• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
GeorgeGamow-Wikipedi..
GeorgeGamow-Wikipedi..

... In the early 1900s, radioactive materials were known to have characteristic exponential decay rates or half lives. At the same time, radiation emissions were known to have certain characteristic energies. By 1928, Gamow had solved the theory of the alpha decay of a nucleus via tunnelling, with mathe ...
Folic Acid Article from March of Dimes
Folic Acid Article from March of Dimes

... neural tube defects (NTDs). Folic acid works to prevent these birth defects only if taken before pregnancy and in the first few weeks of pregnancy. Since NTDs originate in the first month of pregnancy, before many women know they are pregnant, it is important for a woman to have enough folic acid in ...
Green Juice from Sprouts - Wheatgrass and Sprouts, LLC
Green Juice from Sprouts - Wheatgrass and Sprouts, LLC

...  Sunflower sprouts contain a full spectrum of amino acids and vitamin D. They contain chlorophyll and minerals and are a sufficient source of protein.  Sunflower sprouts contain lots of chlorophyll, which helps detoxify the liver and the blood and are an excellent source of phytosterols, which red ...
Expressway™ Cell-Free E. coli Expression System
Expressway™ Cell-Free E. coli Expression System

... flexible system allows production of recombinant protein of interest from an expression construct in as little as 3 hours. Once purified, the resulting recombinant protein is suitable for use in other downstream applications including biochemical, physical, and structural characterization. The Syste ...
High-Level Expression in Escherichia coli of Alkaline Phosphatase
High-Level Expression in Escherichia coli of Alkaline Phosphatase

... homodimer of approximately 108,000 Da. The enzyme is stable at temperatures above 80oC, activated by Mg2+, and inhibited by Zn2+. In contrast, Zn2+ is essential for the activity of E. coli APase [1, 2, 7]. The gene encoding Tca APase was recently cloned into E. coli and the primary structure was ded ...
Full-Text PDF
Full-Text PDF

... 22, 25, 28, 30, 35, 37, 40 and 45 °C and pH 4.5, 5, 5.5, 6.0, 6.5, 6.8, 7.2, 7.5 and 8.0. Nitrogen sources were tested by using liquid LMM medium in which KNO3 (0.1 g·L−1) was replaced by 0.1 g·L−1 of NH4Cl, methylamine or glycine. The growth of strains was also tested in triplicate with nitrogen-fr ...
mic.sgmjournals.org
mic.sgmjournals.org

... be included in the module (Lautru & Challis, 2004; Marahiel et al., 1997; Sieber & Marahiel, 2005). Microcystins typically contain the unusual non-proteinogenic amino acid Nmethyldehydroalanine (Mdha) (Fig. 1). N-Methylation of the microcystins is achieved by the N-methyltransferase (NMT) domain in ...
Demarcation of coding and non-coding regions of DNA using linear
Demarcation of coding and non-coding regions of DNA using linear

... codons, code for amino acids. There are two distinct regions in DNA, the gene and the intergenic DNA, or the junk DNA. Two regions can be distinguished in the gene- the exons, or the regions that code for amino acid, and the introns, or the regions that do not code for amino acid. The main aim of th ...
1200 Paul Winter
1200 Paul Winter

... • F8 Gene is very large – 186,000 bases • Gene is split into Exons and Introns • The 26 exons encode the 2332 amino acid sequence of the Factor VIII protein • The 26 exons cover 8,000 bases. • Haemophilia A is caused by a mutation of just one base ...
Characterization of lysine decarboxylase
Characterization of lysine decarboxylase

... However, the number of isolates of serovar Enteritidis without lysine-decarboxylase activity increased in Japan in 2003. Among 109 strains from distinct outbreaks, 10 lacked lysine-decarboxylase activity. Nine of the ten lysine-decarboxylase-negative strains showed quite similar pulsed-field gel ele ...
Applied Microbiology and Biotechnology
Applied Microbiology and Biotechnology

... phytases. Besides their ability to make phytate phosphorous available, elimination of chelate-forming phytate, which is known to bind nutritionally important minerals is another beneficial effect of phytase activity (Reddy et al. 1989). Most of the known microbial phytases are encoded by genes that ...
BILE ACIDS - Liquid Chromatography
BILE ACIDS - Liquid Chromatography

... for the speciRc determination of low bile acid concentrations in all biological matrices or tissues. Mass spectrometry requires very small sample volumes and Sow rates. For the HPLC separation a microsystem able to produce constant Sow rates in the range of microlitres per minute is recommended. The ...
Cell-Free Protein Expression Systems
Cell-Free Protein Expression Systems

