• Study Resource
  • Explore
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Recombinant DNA and Genetic Engineering
Recombinant DNA and Genetic Engineering

... DNA is placed at one end of a gel A current is applied to the gel DNA molecules are negatively charged and move toward positive end of gel Smaller molecules move faster than larger ones ...
Topic 6 – Making Recombinant DNA Recombinant DNA – fragment
Topic 6 – Making Recombinant DNA Recombinant DNA – fragment

... § High in vitamin‐A because genes from other plants that make vitamin A        were inserted in the rice DNA ...
DNA Reccombination
DNA Reccombination

Nessun titolo diapositiva
Nessun titolo diapositiva

... Heterochromatin is nucleated at a specific sequence and the inactive structure propagates along the chromatin fiber. Genes within regions of heterochromatin are inactivated. Because the length of the inactive region varies from cell to cell, inactivation of genes in this vicinity causes position ...
Unit 5 Review
Unit 5 Review

... 26. What are two types of RNA? (use both the abbreviations and names) ...
Sir Alec Jeffreys minisatellites
Sir Alec Jeffreys minisatellites

... Examples - DNA fingerprints. Tandemly repeated but often in dispersed clusters. Also called VNTR’s (variable number tandem repeats). Human λ33.1 minisatellite (62 bp) AAGGGTGGGCAGGAAGTGGAGTGTGTGCCTG CTTCCCTTCCCTGTCTTGTCCTGGAAACTCA Human λ33.5 minisatellite (17 bp) YGGGCAGGAGGGGGAGG ...
Bi 430 / 530 Theory of Recombinant DNA Techniques Syllabus
Bi 430 / 530 Theory of Recombinant DNA Techniques Syllabus

... How are recombinant DNA risks defined and managed? How is useful DNA and RNA isolated? How are DNA, RNA and proteins detected and measured? How can specific DNA, RNA and protein molecules be identified in a complex mixture? How can DNA be modified in the test tube? Why is PCR such a versatile tool f ...
Recombinant DNA and Genetic Engineering
Recombinant DNA and Genetic Engineering

... DNA is placed at one end of a gel A current is applied to the gel DNA molecules are negatively charged and move toward positive end of gel Smaller molecules move faster than larger ones ...
Slide 1
Slide 1

... Different atomic forms of the same element, which have the same proton number, but a different neutron number. ...
blah
blah

... values in phosphate buffer, Na2HPO4/NaH2PO4 (0.02 M/0.02 M), CAu = 1.6×10-4 M, I = 0.08 M, T = 25 oC. The slight blue-shift from pH 10 to pH 7 indicates some NP destabilization that turns, for pH < 6.5, in a large red-shift indicating nanoparticles aggregation. ...
Genetics - CBSD.org
Genetics - CBSD.org

... • Allele alternate form of a gene • Complete dominance one allele completely hides the other • Incomplete dominance both alleles influence the phenotype (blending) • Codominance Neither allele completely hides the other (both are seen) (blood typing & spots) • Trait an expressed gene • Dominant ...
PDF file
PDF file

... Fall 2001 - Dr. Roger Miesfeld ...
DNA Extraction from Bacteria
DNA Extraction from Bacteria

... Step 3. Remove the tube from the hot water bath. Add cold alcohol to the test tube (about 2/3 full) to create an alcohol layer on top of the bacterial solution. Do this by slowly pouring the alcohol down the inside of the test tube with a Pasteur pipette or medicine dropper. DO NOT MIX! DNA is solu ...
DNA and RNA
DNA and RNA

DNA and RNA ppt
DNA and RNA ppt

...  Cytosine can bond only with Guanine  C-G or G-C (3 H bonds)  This is called the BASE PAIR RULE ...
Polymerase Chain Reaction
Polymerase Chain Reaction

... PCR will allow a short stretch of DNA (usually fewer than 3000 base pairs) to be amplified to about a million fold This amplified sample then allows for size determination and nucleotide sequencing Introduced in 1985 by Kary Mullis Millions of copies of a segment of DNA can be made within a few hour ...
A document that can help for writing your lab report: www
A document that can help for writing your lab report: www

