• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Equality and Equity in Curriculum
Equality and Equity in Curriculum

... of the claims, methods, and designs. Unit 1: Molecular Genetics ...
Molecular analysis of putative genetic factors affecting BSE
Molecular analysis of putative genetic factors affecting BSE

... pools. This was considerably more labour intensive, but increased confidence could be placed on the interpretation of the pattern of fragments revealed. In addition to the problems with the pooling protocol when using variable quality DNA, the initial assumption that particular loci would be found e ...
Kinoshita, T et al.
Kinoshita, T et al.

... sequence, without a tandem repeat structure, is responsible for the imprinted pattern of FWA expression in A. halleri [34]. Thus, in A. halleri at least, the tandem repeat structure, but not the SINE-related sequence, is dispensable for imprinting. The relationship between genomic imprinting and tra ...
pdf
pdf

... a. 5' end label: T4 polynucleotide kinase and [γ 32P] ATP. The reaction is most efficient if the 5' phosphate is removed (by alkaline phosphatase) prior to the kinase treatment. b. 3' end label: Klenow DNA polymerase plus [α 32P] dNTP. The labeled dNTP is chosen to be complementary to the first posi ...
Summary and Discussion English
Summary and Discussion English

... Conservation of genomic integrity is essential for correct expression of the genome and for the faithful transmission of genetic information to the next generations. However, all living organisms are continuously exposed to a variety of endogenous and environmental DNA-damaging agents, which threat ...
Cloning, characterization and in vitro and in planta expression of a
Cloning, characterization and in vitro and in planta expression of a

... Several key cellular events, such as adhesion to the host surface, penetration, and colonization of host tissue, take place during plant infection by oomycetes that can also manipulate biochemical and physiological processes in their host plants through a diverse array of virulence or avirulence mol ...
Word
Word

... appropriate levels of laboratory training, containment, or other steps necessary to ensure that the work is carried out safely and in compliance will pertinent guidelines and regulations. In addition to the basic information regarding your research that is requested in this IBC-1 form, please answer ...
Dynamics and control of DNA sequence amplification
Dynamics and control of DNA sequence amplification

... polymerization on single-stranded DNA (ssDNA) templates. Such methods have arguably become the central technology of experimental molecular biology and biochemistry, due to the fact that DNA amplification is required almost universally in applications ranging from molecular cloning to DNA sequencing ...
Pearson science 10 Teaching Program 3–4 weeks Chapter 1 DNA
Pearson science 10 Teaching Program 3–4 weeks Chapter 1 DNA

...  investigating the development of the Watson and Crick double helix model for the structure of DNA  investigating the history and impact of developments in genetic knowledge Advances in scientific understanding often rely on developments in technology and technological advances are often linked to ...
Development of a DNA vaccine against chicken anemia virus by
Development of a DNA vaccine against chicken anemia virus by

... Vielitz and Landgraf [8] have developed a vaccine against CAV, which is based on non-attenuated virulent CAV propagated in chicken embryos. An attenuated live vaccine, developed by Steenhuisen et al. [9] is also commercially available. However, these vaccines cannot be used in chickens in lay and wi ...
What Darwin didn`t know: Mendel and basic genetics Extending
What Darwin didn`t know: Mendel and basic genetics Extending

GeNeViSTA Coffin Siris Syndrome: A Disorder of SWI/SNF Pathway
GeNeViSTA Coffin Siris Syndrome: A Disorder of SWI/SNF Pathway

Real-Time PCR Probe Design
Real-Time PCR Probe Design

... •Select dyes with excitation/emission maxima compatible with the excitation/detection ranges of the instrument. •Select the appropriate quencher for each dye •Select non-fluorescent quenchers (e.g. BHQs, Dabcyl) instead of ...
PE_Ans_Bk8_e_public
PE_Ans_Bk8_e_public

... while it takes many generations for traditional breeding to achieve the result. (1 mark) Also, in cloning, all the offspring will obtain the desirable characters of their parents (1 mark) because there is no genetic variation. ...
Molecular Evidence for Vector Implication of Onchocerca lupi in Los
Molecular Evidence for Vector Implication of Onchocerca lupi in Los

... Onchocerca is a genus of filarial parasites with worldwide distribution and is typically associated with ungulates, including horses and cattle. The causative agent of human “river blindness” also resides within the same genus (Zarfoss, Dubielzig, Eberhard, & Schmidt, 2005). Historically, canids wer ...
Alpha -antitrypsin  alleles  in  patients  with ... emphysema,  detected  by  DNA  amplification ...
Alpha -antitrypsin alleles in patients with ... emphysema, detected by DNA amplification ...

