• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
GENETICS TEST IV - Daytona State College
GENETICS TEST IV - Daytona State College

... • Promoter • An upstream region of a gene serving a regulatory function and to which RNA polymerase binds prior to the initiation of transcription. • Transcription begins with template binding by RNA polymerase at a promoter. ...
Genes Are DNA
Genes Are DNA

... All mutations 突變 consist of changes in the sequence of DNA. ...
Exam 2
Exam 2

... An elephant hemoglobin gene can be expressed as a translatable mRNA in E.coli cells ...
Chapter 9 .Metabolism of nucleotide
Chapter 9 .Metabolism of nucleotide

... Two important prompter consensus sequence are found in prokaryote , one located about 10 nucleotides (-10 sequence)upstream of where transcription will begin and one located about 35 nucleotides up stream(-35 sequence). The consensus sequence TATAAT located in –10 sequence is also called Pribnow box ...
Genetic Engineering and Genomics
Genetic Engineering and Genomics

... Several other enzymes are known that can break apart a DNA molecule, but an enzyme that acts indiscriminately is of little use in genetic engineering. Restriction enzymes act specifically. Each restriction enzyme generally cuts a sample of DNA in several places, wherever the DNA contains a particula ...
- Biological Sciences
- Biological Sciences

... Since the rates of formation of tRNAs, rather than their rates of transcription, are proportional to their steadystate levels (King and Attardi 1993), the intergenic sequence is similar to the adjacent tRNA gene also in that a processed transcript of one of the strands is formed at a much higher cop ...
論文要旨・審査の要旨
論文要旨・審査の要旨

... IBD may be in part due to improved hepatic nitrogen contributing to reduced oxidative stress. IBD inflammatory responses are accompanied cellular methylation reactions where the methyl donor for these reactions is S-adenosylmethionine (SAM). Significant downregulation of methionine adenosyltransfera ...
Evaluation of existing motif detection tools on their
Evaluation of existing motif detection tools on their

... DNA contains genes = specific sequences of bases that encode instructions on how to make proteins = work units of a cell ….AAATTTGGTTGTTGTCTCCCAGCTGTTTATTTCTGT Gene DNAAACAGATCTTGGAGGCTGCGGTCTGGATCCCTCGCC AAGAACCAGATCCAGGAGAAAACGTGCTCAACGTGC AGCTCTGCTCCTACTGATTATAGCCCCACAGATGACA TCGCTCCATAGTCACACCAA ...
Consultation process for this DIR application
Consultation process for this DIR application

... Ready Flex® cotton) would provide resistance to the herbicide glyphosate (marketed as Roundup®). Regulatory sequences that control expression of the introduced genes are also present in the GM cottons. These are derived from cauliflower mosaic virus (CaMV), figwort mosaic virus (FMV), soybean, pea, ...
Functional and nonfunctional mutations distinguished by random
Functional and nonfunctional mutations distinguished by random

... N181D1N218S have similar half-lives of thermoinactivation at 65°C and similar melting temperatures, Tm. The half-lives at 65°C of single mutants N181D and N218S are '3- and 2-fold greater than that of wild-type subtilisin E, respectively, and their Tms are 3.7 and 3.2°C higher. Thus, both functional ...
Protocols - BioMed Central
Protocols - BioMed Central

... 2. Preparation of vectors for USER Friendly cloning Production of pRF-HU2 and pRF-HU2E vectors: The pRF-HU2 and pRF-HU2E vectors are maintained as low copy number plasmids in E. coli. The protocol requires 10 µg, why it is necessary to maxiprep the vectors from 3 L of LB culture. 1. Inoculate a 10 ...
Gene Section Transcription 3) Atlas of Genetics and Cytogenetics
Gene Section Transcription 3) Atlas of Genetics and Cytogenetics

... Phosphorylation leads to dimerization of STAT3 via intermolecular pTyr-SH2 interactions. STAT3 can also heterodimerize with STAT1. (Recent data suggests that STAT3 can possibly form a dimmer without tyrosine phosphorylation and that phosphorylation leads to changes dimmer conformation). Tyrosine of ...
Isolation and characterization of cDNA clones encoding
Isolation and characterization of cDNA clones encoding

