• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
RNA-Seq Sample Recommendations (Craig Praul, PSU and Caitlyn
RNA-Seq Sample Recommendations (Craig Praul, PSU and Caitlyn

... Investigators need to carefully choose their methods of tissue and cell isolation as the choice of these methods have a direct impact on the quality and quantity of RNA subsequently obtained. If possible total RNA purification should follow tissue/cell dissection immediately to prevent alterations i ...
Chapter 13
Chapter 13

... Any other sugar must be converted to glucose before it can enter the glycolysis pathway & this takes energy. It is advantageous to have the potential to utilize other sugars (carbon sources), but want to only synthesize the proteins necessary for utilization of these sugars only when glucose is abse ...
Enzymes involved in DNA replication Enzyme Role Helicase or
Enzymes involved in DNA replication Enzyme Role Helicase or

... o No  primer  required,  use  NTPs  as  substrate   -­‐ All  DNA  (not  RNA)  polymerases  have  a  3’  →  5’  exonuclease  activity  –  proof  reading     o Cleaves  backbone,  removes  recently  added  nucleotide  if  not  complementary ...
No Slide Title
No Slide Title

... Each aaRS recognizes its particular amino acid and the tRNAs coding for that amino acid. Accurate translation of the genetic code depends on attachment of each amino acid to an appropriate tRNA. Domains of tRNA recognized by an aaRS are called identity elements. Most identity elements are in the ...
Protein Synthesis - Biology Junction
Protein Synthesis - Biology Junction

... begin the Transcription of RNA • Called the TATA box • Specific base sequences act as signals to stop • Called the termination signal copyright cmassengale ...
Transcription and Translation
Transcription and Translation

... – Transcribe: to copy (copy in the same nucleic acid language, but only copy what is needed) ...
File
File

... two copies of each chromosome/DNA molecule/chromatid needed; helicase unwinds the DNA/double helix; to allow the strands to be separated; helicase separates the two (complementary) strands of DNA; by breaking hydrogen bonds between bases; [4 max] (b) DNA replication is semi-conservative; DNA is spli ...
From Gene to Protein—Transcription and Translation
From Gene to Protein—Transcription and Translation

...  To model the process of transcription, you and your partner will need o a page showing an RNA polymerase molecule inside a nucleus (see picture below) o a paper strip showing the single strand of DNA labeled "Beginning of Hemoglobin Gene" o RNA nucleotides and tape.  One of you will act as the RN ...
What are the molecular mechanisms that induce neuronal
What are the molecular mechanisms that induce neuronal

... the Nematostella Vectensis (N.vectensis) nervous system. Specifically this will be examined by testing the hypothesis that the N. Vectensis bHLH domain containing homologs of the Drosophila atonal neural transcription factors are involved in neural patterning during embryonic development. Evaluating ...
Inquiry into Life Twelfth Edition
Inquiry into Life Twelfth Edition

... • Remodeling allows TFIID to bind 2 acetylated Lys in the nucleosomes through the dual bromodomain in TAFII250 • TFIID binding – Bends the DNA ...
Non-protein-coding RNA
Non-protein-coding RNA

... The number of ncRNAs in an organism rises with its complexity. Just a small number of ncRNAs exist in prokaryotes, and the numbers of ncRNAs are higher in eukaryotes (Mattick and Makunin 2006). For many of the identified lincRNAs, no function has yet been discovered. The term “long ncRNA” applies w ...
DNA
DNA

... Chromatin Modification: Histone Modification - Histone tails are highly decorated with residues such as Lys, Arg, Ser, Thr and Tyr - Many of these residues in histones are subject to post-translational modification (PTM) by enzymes that couple the extra/ intra-cellular needs of the cell with the st ...
Accounting for all the factors
Accounting for all the factors

... suggest the assay can generate standardized results. Techniques for quantifying transcription factor activity have been Indeed, the assay reliably detected increases in TF activity resulting limited to examining only a few targets at a time. Now, researchers from compounds with known transcriptional ...
SLG MOCK MIDTERM – FOR PRACTICE ONLY
SLG MOCK MIDTERM – FOR PRACTICE ONLY

... DISCLAIMER: PASS handouts are designed as a study aid only for use in PASS workshops. Handouts may contain errors, intentional or otherwise. It is up to the student to verify the information contained within. ...
A1991GH39300001
A1991GH39300001

