Slide 1
... – If chromosome is lost (one copy = monosomic) = individual does not survive – If chromosome is gained (3 copies = trisomic) = individual may survive but only in a few cases and will be mentally impaired • Example: Trisopy 21 (Down syndrome) ...
... – If chromosome is lost (one copy = monosomic) = individual does not survive – If chromosome is gained (3 copies = trisomic) = individual may survive but only in a few cases and will be mentally impaired • Example: Trisopy 21 (Down syndrome) ...
Document
... • Conservative- would leave the original strand intact and copy it. • Dispersive-would produce two DNA molecule with sections of both old and new along each strand. • Semiconservative –would produce DNA molecule with both one old strand and one new strand. ...
... • Conservative- would leave the original strand intact and copy it. • Dispersive-would produce two DNA molecule with sections of both old and new along each strand. • Semiconservative –would produce DNA molecule with both one old strand and one new strand. ...
Prokaryote Genetics
... prokaryote and eukaryote microorganism. Mutation consists of changes to the genetic code of the organism. This can be one of the following changes to a genome: the changing of one base for another; the addition or deletion of one or a few bases; the addition or deletion of large pieces of nucleic ac ...
... prokaryote and eukaryote microorganism. Mutation consists of changes to the genetic code of the organism. This can be one of the following changes to a genome: the changing of one base for another; the addition or deletion of one or a few bases; the addition or deletion of large pieces of nucleic ac ...
Objective Questions
... 11) Which of the following proteins are not coded for by genes carried on plasmids? A) Enzymes necessary for conjugation B) Enzymes that catabolize hydrocarbons C) Bacteriocins D) Enzymes that inactivate antibiotics E) None of the above 12) Transformation is the transfer of DNA from a donor to a rec ...
... 11) Which of the following proteins are not coded for by genes carried on plasmids? A) Enzymes necessary for conjugation B) Enzymes that catabolize hydrocarbons C) Bacteriocins D) Enzymes that inactivate antibiotics E) None of the above 12) Transformation is the transfer of DNA from a donor to a rec ...
DNA and Chromatin
... five-carbon sugars of two nucleotides together. This forms a polynucleotide, a molecule formed by multiple nucleotides linked together. The alternating sugar and phosphate molecules of the nucleotide chain form, what we call, a sugar-phosphate backbone. There are two ends of a polynucleotide: • 5' e ...
... five-carbon sugars of two nucleotides together. This forms a polynucleotide, a molecule formed by multiple nucleotides linked together. The alternating sugar and phosphate molecules of the nucleotide chain form, what we call, a sugar-phosphate backbone. There are two ends of a polynucleotide: • 5' e ...
PCR labwork 2 ENG
... Diabetes caused by mutations in the HNF1A (encoding hepatocyte nuclear factor-1 alpha) and GCK4 (encoding glucokinase 4) genes is one of the most common types of maturity onset diabetes of the young (MODY). HNF1α is a transcription factor that is important for the normal development of beta cells. M ...
... Diabetes caused by mutations in the HNF1A (encoding hepatocyte nuclear factor-1 alpha) and GCK4 (encoding glucokinase 4) genes is one of the most common types of maturity onset diabetes of the young (MODY). HNF1α is a transcription factor that is important for the normal development of beta cells. M ...
Document
... • DNA normally comes in “Genome sized” lengths (usually several million bp in length.) • These are the “elephants” in the race through the agarose and cant enter the gel matrix when they are this big. • Restriction enzymes made possible the cutting of DNA into smaller fragments together with their s ...
... • DNA normally comes in “Genome sized” lengths (usually several million bp in length.) • These are the “elephants” in the race through the agarose and cant enter the gel matrix when they are this big. • Restriction enzymes made possible the cutting of DNA into smaller fragments together with their s ...
DNA, restriction enzymes
... loop on the surface of the protein is altered. d) In this case, the Northern and Southern blots, and the Western blots, with both the polyclonal and the monoclonal antibodies, all give identical results for the wild-type and mutant strains. The only difference in the mutant enzyme is the change of a ...
... loop on the surface of the protein is altered. d) In this case, the Northern and Southern blots, and the Western blots, with both the polyclonal and the monoclonal antibodies, all give identical results for the wild-type and mutant strains. The only difference in the mutant enzyme is the change of a ...
Extraction of DNA from an Onion
... Secondly, the detergent is added to help break down cell walls in the onion cells. Cell walls in living things are made of long polar molecules with a “greasy” end and a charged end. Because detergent is used to break apart greasy particles in your clothes, it will also work to tear apart the “greas ...
... Secondly, the detergent is added to help break down cell walls in the onion cells. Cell walls in living things are made of long polar molecules with a “greasy” end and a charged end. Because detergent is used to break apart greasy particles in your clothes, it will also work to tear apart the “greas ...
5 Conclusion - Duke Computer Science
... DNA motifs. This is important, because it appears that these elements are key to the successful construction of molecules that can undergo sequence dependent mechanical transitions.) (2.2) DNA NANOMOTORS. We also developed DNA molecules that reconfigure for possible use as nano-scale motors. We desi ...
... DNA motifs. This is important, because it appears that these elements are key to the successful construction of molecules that can undergo sequence dependent mechanical transitions.) (2.2) DNA NANOMOTORS. We also developed DNA molecules that reconfigure for possible use as nano-scale motors. We desi ...