... therefore derived from the same gene or from allelic genes. The clone with the longest open reading frame (499 nucleotides) was pNt SNN cPRla/35. Two clones, pNt SNN cPRla/8 and pNt SNN cPRlc/83, had long poly(dA) tails with 48 and 35 residues, respectively, while another clone, pNt cPRla/35, had on ...
MyTaq™ HS DNA Polymerase
MyTaq™ HS DNA Polymerase

... II Plant DNA Kit. Decreasing amounts of DNA were amplified using MyTaq HS. Two fragments of the tubulin gene of Oryza sativa were amplified in singleplex (0.5kb and 2kb fragments) and as a multiplex (0.5kb, 1kb, 2kb fragments) using MyTaq HS. M EasyLadder I ...
gene addition
gene addition

... • Abnormal gene swapped for a normal gene through homologous recombination • Abnormal gene could be repaired through selective reverse mutation which returns the gene to its normal function. • The regulation of a particular gene could be altered. ...
Lesson 3
Lesson 3

... • For the design of media used for the production of cell mass, the determination of an elemental material balance is a useful exercise. • For defined media, the determination is a straightforward calculation from the components. • For complex media, Traders’ Co. and other manufacturers of complex n ...
recombinant DNA. Lesson Overview
recombinant DNA. Lesson Overview

... If two DNA molecules are cut with the same restriction enzyme, their sticky ends will bond to a DNA fragment that has the complementary base sequence. DNA ligase then joins the two fragments. The resulting molecules are called recombinant DNA. ...
Friesland Foods Normal
Friesland Foods Normal

... should be similar (i.e. similar composition, and the same size and spacing). Therefore, established binding motifs of regulator-protein family members were taken into account to define the actual binding motif. In addition, we defined the motifs such that they obey general constraints imposed by the ...
Chpt3_Isolating_analyzing_genes.doc
Chpt3_Isolating_analyzing_genes.doc

... Plasmids are autonomously replicating circular DNA molecules found in bacteria. They have their own origin of replication, and they replicate independently of the origins on the "host" chromosome. Replication is usually dependent on host functions, such as DNA polymerases, but regulation of plasmid ...
Procedure - IFM - Linköpings universitet
Procedure - IFM - Linköpings universitet

... In order to safely be able to find transformants with the cloned gene there are a number of different methods. The best thing is to do a plasmid preparation on a number of colonies and determine the DNA sequence of the different clones. Since this method is somewhat tedious, we will try to do "colon ...
Sequence Enhancer Information - Garvan Institute of Medical
Sequence Enhancer Information - Garvan Institute of Medical

... with a high GC content. These molecules have been shown in the past to enhance amplification separately or in combinations of two, such as with 7-deaza-dGTPbetaine or betaine-DMSO. In our hands, the latter combination was not sufficient to achieve amplification of the tested sequences, whereas the a ...
LECT34 RNAproc
LECT34 RNAproc

... Ans: The -OH on the 3’ end of the liberated exon becomes a nucleophile and attacks the 3’-splice site of the intron. This is the second step. The two exons are now joined. What happens to the intron? Ans: The intron is set free. Because a 2’-OH on an adenosine caused the initial cleavage, there is a ...
Thursday and Friday
Thursday and Friday

... genes that have evolved by recombination or insertion of unrelated regions of DNA. In instances such as this, a global similarity score will be greatly reduced. In cases where genes are being aligned whose sequences are of comparable length and also whose entire gene is homologous (descent from a co ...
The application of Microarray in Medicine
The application of Microarray in Medicine

... First-trimester or second-trimester screening, or both, for Down’s syndrome. New England Journal of Medicine. 2005;353(19):2001-11. 16. Behzadi P, E. B. Study of microbial biochemical reactions in bacteriology ...
Introduction to Cellular and Molecular Biology (BIOL 190)
Introduction to Cellular and Molecular Biology (BIOL 190)

... 1. Recognize there are biochemical similarities among all living things 2. Distinguish between the three domains of life and the four kingdoms within Eukarya 3. Understand the basic idea of descent with modification and that Darwin proposed natural selection as a primary mechanism of evolution Scien ...
< 1 ... 56 57 58 59 60 61 62 63 64 ... 295 >

Promoter (genetics)



In genetics, a promoter is a region of DNA that initiates transcription of a particular gene. Promoters are located near the transcription start sites of genes, on the same strand and upstream on the DNA (towards the 5' region of the sense strand).Promoters can be about 100–1000 base pairs long.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report