• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Slide 1
Slide 1

... In DNA replication, DNA polymerase catalyzes the reaction in which a. the double helix unwinds. b. the sugar-phosphate bonds of each strand are broken. c. a phosphate group is added to the 3’-carbon or 5’carbon of ribose. d. a nucleotide with a base complementary to the base on the template strand ...
BIOLOGY-DNA and Protein Synthesis PPT
BIOLOGY-DNA and Protein Synthesis PPT

... 3. What is Chargoff’s Rule of Base Pairing 4. Which 2 base pairs are PYRIMIDINES/PURINES? 5. What 3 parts make up a nucleotide of DNA? Replication of DNA: 1. Why does DNA Replicate? (what’s the point?) 2. Name the main Enzyme involved & what it does. 3. What enzyme unzips the DNA strand? Part 2: Pro ...
DNA Structure and Function - Biology at Clermont College
DNA Structure and Function - Biology at Clermont College

... 2. Compare the structure of DNA and RNA and its functions. 3. Describe the process of DNA replication. 4. Describe the locations, reactants, and products of transcription. 5. Describe the locations, reactants, and products of translation. 6. Describe major types of mutations and their possible conse ...
Biology-Chapter8 (Biology
Biology-Chapter8 (Biology

... A. There would be no difference between the two sets of codons. B. The codons would be complementary resulting in TTG GTA GCC. C. The codons would be the same, but T would change to U, resulting in AAC CAU CGG. D. The codons would be complementary and T would be changed to U, resulting in UUG GUA GC ...
DNA, Genes and Chromosomes
DNA, Genes and Chromosomes

... a __________ is made up of many of these DNA __________ is the process in which a identical copy of DNA is formed for a new cell (mitosis) Chromosomes are found in the _________ of eukaryotic organisms and the __________ of prokaryotic organisms The length of human DNA is more than 1.5 ___ One stran ...
Ch. 10: Nucleic Acids and Protein Synthesis
Ch. 10: Nucleic Acids and Protein Synthesis

... Let’s think of transcription as an analogy. Think of DNA as a reference book in a library. These books can not be taken out because they are very valuable and may risk getting damaged if they leave the confines of the library. If DNA were to leave the nucleus and enter the cytosol, it would enter an ...
DNA, RNA, and Proteins - Tri-City
DNA, RNA, and Proteins - Tri-City

... •  DNA  is  considered  to  be  a  relatively  stable   molecule.    What  gives  it  this  stability,  even   though  the  hydrogen  bonds  between  the   nitrogen  bases  are  easily  broken?   •  Hint:  Hydrogen  bonds  hold  the   c ...
Slide 1
Slide 1

... determine the traits in organisms so therefore, genes determine the specific traits of an organism. What is The Genetic Code? It is three adjacent nucleotides (“letters”) in mRNA that specify an amino acid in a polypeptide, (_________) molecule. ...
Ch. 10: Nucleic Acids and Protein Synthesis
Ch. 10: Nucleic Acids and Protein Synthesis

... Let’s think of transcription as an analogy. Think of DNA as a reference book in a library. These books can not be taken out because they are very valuable and may risk getting damaged if they leave the confines of the library. If DNA were to leave the nucleus and enter the cytosol, it would enter an ...
using your hand, show me thymine using your
using your hand, show me thymine using your

... Below is one of the molecules that makes up DNA. What functional groups do you see in the molecule: ...
K`NEX Activity
K`NEX Activity

... Activity 2: Replication of a DNA Molecule You will now replicate your DNA molecule by making a new, complementary strand to your original strand according to the semiconservative model. 1. Use pp. 10-13 in the glossy manual. 2. Build the appropriate nucleotides that you will need to replicate your D ...
What is DNA? - mrgscience.com
What is DNA? - mrgscience.com

... worked out the structure of DNA in 1953, after long months of research. Watson, Crick and Maurice Wilkins shared the 1962 Nobel Prize for this important discovery. DNA is made up of molecules of the sugar deoxyribose, phosphate groups, and nitrogen bases. The basic unit of DNA, the nucleotide, is ma ...
How to play
How to play

... DNA is the instruction manual for how to build life. The DNA molecule resides inside cells and comes in 2 strands twisted together to resemble a spiral staircase scientists call a double helix. The staircase's steps are built with combinations of 4 base elements. These are A, T, C, G (Adenine, Thymi ...
Ch. 13 Genetic Engineering
Ch. 13 Genetic Engineering

... Burbank was the greatest selective breeder of all time. He developed the disease-resistant potato and more than 800 varieties of plants. ...
TOPIC 4: GENETICS - Doctor Golub`s Living Environment
TOPIC 4: GENETICS - Doctor Golub`s Living Environment

