Course: Immunology Lecturer: Dr. Weam Saad Practical Lecture
... technique used to measure the concentration of Ag in a solution mixed with other Ags when specific antiserum used. The equivalence zoon is called the endpoint because it represents the point where the diameter of the well stops to increase. This endpoint diameter represents the actual concentration ...
... technique used to measure the concentration of Ag in a solution mixed with other Ags when specific antiserum used. The equivalence zoon is called the endpoint because it represents the point where the diameter of the well stops to increase. This endpoint diameter represents the actual concentration ...
Evidence For Evolution
... Fossils of ancient organisms are simpler in form than modern organisms. Sequences of fossils have been discovered that show a graded, gradual series of changes in form as one progresses through layers of sediment or volcanic ash. The oldest fossils (hence oldest organisms) are in the deepest layers ...
... Fossils of ancient organisms are simpler in form than modern organisms. Sequences of fossils have been discovered that show a graded, gradual series of changes in form as one progresses through layers of sediment or volcanic ash. The oldest fossils (hence oldest organisms) are in the deepest layers ...
View Poster - Technology Networks
... generate the perpetrator’s DNA profile. However, the use of DNA isolated via differential extraction for DNA typing shows two major limitations. First, DNA typing results in mixed DNA profiles as sperm cell DNA fractions are contaminated by DNA derived from the victim, and hence, cause a decrease in ...
... generate the perpetrator’s DNA profile. However, the use of DNA isolated via differential extraction for DNA typing shows two major limitations. First, DNA typing results in mixed DNA profiles as sperm cell DNA fractions are contaminated by DNA derived from the victim, and hence, cause a decrease in ...
1 BIOINFORMATICS Bioinformatics, based on National Institutes of
... (On the search page you have to choose „Database: Human”) For the „S” pair of primer (that amlifies the mutated version only) we change the 3’ C to T (in the coding strand: G to A): 5’ tgctgccctctgtattcctt 3’ Check this primer for specificity as well. B/II Let’s examine if this mutation could be det ...
... (On the search page you have to choose „Database: Human”) For the „S” pair of primer (that amlifies the mutated version only) we change the 3’ C to T (in the coding strand: G to A): 5’ tgctgccctctgtattcctt 3’ Check this primer for specificity as well. B/II Let’s examine if this mutation could be det ...
AronsonDOE group meeting presentation
... con/nuous field measurement of CO2 fluxes – There is one auto‐chamber in each treatment combina/on sub‐plot ...
... con/nuous field measurement of CO2 fluxes – There is one auto‐chamber in each treatment combina/on sub‐plot ...
Finding Regulatory Sites - TAMU Computer Science Faculty Pages
... which is the least likely to appear by chance. It uses the expectation-maximization (EM) approach: first obtain an initial motif (which may not be very good), then iteratively obtain a better motif with the following two steps: • Expectation: compute the statistical composition of the current motif ...
... which is the least likely to appear by chance. It uses the expectation-maximization (EM) approach: first obtain an initial motif (which may not be very good), then iteratively obtain a better motif with the following two steps: • Expectation: compute the statistical composition of the current motif ...
Cloning and nucleotide sequence of a gene upstream of the eaeA
... 82 min which is also the location of a large (approx. 70 kb) insert in the uropathogenic E. coli. This large insert or ‘pathogenicity island’ contains virulence factor genes in uropathogenic E. coli. The fact that the LEE of EHEC and EPEC is located at the same chromosomal site suggests that this re ...
... 82 min which is also the location of a large (approx. 70 kb) insert in the uropathogenic E. coli. This large insert or ‘pathogenicity island’ contains virulence factor genes in uropathogenic E. coli. The fact that the LEE of EHEC and EPEC is located at the same chromosomal site suggests that this re ...
Stem cell researchers uncover previously unknown patterns in DNA
... the genome and that DNA methyltransfereases (the enzymes that methylates DNA) preferentially target nucloesome-bound DNA," said Pellegrini, an associate professor of molecular, cell and developmental biology and an informatics expert. The work was initially done in Arabidopsis, a mustard weed common ...
... the genome and that DNA methyltransfereases (the enzymes that methylates DNA) preferentially target nucloesome-bound DNA," said Pellegrini, an associate professor of molecular, cell and developmental biology and an informatics expert. The work was initially done in Arabidopsis, a mustard weed common ...
DNA - Laboratory of Theory of Biopolymers
... • In an adult multicellular organism, there is a wide variety of cell types seen in the adult. eg, muscle, nerve and blood cells. • The different cell types contain the same DNA though. • This differentiation arises because different cell types express different genes. ...
... • In an adult multicellular organism, there is a wide variety of cell types seen in the adult. eg, muscle, nerve and blood cells. • The different cell types contain the same DNA though. • This differentiation arises because different cell types express different genes. ...