... paper, and it worited rigid away. We got plenty of I came to Philip Leder’s laboratory at the National labeled amino acids incorporated into protein ditnstitute of Child Health and Human Development rectedbymRNA. in 1970 after finishing my doctorate at the I immediately followed this ~ by runWeumann ...
Gene Section EIF3C (eukaryotic translation initiation factor 3, subunit C)
Gene Section EIF3C (eukaryotic translation initiation factor 3, subunit C)

... Schematic of the 913 amino acid eIF3c protein with amino acid positions shown and locations of the PCI domain. Also indicated are the known minimal regions in eIF3c required for binding by interacting proteins. These include eIF complexes eIF1 and eIF5, the NF2 tumor suppressor merlin, and murine vi ...
5`ccugaugcaugccuagaugccauaacgggcuuaaauagauga3`
5`ccugaugcaugccuagaugccauaacgggcuuaaauagauga3`

... 15. Three types of RNA polymerases are used in eukaryotic transcription. Which statement concerning eukaryotic RNA polymerases is CORRECT? a) All RNA polymerases have a carboxy-terminal domain that becomes phosphorylated. b) RNA polymerase I transcribes genes coding for pre-rRNA. c) RNA polymerase I ...
MolBio Tech Data_new.cdr
MolBio Tech Data_new.cdr

... 200 mM Tris-HCl (pH 8.0 at 22oC), 100 mM KCl, 0.5% Tween 20, 0.5% Nonidet-P40, 0.1 mM EDTA, 1mM DTT and 50% Glycerol. Store at –20oC. Guidelines for PCR optimization using HiMedia’s Taq Polymerase: • DNA Template 1. Use high quality, purified DNA templates 2. Approximately 104 copies are required to ...
Long Noncoding RNAs Add Another Layer to Pre
Long Noncoding RNAs Add Another Layer to Pre

... long ncRNAs have been shown to act as chromatin modifiers, as transcriptional regulators that affect the activity of transcription factors or RNA polymerase II, and as posttranscriptional regulators that bind to complementary RNA sequences (Mercer et al., 2009). In other words, long ncRNAs seem to h ...
powerpoint
powerpoint

... 2. Transcription - DNA is "read" and RNA is made - an enzyme binds to DNA in a specific region - the DNA "unzips" - the enzyme links together RNA bases that are complementary to one of the DNA strands. - So, a DNA GENE was "read" and an m-RNA "copy" was made G TA C G G T C AT G AAA C T G ...
LAC OPERON: A CONCEPT TO BE CLEARED What is an
LAC OPERON: A CONCEPT TO BE CLEARED What is an

... In the absence of lactose, a repressor protein encoded by the regulatory gene binds to the lac operator and prevents its transcription. This repressor protein has 2 binding sites: 1. With the allolactose molecule, 2. With the operator site. Binding of allolactose (which is synthesized from the lacto ...
Visualization of RNA molecules using VMD
Visualization of RNA molecules using VMD

... 3d structure just like the tertiary structure of proteins is dependent on the aminoacid sequence. Indeed, some RNA molecules even exhibit enzyme-like catalytic abitilies. ...
Uncovering the regulatory networks of gastrulation: A systems
Uncovering the regulatory networks of gastrulation: A systems

... Gastrulation is the complex process during embryogenesis by which pluripotent epiblast cells give rise to the three primary germ layers: endoderm, ectoderm, and mesoderm. Despite extensive investigation of pre-gastrulation and gastrulation stages of mammalian development, relatively little is known ...
post-transcription
post-transcription

... sequence of RNA after transcription. • In some RNAs, as much as 55% of the nucleotide sequence is not encoded in the (primary) gene, but is added after transcription. • Examples: mitochondrial genes in Trypanosomes ...
Chapter02 Nucleotides and Nucleic Acids(核酸化学)
Chapter02 Nucleotides and Nucleic Acids(核酸化学)

... Splicing produces final mRNA without introns Ribosomal RNA Ribosomes are about 2/3 RNA, 1/3 protein rRNA serves as a scaffold for ribosomal proteins 23S rRNA in E. coli is the peptidyl transferase! Transfer RNA Small polynucleotide chains - 73 to 94 residues each Several bases usually methylated Eac ...
< 1 ... 39 40 41 42 43 44 45 46 47 ... 155 >

RNA polymerase II holoenzyme

RNA polymerase II holoenzyme is a form of eukaryotic RNA polymerase II that is recruited to the promoters of protein-coding genes in living cells. It consists of RNA polymerase II, a subset of general transcription factors, and regulatory proteins known as SRB proteins.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report