... The flounder is a species of fish that can live in very cold water. The fish produces an “antifreeze” protein that prevents ice crystals from forming in its blood. The DNA for this protein has been identified. An enzyme is used to cut and remove this section of flounder DNA that is then spliced into ...
DNA Keychains - Kids in Need Foundation
DNA Keychains - Kids in Need Foundation

... Culminating Activity ...
Chapter 20~ DNA Technology & Genomics
Chapter 20~ DNA Technology & Genomics

... CGACTAGCATGATCGATCAGCTACATGCTAGCACACYC GTACATCGATCCTGACATCGACCTGCTCGTACATGCTA ...
aRNA Amplification
aRNA Amplification

... 1) The equal volume of phenol:chloroform: isoamyl alcohol (25:24:1) was added to the cDNA mixture. 2) The entire mixture was transferred to the Phase Lock Gel (Bio-Rad, …) and separated in a 5415R centrifuge. 3) To the aqueous phase 1 µl of linear acryl amide is added, then, 0.5 volume of 7.5 M ammo ...
chapter11
chapter11

... A small amount of telomeric DNA fails to replicate each time the DNA replicates. No essential genetic information is lost. Telomeric DNA can be lengthened by a DNA replicating enzyme called telomerase. Cells that produce telomerase continue to divide indefinitely beyond the point at which cell divis ...
Review Questions
Review Questions

... The same goes for guanine and cytosine. Adenine and guanine are both purines (nitrogen bases composed of double rings). Cytosine and thymine each are single-ring bases so they are pyrimidines. You may notice that in each complementary pair of bases there is one purine and one pyrimidine. This arrang ...
The Central Dogma - Green Local Schools
The Central Dogma - Green Local Schools

... Messenger RNA (mRNA):  Carries genetic info from the nucleus to the cytoplasm Transfer RNA (tRNA):  Carries specific amino acids to the ribosome to build the protein Ribosomal RNA (rRNA):  Major component of the ribosome organelle  Site of protein synthesis  Most abundant type of RNA ...
3.13 Review
3.13 Review

... If a disease is sex-linked inheritance, then it is attached to the X chromosome. Men are much more likely to be affected than ...
CH 14 EXTRA CREDIT Study Guide
CH 14 EXTRA CREDIT Study Guide

... 9. List all the genotypes and phenotypes of blood, not counting Rh. 10. In Huntington’s disease, the person usually is Hh but sometimes HH. What % of children will inherit Huntington’s if one parent has it? 11. What causes sickle-cell? 12. What causes cystic fibrosis? How is this different from a no ...
DNA Ligase
DNA Ligase

... The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. The general differences between the bacterial chromosome and eukaryotic chromosomes. How DNA is packaged into a chromosome. ...
Biology UNIT 2 Heredity: Inheritance and Variation of traits Big Ideas
Biology UNIT 2 Heredity: Inheritance and Variation of traits Big Ideas

...  Each chromosome consists of a single very long DNA molecule, and each gene on the chromosome is a particular segment of that DNA. The instructions for forming species’ characteristics are carried in DNA. All cells in an organism have the same genetic content, but the genes used (expressed) by the ...
< 1 ... 237 238 239 240 241 242 243 244 245 ... 417 >

United Kingdom National DNA Database

The United Kingdom National DNA Database (NDNAD; officially the UK National Criminal Intelligence DNA Database) is a national DNA Database that was set up in 1995. As of the end of 2005, it carried the profiles of around 3.1 million people. In March 2012 the database contained an estimated 5,950,612 individuals. The database, which grows by 30,000 samples each month, is populated by samples recovered from crime scenes and taken from police suspects and, in England and Wales, anyone arrested and detained at a police station.Only patterns of short tandem repeats are stored in the NDNAD – not a person's full genomic sequence. Currently the ten loci of the SGM+ system are analysed, resulting in a string of 20 numbers, being two allele repeats from each of the ten loci. Amelogenin is used for a rapid test of a donor's sex.However, individuals' skin or blood samples are also kept permanently linked to the database and can contain complete genetic information. Because DNA is inherited, the database can also be used to indirectly identify many others in the population related to a database subject. Stored samples can also degrade and become useless, particularly those taken with dry brushes and swabs.The UK NDNAD is run by the Home Office, after transferring from the custodianship of the National Policing Improvement Agency (NPIA) on 1 October 2012. A major expansion to include all known active offenders was funded between April 2000 and March 2005 at a cost of over £300 million.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report