DNA Statistics and the Null Hypothesis
... example, imagine we search a collection of bacterial DNA samples and find that bacteria with the sequence "ATCTCTGTTCCTATCATATATATACCCCG" are resistant to a particular antibiotic, while ones without that sequence are susceptible. Given that we discovered this feature using a finite set of genomes ...
... example, imagine we search a collection of bacterial DNA samples and find that bacteria with the sequence "ATCTCTGTTCCTATCATATATATACCCCG" are resistant to a particular antibiotic, while ones without that sequence are susceptible. Given that we discovered this feature using a finite set of genomes ...
Ch. 12 Quiz! Get Out A Piece of Paper!
... a) replication makes two new strands that are each 50% original DNA strand b) replication makes two new strands that are each 100% new c) replication makes one stand that is 100% and one strand that is 100% original DNA strand d) Replication makes new strands that are a random amount of original and ...
... a) replication makes two new strands that are each 50% original DNA strand b) replication makes two new strands that are each 100% new c) replication makes one stand that is 100% and one strand that is 100% original DNA strand d) Replication makes new strands that are a random amount of original and ...
The Body in Motion
... bacteria and the bacteria allowed to grow • This will produce many genetically identical copies of the piece of DNA. This is called cloning • A clone is a genetically identical individual or cell ...
... bacteria and the bacteria allowed to grow • This will produce many genetically identical copies of the piece of DNA. This is called cloning • A clone is a genetically identical individual or cell ...
Answers questions chapter 12
... overall steps. First, specialized proteins called recombinases recognize specific recombination sites within the DNA; second, the recombinases bring the sites together to form a synaptic complex; and, third, the recombinases catalyze the cleavage and rejoining of the DNA molecules. The processes dif ...
... overall steps. First, specialized proteins called recombinases recognize specific recombination sites within the DNA; second, the recombinases bring the sites together to form a synaptic complex; and, third, the recombinases catalyze the cleavage and rejoining of the DNA molecules. The processes dif ...
Gene Technology
... • Modified nucleotides called dideoxyribonucleotides (ddNTP) attach to synthesized DNA strands of different lengths • Each type of ddNTP is tagged with a distinct fluorescent label that identifies the nucleotide at the end of each DNA fragment ...
... • Modified nucleotides called dideoxyribonucleotides (ddNTP) attach to synthesized DNA strands of different lengths • Each type of ddNTP is tagged with a distinct fluorescent label that identifies the nucleotide at the end of each DNA fragment ...
MB207Jan2010
... 2. Excision Repair, in which the damaged base or bases are removed and then replaced with the correct ones in a localized burst of DNA synthesis. There are three modes of excision repair, each of which employs specialized sets of enzymes. ...
... 2. Excision Repair, in which the damaged base or bases are removed and then replaced with the correct ones in a localized burst of DNA synthesis. There are three modes of excision repair, each of which employs specialized sets of enzymes. ...
Chapter 13 Genetic Engineering, TE
... will, in nature, insert a tumor-producing plasmid into plant cells. b. Sometimes plant cells in culture will take up DNA on their own when their cell walls are removed. c. It is impossible to inject DNA directly into plant cells. d. Plant cells that are transformed cannot develop into adult ...
... will, in nature, insert a tumor-producing plasmid into plant cells. b. Sometimes plant cells in culture will take up DNA on their own when their cell walls are removed. c. It is impossible to inject DNA directly into plant cells. d. Plant cells that are transformed cannot develop into adult ...
Day 1 Handout
... The term Epigenetics has had a variety of meanings to scientists, until relatively recently when it was agreed that the term be defined as a "stably heritable phenotype resulting from changes in a chromosome without alterations in the DNA sequence". In other words Epigenetics is the study of cellula ...
... The term Epigenetics has had a variety of meanings to scientists, until relatively recently when it was agreed that the term be defined as a "stably heritable phenotype resulting from changes in a chromosome without alterations in the DNA sequence". In other words Epigenetics is the study of cellula ...
没有幻灯片标题
... 14.8 Specialized recombination involves breakage and reunion at specific sites 14.9 Repair systems correct damage to DNA 14.10 Excision repair systems in E. coli 14.11 Controlling the direction of mismatch repair 14.12 Retrieval systems in E. coli ...
... 14.8 Specialized recombination involves breakage and reunion at specific sites 14.9 Repair systems correct damage to DNA 14.10 Excision repair systems in E. coli 14.11 Controlling the direction of mismatch repair 14.12 Retrieval systems in E. coli ...
DNA repair
DNA repair is a collection of processes by which a cell identifies and corrects damage to the DNA molecules that encode its genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many as 1 million individual molecular lesions per cell per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions induce potentially harmful mutations in the cell's genome, which affect the survival of its daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. When normal repair processes fail, and when cellular apoptosis does not occur, irreparable DNA damage may occur, including double-strand breaks and DNA crosslinkages (interstrand crosslinks or ICLs).The rate of DNA repair is dependent on many factors, including the cell type, the age of the cell, and the extracellular environment. A cell that has accumulated a large amount of DNA damage, or one that no longer effectively repairs damage incurred to its DNA, can enter one of three possible states: an irreversible state of dormancy, known as senescence cell suicide, also known as apoptosis or programmed cell death unregulated cell division, which can lead to the formation of a tumor that is cancerousThe DNA repair ability of a cell is vital to the integrity of its genome and thus to the normal functionality of that organism. Many genes that were initially shown to influence life span have turned out to be involved in DNA damage repair and protection.