• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
GO and Annotation
GO and Annotation

... into a clean set of categories is a lot like trying to figure out where to find that suspenseful black comedy at your corner video store. Questions inevitably come up, like are Movies part of Art or Entertainment? (Yahoo! lists them under the latter.) -Wired Magazine, May 1996 May 5, 2015 ...
Identification of One BOCR Mutation and Five NF1 Mutations in Male
Identification of One BOCR Mutation and Five NF1 Mutations in Male

... showed on these radiographs of five probands (Figure 2). In total, five hundred healthy Chinese individuals were recruited from the Xiangya Wellness Center as a control group. The study was approved by the Ethics Committee of the Xiangya Hospital of the Central South University in China (equivalent ...
RNAi phenotypes are influenced by the genetic background of the
RNAi phenotypes are influenced by the genetic background of the

... Background: RNA interference (RNAi) is a powerful tool to study gene function in organisms that are not amenable to classical forward genetics. Hence, together with the ease of comprehensively identifying genes by new generation sequencing, RNAi is expanding the scope of animal species and questions ...
In the near future, EU thresholds for adventitious
In the near future, EU thresholds for adventitious

... Impurity testing in seeds has traditionally been done using either single or sequential seed-pool tests. From an analytical seed sample (e.g. 3000 seeds) equal seed pools are made and analysed individually for the trait of interest. Using binomial statistics, the number of seed pools positive for th ...
Diploidy and the selective advantage for sexual reproduction in
Diploidy and the selective advantage for sexual reproduction in

... what is known as lethal mutagenesis. While the error catastrophe and lethal mutagenesis are formally distinct phenomena, they can often be associated with one another, as is the case with the models being considered here (Bull and Wilke 2008). However, for sexual reproduction in the multi-chromosome ...
Incomplete citric acid cycle obliges aminolevulinic
Incomplete citric acid cycle obliges aminolevulinic

... quantities (Anthony, 1986). Thus, the synthesis of the first committed tetrapyrrole precursor, ALA, must proceed at a high rate in M . methylotrophus. ALA is synthesized by two pathways stemming from the citric acid cycle (Jahn et al., 1992). In the C, pathway of chloroplasts, archaeobacteria and ma ...
The Inheritance of Apomixis in Poa pratensis
The Inheritance of Apomixis in Poa pratensis

... and parthenogenesis by dominant Mendelian factors (Van Dijk ...
slides - Referent Tracking Unit
slides - Referent Tracking Unit

... What are genes? • There is not much consensus of opinion among geneticists as to what genes are — whether they are real or purely fictitious — because at the level at which the genetic experiments lie, it does not make the slightest difference whether the gene is a hypothetical unit, or whether the ...
slides - Referent Tracking Unit
slides - Referent Tracking Unit

... What are genes? • There is not much consensus of opinion among geneticists as to what genes are — whether they are real or purely fictitious — because at the level at which the genetic experiments lie, it does not make the slightest difference whether the gene is a hypothetical unit, or whether the ...
A mutation in the Arabidopsis mTERFrelated plastid protein
A mutation in the Arabidopsis mTERFrelated plastid protein

... O2-dependent signals from the plastid to the nucleus (Figure 2). Hence, soldat10 is likely to suppress 1O2-mediated cell death in flu seedlings more indirectly. One way to elucidate possible mechanisms responsible for the suppression of 1O2-mediated stress responses in soldat10/flu seedlings is the ...
asense is a Drosophila neural precursor gene and is
asense is a Drosophila neural precursor gene and is

... Unlike ac or sc (Cubas et al., 1991; Skeath and Carroll, 1991), ase remains detectable during and after division of the SOP (Fig. 2G–I). Some time after the first division, the progeny of the A and P cells cease to be labelled; instead, additional labelled cells appear in other subepidermal position ...
Renin Precursor Synthesis and Renin
Renin Precursor Synthesis and Renin

PDF
PDF

... regulate the expression of Insm1 (Breslin et al., 2003; Castro et al., 2006; Mellitzer et al., 2006). As Ascl1 is the only conventional proneural factor expressed by 5HT progenitors, we reasoned that it is likely to be the physiologically relevant member of this group (Pattyn et al., 2004). Consiste ...
msb201035-sup
msb201035-sup

... development and have a CRM bound at either early (green) or late (red) stages of development. (a) The correlation between the timing of each TF separately to the timing of its target genes expression: the target genes for each TF were divided into early or late based on the timing of TF occupancy to ...
What is a biofilm?
What is a biofilm?

