justifiable. “Like most people I disapprove strongly of the idea of an ...
... While defending the use of embryonic science and cloning technology to treat or prevent serious diseases, he argues that the compulsion to use the same science to enhance physical or mental attributes in the unborn is not morally justifiable. “Like most people I disapprove strongly of the idea of an ...
Conservation of Gene Order between Horse and Human X
... genome [18]. Though the 34 markers placed on the RH map in the present study span almost the entire length of the chromosome, the coverage is not yet even. Some “gaps” in the map are clearly evident, for example, between LEX027 and OTC on the short arm, and PGK1 and LEX013 on the long arm, where mor ...
... genome [18]. Though the 34 markers placed on the RH map in the present study span almost the entire length of the chromosome, the coverage is not yet even. Some “gaps” in the map are clearly evident, for example, between LEX027 and OTC on the short arm, and PGK1 and LEX013 on the long arm, where mor ...
ecoli lysis - KSU Faculty Member websites
... E. coli H10407 genomic DNA by using Vent DNA polymerase and oligonucleotide primers P35 (5'-ATTGTCGGTTATGCAGCGAAGC) and P36 (5'ACTCCTGCAAATTCCAGTTACC). The PCR product was A-tailed with AmpliTaq polymerase, ligated into pGEM-T Easy behind the lac promoter, and electroporated into XL1-Blue to generat ...
... E. coli H10407 genomic DNA by using Vent DNA polymerase and oligonucleotide primers P35 (5'-ATTGTCGGTTATGCAGCGAAGC) and P36 (5'ACTCCTGCAAATTCCAGTTACC). The PCR product was A-tailed with AmpliTaq polymerase, ligated into pGEM-T Easy behind the lac promoter, and electroporated into XL1-Blue to generat ...
Dictyostelium IQGAP-related Protein Specifically
... an open reading frame interrupted by three putative introns with typical features of Dictyostelium introns (Figs. 1 and 4). The intron–exon boundaries were confirmed by sequence analysis of cDNA clones prepared from the vegetative mRNA (data not shown). It was found that the tag was inserted into th ...
... an open reading frame interrupted by three putative introns with typical features of Dictyostelium introns (Figs. 1 and 4). The intron–exon boundaries were confirmed by sequence analysis of cDNA clones prepared from the vegetative mRNA (data not shown). It was found that the tag was inserted into th ...
Joanne Ramsey
... Renal oncocytomas (ROs) are benign epithelial tumours that arise from the intercalated cells of the renal collecting duct The main characteristics of ROs is the accumulation of mitochondria in the cell cytoplasm and their deficiency in electron transport chain complex I Loss of chromosomes 1 and 14 ...
... Renal oncocytomas (ROs) are benign epithelial tumours that arise from the intercalated cells of the renal collecting duct The main characteristics of ROs is the accumulation of mitochondria in the cell cytoplasm and their deficiency in electron transport chain complex I Loss of chromosomes 1 and 14 ...