... synthesis, such as immature red blood cells (reticulocytes). The most frequently used cell-free expression systems originate from rabbit reticulocytes, wheat germ and E. coli. There are two types of cell-free expression systems: Translation Systems and Coupled Translation and Transcription (TNT®) Sy ...
Endonucleolytic processing of CCAless tRNA precursors by RNase
Endonucleolytic processing of CCAless tRNA precursors by RNase

... eukaryota and archaea, the CCA motif, found at the 3¢ end of the amino acid accepting stem of all tRNAs, is added by an enzyme known as nucleotidyl-transferase (or CCase). In E.coli, however, the CCA motif is encoded directly by the tRNA gene in all cases. If exonucleolytic degradation of the 3¢ tra ...
Enzymatic cleavage of RNA by RNA
Enzymatic cleavage of RNA by RNA

... The transfer of genetic information from nucleic acid to protein inside cells can be re,presented as shown in Fig. 1. This simple scheme reflects accurately the fact that the information contained in the linear arrangement of the nucleotides in DNA is copied accurately into the linear arrangement of ...
Likelihood Based Clustering (LiBaC) for Codon Models, a method
Likelihood Based Clustering (LiBaC) for Codon Models, a method

... Bielawski and Yang 2001; Aris-Brosou and Bielawski 2006) and classification of sites according to selection pressure (e.g., Anisimova, Bielawski and Yang 2002; Wong et al. 2004; Kosakovsky Pond and Muse, 2005). Regardless of the method of inference, biological interpretation of any differences among ...
spectroscopic studies of mosquito iridescent virus, its capsid
spectroscopic studies of mosquito iridescent virus, its capsid

... Optical spectroscopy is one of the efficient and informative methods of studying viruses. It provides well reproducible results and is a powerful supplement to conventional biological methods of studying the living organisms. Thus, it allows one to determine the chemical composition of the capsid pr ...
Familial subepithelial corneal amyloidosis
Familial subepithelial corneal amyloidosis

... Lactoferrin consists of a single polypeptide chain with a molecular weight of 78.3 kDa and 692 amino acid residues and limited glycosylation. This nonheme glycoprotein has 33 half cystine residues, a high affinity for iron, and two metal-binding sites. Lactoferrin is found in various tissues, wet su ...
JOIN2004 Universidade do Minho
JOIN2004 Universidade do Minho

... $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; $revcom = reverse $DNA; # Next substitute all bases by their complements, # A->T, T->A, G->C, C->G, uppercase or lowercase ...
Inheritance of very high oleic acid content and its relationship with
Inheritance of very high oleic acid content and its relationship with

... (Heaton and Knowles, 1980). CL2 is also characterized by late flowering, presence of spines, and white corolla. Twenty-four half seeds of CL2 and CR-9 were analysed for seed oil fatty acid profile. The seeds were germinated and, after fifteen days in a growth chamber, the plants were transplanted to ...
DNA sentences How are proteins coded for by DNA?
DNA sentences How are proteins coded for by DNA?

... Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a doublestranded helix. The process by which DNA codes for proteins involves enzymes and additional single-stranded nucleic acids, specifically messenger ribonucleic acid (mRNA) and transfer ribon ...
Lecture 21: Structure of Prokaryotic Cells
Lecture 21: Structure of Prokaryotic Cells

... the inner most of mitochondria and it contains ribosome, DNA, RNA, enzymes to run kreb cycle and other proteins. Mitochondrial DNA is circular and it has full machinery to synthesize its own RNA (mRNA, rRNA and t-RNA) and proteins. A number of difference exist between mitochondrial DNA and DNA prese ...
“The function and synthesis of ribosomes.” Nature Reviews Mol Cell
“The function and synthesis of ribosomes.” Nature Reviews Mol Cell

... different structural domains. ...
DNA sentences - seed2stem.org
DNA sentences - seed2stem.org

... Deoxyribonucleic acid (DNA) is the molecule of life. DNA is one of the most recognizable nucleic acids, a double-stranded helix. The process by which DNA codes for proteins involves enzymes and additional single-stranded nucleic acids, specifically messenger ribonucleic acid (mRNA) and transfer ribo ...
the function and synthesis of ribosomes
the function and synthesis of ribosomes

... different structural domains. ...
< 1 2 3 4 5 6 7 8 9 10 ... 251 >

Expanded genetic code



An expanded genetic code is an artificially modified genetic code in which one or more specific codons have been re-allocated to encode an amino acid that is not among the 22 encoded proteinogenic amino acids.The key prerequisites to expand the genetic code are: the non-standard amino acid to encode, an unused codon to adopt, a tRNA that recognises this codon, and a tRNA synthase that recognises only that tRNA and only the non-standard amino acid.Expanding the genetic code is an area of research of synthetic biology, an applied biological discipline whose goal is to engineer living systems for useful purposes. The genetic code expansion enriches the repertoire of useful tools available to science.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report