... been the method of choice for AAT phenotyping. The technique is rather simple but interpretation of the bands can be difficult and demands skilled personnel. The method can identify about 60 protein variants including the deficient AAT types, PiZ and PiS, which compose the vast majority of the disea ...
pSAT vectors: a modular series of plasmids for autofluorescent
pSAT vectors: a modular series of plasmids for autofluorescent

... Supplement 2. A detailed description of plasmid construction methods. Construction of pSAT vectors The original MCS of pUC18 (Norrander et al., 1983) was replaced by PCR amplification of the entire plasmid backbone using the primers 5’AAATACTGCAGCCATGGAATTCTAGAGCGGCCGCGTAATCATGGTCATAGCTGTTT CC3’ and ...
Characterization of Complementary DNA Encoding the Precursor for
Characterization of Complementary DNA Encoding the Precursor for

... block of homology to mGAP, within a region which itself is highly conserved among the mammalian species. To assure that the isolated cichlid cDNA did not represent a cloning artifact in this region, three independent oligo(dT)-primed reverse transcription reactions were performed using the same mRNA ...
Identification of markers tightly linked to tomato yellow
Identification of markers tightly linked to tomato yellow

... Cf-5, and Ty-1 alleles, suggesting that the allele of the JB-1 marker is also linked to the Mi gene. Although great strides have been made in breeding for resistance to TYLCD, most of the commercial hybrids resistant to TYLCD only contain a single resistance gene. One of the strategies for resistanc ...
Blueprint of Life
Blueprint of Life

... Showed that inherited characteristics are passed down as discrete unit from parents to their offspring. This was shown through experiments with pea plants. Pea plants were used because they can be easily cross-bred, have a short life cycle & both male & female parts are prevent in their flowers. Men ...
as PDF
as PDF

... An alternative dsDNA stain is SYBR Green I, produced by Invitrogen. Despite the fact that SYBR Green is more expensive, it is 25 times more sensitive than ethidium bromide (Jin et al., 1994). SYBR Safe, a variant of SYBR Green, has been shown to have low levels of mutagenicity and toxicity compared ...
A new FISH protocol with increased sensitivity for
A new FISH protocol with increased sensitivity for

... both on and out of the nuclei (Morais-Cecilio et al., 1997). Table 1, which shows the percentage of labelled nuclei, gives an estimation of the hybridization efficiency, that is between 45% and 70% depending on the probe and on the material. Table 2 shows the distribution of the number of spots per nu ...
Genomic imprinting and human disease
Genomic imprinting and human disease

... known imprinted genes are arranged in clusters of several tens up to thousands of kilobases (kb) in size. Imprinted gene expression across these evolutionarily conserved clusters is regulated by ICRs (imprinting control regions), essential DNA sequence elements that are up to several kilobases in si ...
Recessive mutations
Recessive mutations

... specific mutation in a population of cells or individuals Both are low in value and vary by location. ...
Trawling DNA Databases for Partial Matches: What is the FBI Afraid
Trawling DNA Databases for Partial Matches: What is the FBI Afraid

... DNA evidence is often presented as the "gold standard"for forensic science. But this was not always the case. For years, eminent scientists complained that the estimates of the tiny frequencies of DNA types were unfounded. It took scores of research papers, dozens of judicial opinions, and two commi ...
< 1 ... 48 49 50 51 52 53 54 55 56 ... 652 >

Molecular cloning



Molecular cloning is a set of experimental methods in molecular biology that are used to assemble recombinant DNA molecules and to direct their replication within host organisms. The use of the word cloning refers to the fact that the method involves the replication of one molecule to produce a population of cells with identical DNA molecules. Molecular cloning generally uses DNA sequences from two different organisms: the species that is the source of the DNA to be cloned, and the species that will serve as the living host for replication of the recombinant DNA. Molecular cloning methods are central to many contemporary areas of modern biology and medicine.In a conventional molecular cloning experiment, the DNA to be cloned is obtained from an organism of interest, then treated with enzymes in the test tube to generate smaller DNA fragments. Subsequently, these fragments are then combined with vector DNA to generate recombinant DNA molecules. The recombinant DNA is then introduced into a host organism (typically an easy-to-grow, benign, laboratory strain of E. coli bacteria). This will generate a population of organisms in which recombinant DNA molecules are replicated along with the host DNA. Because they contain foreign DNA fragments, these are transgenic or genetically modified microorganisms (GMO). This process takes advantage of the fact that a single bacterial cell can be induced to take up and replicate a single recombinant DNA molecule. This single cell can then be expanded exponentially to generate a large amount of bacteria, each of which contain copies of the original recombinant molecule. Thus, both the resulting bacterial population, and the recombinant DNA molecule, are commonly referred to as ""clones"". Strictly speaking, recombinant DNA refers to DNA molecules, while molecular cloning refers to the experimental methods used to assemble them.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report