Chapter 21
... 4. Posttranslational control (cytoplasm) – changes to the protein to make it functional ...
... 4. Posttranslational control (cytoplasm) – changes to the protein to make it functional ...
Gene prediction
... • Long open reading frames may be a gene. At random, we should expect one stop codon every (64/3) ~= 21 codons. However, genes are usually much longer than this • A basic approach is to scan for ORFs whose length exceeds certain threshold. This is naïve because some genes (e.g. some neural and immun ...
... • Long open reading frames may be a gene. At random, we should expect one stop codon every (64/3) ~= 21 codons. However, genes are usually much longer than this • A basic approach is to scan for ORFs whose length exceeds certain threshold. This is naïve because some genes (e.g. some neural and immun ...
Protein Li SDS PAGE
... Asp and Glu are acidic, His, Lys and Arg are basic, SH of Cys and phenol of Tyr are weakly acidic. The whole charge of the protein – besides the amino acid composition - depends on the pH of the medium. In mild alkaline condition most proteins have net negative charge, therefore they migrate toward ...
... Asp and Glu are acidic, His, Lys and Arg are basic, SH of Cys and phenol of Tyr are weakly acidic. The whole charge of the protein – besides the amino acid composition - depends on the pH of the medium. In mild alkaline condition most proteins have net negative charge, therefore they migrate toward ...
Kylt® RNA / DNA Purification
... wabs should be pooled in a sufficient volume of sterile buffer (e.g., Normal Saline or 0.1 x TE) and soaked for an S adequate period of time. Then, the sample is washed out thoroughly by pulse-vortexing and the supernatant is used. Alternativeyl swabs may directly be emerged in Lysis solution. T ...
... wabs should be pooled in a sufficient volume of sterile buffer (e.g., Normal Saline or 0.1 x TE) and soaked for an S adequate period of time. Then, the sample is washed out thoroughly by pulse-vortexing and the supernatant is used. Alternativeyl swabs may directly be emerged in Lysis solution. T ...
Transcription - My Teacher Pages
... Once the entire gene has been transcribed, the RNA strand detaches completely from the DNA. Exactly how RNA polymerase recognizes the end of a gene is very complicated but we will discuss as it reaching a Stop signal. ...
... Once the entire gene has been transcribed, the RNA strand detaches completely from the DNA. Exactly how RNA polymerase recognizes the end of a gene is very complicated but we will discuss as it reaching a Stop signal. ...
Reporter genes
... The human growth hormone (hGH) encoded reporter protein is secreted into the culture medium by transfected cells. The hGH from the supernatant of the culture medium binds to the antibody on the plate. Subsequently, the bound hGH is detected in two steps via a digoxigenincoupled anti-hGH antibody and ...
... The human growth hormone (hGH) encoded reporter protein is secreted into the culture medium by transfected cells. The hGH from the supernatant of the culture medium binds to the antibody on the plate. Subsequently, the bound hGH is detected in two steps via a digoxigenincoupled anti-hGH antibody and ...
Cloning and sequencing of glutamate mutase component E from
... coupling the conversion of glutamate to methylaspartate with the conversion of the latter to mesaconic acid, catalyzed by methylaspartase, which can be followed by the increase in OD 240 • The assay mixture consisted of 10 mM L-glutamate, 50 mM Tris/HCl, pH 8.2, 3 mM coenzyme B 12, 10 mM KCl, 2 mM M ...
... coupling the conversion of glutamate to methylaspartate with the conversion of the latter to mesaconic acid, catalyzed by methylaspartase, which can be followed by the increase in OD 240 • The assay mixture consisted of 10 mM L-glutamate, 50 mM Tris/HCl, pH 8.2, 3 mM coenzyme B 12, 10 mM KCl, 2 mM M ...
Genetics DNA and Genetics
... The effects of a mutation depend on where in the DNA sequence the mutation happens and the type of mutation. Proteins express traits. Because mutations can change proteins, they can cause traits to change. Some mutations in human DNA cause genetic disorders. With more research, scientists hope to fi ...
... The effects of a mutation depend on where in the DNA sequence the mutation happens and the type of mutation. Proteins express traits. Because mutations can change proteins, they can cause traits to change. Some mutations in human DNA cause genetic disorders. With more research, scientists hope to fi ...
REMTEC 29sep - site characterisation
... and bacterial distribution in groundwater and matrix. Understanding of all the complex processes and where these takes place. Investigate which microorganisms that are present, as well as their ability to move from permeable layers into the clayey till matrix. ...
... and bacterial distribution in groundwater and matrix. Understanding of all the complex processes and where these takes place. Investigate which microorganisms that are present, as well as their ability to move from permeable layers into the clayey till matrix. ...