... •This paper has shown that mutant biofilms older than 72 hr where less sensitive to Tb than 24 hr old biofilms. This means that Tb treatment is more successful on younger biofilms • Not all strains are as sensitive to Tb as the one used in this ...
757 (Agus Kurnia)ok
757 (Agus Kurnia)ok

... contributed to the thermostability (Harris et al. 1997). Moreover, the hydrophobic interaction at the surface of a protein has also been reported (Van den Burg et al. 1994; Funahashi et al. 2000) to stabilize the protein. Amino acid residues at the position of 222 were conserved in all bacterial xyl ...
Other RNA Processing Events
Other RNA Processing Events

... • This workforce solution was funded by a grant awarded under the President’s Community-Based Job Training Grants as implemented by the U.S. Department of Labor’s Employment and Training Administration. The solution was created by the grantee and does not necessarily reflect the official position of ...
Meiosis
Meiosis

... • Living organisms are distinguished by their ability to reproduce their own kind • Genetics (遺傳學) is the scientific study of heredity (遺傳) and variation (變異)。 • Heredity (遺傳) is the transmission of traits from one generation to the next • Variation (變異) is demonstrated by the differences in appeara ...
Xq28 duplications
Xq28 duplications

... How common are Xq28 duplications? Duplications of Xq28 are considered quite rare but now that more specific laboratory techniques are available, the frequency of diagnoses is increasing. At the time of updating this booklet in 2015, over 100 male and almost 100 female cases of Xq28 duplication had b ...
Detection of Five Rare Cystic Fibrosis Mutations Peculiar to
Detection of Five Rare Cystic Fibrosis Mutations Peculiar to

... ular analysis. We therefore designed a second allelespecific oligonucleotide set to analyze the five mutations. Among the patients analyzed, one patient homozygous for the L1065P mutation expressed a mild pulmonary and intestinal form of the disease with pancreatic insufficiency. Two other patients, ...
A model for mis-sense error in protein synthesis: mis
A model for mis-sense error in protein synthesis: mis

... have been used by nature for synthesizing proteins. The specific sequence of the amino acids in a given protein is directed by the corresponding sequence of codons (triplets of nucleotide monomers) on the corresponding template messenger RNA (mRNA). The template-directed polymerization of a protein, ...
25 Disorders of Proline and Serine Metabolism
25 Disorders of Proline and Serine Metabolism

... Three disorders of serine metabolism are known. Two are in its biosynthesis: namely, 3-phosphoglycerate dehydrogenase deficiency and phosphoserine phosphatase deficiency. Patients with 3-phosphoglycerate dehydrogenase deficiency are affected with congenital microcephaly, psychomotor retardation and ...
Gene Section PAX8 (paired box 8) Atlas of Genetics and Cytogenetics
Gene Section PAX8 (paired box 8) Atlas of Genetics and Cytogenetics

Print - Circulation Research
Print - Circulation Research

... in which sucrose was present only during the degradation period (i.e., its effects on proteolysis reflected changes during the first day of exposure). In addition, a second group of experiments was performed in which hearts were exposed to sucrose during the 24-hour stabilization, pulsation, and was ...
Di-(2-ethylhexyl) phthalate mediates glycolysis and the TCA cycle
Di-(2-ethylhexyl) phthalate mediates glycolysis and the TCA cycle

... calibrated the cDNA template. Two gene specific primers for MDH (ATCTATGGCTGTTATTTCCGAC and TCTCTCTCTTCTTCAAGCTCCT) were designed to amplify an 196 bp product. Real-time PCR amplification was performed using a Rotor-Gene 6000 real-time PCR detection system. We utilized the reaction components and th ...
< 1 ... 115 116 117 118 119 120 121 122 123 ... 2254 >

Artificial gene synthesis

Artificial gene synthesis is a method in synthetic biology that is used to create artificial genes in the laboratory. Currently based on solid-phase DNA synthesis, it differs from molecular cloning and polymerase chain reaction (PCR) in that the user does not have to begin with preexisting DNA sequences. Therefore, it is possible to make a completely synthetic double-stranded DNA molecule with no apparent limits on either nucleotide sequence or size. The method has been used to generate functional bacterial or yeast chromosomes containing approximately one million base pairs. Recent research also suggests the possibility of creating novel nucleobase pairs in addition to the two base pairs in nature, which could greatly expand the possibility of expanding the genetic code.Synthesis of the first complete gene, a yeast tRNA, was demonstrated by Har Gobind Khorana and coworkers in 1972. Synthesis of the first peptide- and protein-coding genes was performed in the laboratories of Herbert Boyer and Alexander Markham, respectively.Commercial gene synthesis services are now available from numerous companies worldwide, some of which have built their business model around this task. Current gene synthesis approaches are most often based on a combination of organic chemistry and molecular biological techniques and entire genes may be synthesized ""de novo"", without the need for precursor template DNA. Gene synthesis has become an important tool in many fields of recombinant DNA technology including heterologous gene expression, vaccine development, gene therapy and molecular engineering. The synthesis of nucleic acid sequences is often more economical than classical cloning and mutagenesis procedures.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report