• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Course: Immunology Lecturer: Dr. Weam Saad Practical Lecture
Course: Immunology Lecturer: Dr. Weam Saad Practical Lecture

... technique used to measure the concentration of Ag in a solution mixed with other Ags when specific antiserum used. The equivalence zoon is called the endpoint because it represents the point where the diameter of the well stops to increase. This endpoint diameter represents the actual concentration ...
Evidence For Evolution
Evidence For Evolution

... Fossils of ancient organisms are simpler in form than modern organisms. Sequences of fossils have been discovered that show a graded, gradual series of changes in form as one progresses through layers of sediment or volcanic ash. The oldest fossils (hence oldest organisms) are in the deepest layers ...
File
File

View Poster - Technology Networks
View Poster - Technology Networks

... generate the perpetrator’s DNA profile. However, the use of DNA isolated via differential extraction for DNA typing shows two major limitations. First, DNA typing results in mixed DNA profiles as sperm cell DNA fractions are contaminated by DNA derived from the victim, and hence, cause a decrease in ...
1 BIOINFORMATICS Bioinformatics, based on National Institutes of
1 BIOINFORMATICS Bioinformatics, based on National Institutes of

... (On the search page you have to choose „Database: Human”) For the „S” pair of primer (that amlifies the mutated version only) we change the 3’ C to T (in the coding strand: G to A): 5’ tgctgccctctgtattcctt 3’ Check this primer for specificity as well. B/II Let’s examine if this mutation could be det ...
AronsonDOE group meeting presentation
AronsonDOE group meeting presentation

... con/nuous
field
measurement
of
CO2
fluxes – There
is
one
auto‐chamber
in
each
treatment combina/on
sub‐plot ...
Emerging real-time PCR applications.
Emerging real-time PCR applications.

Sequencing genomes
Sequencing genomes

... • Relies on detection of pyrophosphate release on nucleotide ...
dna model criteria - Mayfield City Schools
dna model criteria - Mayfield City Schools

Homeotic genes - Teacherschoice
Homeotic genes - Teacherschoice

Homeotic genes
Homeotic genes

Finding Regulatory Sites - TAMU Computer Science Faculty Pages
Finding Regulatory Sites - TAMU Computer Science Faculty Pages

... which is the least likely to appear by chance. It uses the expectation-maximization (EM) approach: first obtain an initial motif (which may not be very good), then iteratively obtain a better motif with the following two steps: • Expectation: compute the statistical composition of the current motif ...
Cloning and nucleotide sequence of a gene upstream of the eaeA
Cloning and nucleotide sequence of a gene upstream of the eaeA

... 82 min which is also the location of a large (approx. 70 kb) insert in the uropathogenic E. coli. This large insert or ‘pathogenicity island’ contains virulence factor genes in uropathogenic E. coli. The fact that the LEE of EHEC and EPEC is located at the same chromosomal site suggests that this re ...
Stem cell researchers uncover previously unknown patterns in DNA
Stem cell researchers uncover previously unknown patterns in DNA

... the genome and that DNA methyltransfereases (the enzymes that methylates DNA) preferentially target nucloesome-bound DNA," said Pellegrini, an associate professor of molecular, cell and developmental biology and an informatics expert. The work was initially done in Arabidopsis, a mustard weed common ...
DNA - Laboratory of Theory of Biopolymers
DNA - Laboratory of Theory of Biopolymers

... • In an adult multicellular organism, there is a wide variety of cell types seen in the adult. eg, muscle, nerve and blood cells. • The different cell types contain the same DNA though. • This differentiation arises because different cell types express different genes. ...
Chapter 21
Chapter 21

... 4. Posttranslational control (cytoplasm) – changes to the protein to make it functional ...
Gene prediction
Gene prediction

... • Long open reading frames may be a gene. At random, we should expect one stop codon every (64/3) ~= 21 codons. However, genes are usually much longer than this • A basic approach is to scan for ORFs whose length exceeds certain threshold. This is naïve because some genes (e.g. some neural and immun ...
Protein Li SDS PAGE
Protein Li SDS PAGE

... Asp and Glu are acidic, His, Lys and Arg are basic, SH of Cys and phenol of Tyr are weakly acidic. The whole charge of the protein – besides the amino acid composition - depends on the pH of the medium. In mild alkaline condition most proteins have net negative charge, therefore they migrate toward ...
Kylt® RNA / DNA Purification
Kylt® RNA / DNA Purification

...  wabs should be pooled in a sufficient volume of sterile buffer (e.g., Normal Saline or 0.1 x TE) and soaked for an S adequate period of time. Then, the sample is washed out thoroughly by pulse-vortexing and the supernatant is used. Alternativeyl swabs may directly be emerged in Lysis solution. T ...
Comparison Between Currently Used Blood Samples And New
Comparison Between Currently Used Blood Samples And New

Transcription - My Teacher Pages
Transcription - My Teacher Pages

... Once the entire gene has been transcribed, the RNA strand detaches completely from the DNA. Exactly how RNA polymerase recognizes the end of a gene is very complicated but we will discuss as it reaching a Stop signal. ...
Reporter genes
Reporter genes

... The human growth hormone (hGH) encoded reporter protein is secreted into the culture medium by transfected cells. The hGH from the supernatant of the culture medium binds to the antibody on the plate. Subsequently, the bound hGH is detected in two steps via a digoxigenincoupled anti-hGH antibody and ...
Cloning and sequencing of glutamate mutase component E from
Cloning and sequencing of glutamate mutase component E from

... coupling the conversion of glutamate to methylaspartate with the conversion of the latter to mesaconic acid, catalyzed by methylaspartase, which can be followed by the increase in OD 240 • The assay mixture consisted of 10 mM L-glutamate, 50 mM Tris/HCl, pH 8.2, 3 mM coenzyme B 12, 10 mM KCl, 2 mM M ...
Genetics DNA and Genetics
Genetics DNA and Genetics

... The effects of a mutation depend on where in the DNA sequence the mutation happens and the type of mutation. Proteins express traits. Because mutations can change proteins, they can cause traits to change. Some mutations in human DNA cause genetic disorders. With more research, scientists hope to fi ...
REMTEC 29sep - site characterisation
REMTEC 29sep - site characterisation

... and bacterial distribution in groundwater and matrix. Understanding of all the complex processes and where these takes place. Investigate which microorganisms that are present, as well as their ability to move from permeable layers into the clayey till matrix. ...
< 1 ... 292 293 294 295 296 297 298 299 300 ... 512 >

Community fingerprinting

  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report