...  Transformation refers to a genetic change brought about by taking up and expressing DNA.  Competence refers to the state of being able to take up DNA. Two different forms of competence should be distinguished, natural and artificial. o Natural competence : Transformation occurs only in bacterial ...
Zoo/Bot 3333
Zoo/Bot 3333

... of seven BAC clones, designated A-G. A “+” in the table means that PCR primers specific to the STS are able to amplify the sequence from the clone, a “-“ means that the sequence can not be amplified from the clone. STS marker BAC Clone A B C D E F G ...
Section 12-1
Section 12-1

... approximately equal and C and T are approximately equal b. Therefore, in DNA, A pairs with T; C pairs with G C. Rosalind Franklin (1952) used X-ray diffraction to study the structure of DNA D. Watson and Crick (1953) made a model of DNA (fig 12-7) a. Showed that DNA was a double stranded molecule, c ...
DNA PROFILING
DNA PROFILING

FREE Sample Here
FREE Sample Here

... C) Phosphodiester groups D) Nitrogen bases ...
Introduction to molecular biology
Introduction to molecular biology

... responsible of the color of the eyes in fruit flies would be located on the X chromosome. He therefore propose that the genetic information may be supported by the chromosomes. ...
Chemistry Review
Chemistry Review

... - DNA found in Chromosomes Chromosomes = DNA that is supercoiled - Humans have 23 pairs ...
Directed Reading A
Directed Reading A

... ______ 2. What is the name of the material that determines inherited characteristics? a. deoxyribonucleic acid c. RNA b. ribosome d. amino acid ...
PUTTING DNA to WORK: High School Virtual Field Trip
PUTTING DNA to WORK: High School Virtual Field Trip

< 1 ... 163 164 165 166 167 168 169 170 171 ... 222 >

Comparative genomic hybridization



Comparative genomic hybridization is a molecular cytogenetic method for analysing copy number variations (CNVs) relative to ploidy level in the DNA of a test sample compared to a reference sample, without the need for culturing cells. The aim of this technique is to quickly and efficiently compare two genomic DNA samples arising from two sources, which are most often closely related, because it is suspected that they contain differences in terms of either gains or losses of either whole chromosomes or subchromosomal regions (a portion of a whole chromosome). This technique was originally developed for the evaluation of the differences between the chromosomal complements of solid tumor and normal tissue, and has an improved resoIution of 5-10 megabases compared to the more traditional cytogenetic analysis techniques of giemsa banding and fluorescence in situ hybridization (FISH) which are limited by the resolution of the microscope utilized.This is achieved through the use of competitive fluorescence in situ hybridization. In short, this involves the isolation of DNA from the two sources to be compared, most commonly a test and reference source, independent labelling of each DNA sample with a different fluorophores (fluorescent molecules) of different colours (usually red and green), denaturation of the DNA so that it is single stranded, and the hybridization of the two resultant samples in a 1:1 ratio to a normal metaphase spread of chromosomes, to which the labelled DNA samples will bind at their locus of origin. Using a fluorescence microscope and computer software, the differentially coloured fluorescent signals are then compared along the length of each chromosome for identification of chromosomal differences between the two sources. A higher intensity of the test sample colour in a specific region of a chromosome indicates the gain of material of that region in the corresponding source sample, while a higher intensity of the reference sample colour indicates the loss of material in the test sample in that specific region. A neutral colour (yellow when the fluorophore labels are red and green) indicates no difference between the two samples in that location.CGH is only able to detect unbalanced chromosomal abnormalities. This is because balanced chromosomal abnormalities such as reciprocal translocations, inversions or ring chromosomes do not affect copy number, which is what is detected by CGH technologies. CGH does, however, allow for the exploration of all 46 human chromosomes in single test and the discovery of deletions and duplications, even on the microscopic scale which may lead to the identification of candidate genes to be further explored by other cytological techniques.Through the use of DNA microarrays in conjunction with CGH techniques, the more specific form of array CGH (aCGH) has been developed, allowing for a locus-by-locus measure of CNV with increased resolution as low as 100 kilobases. This improved technique allows for the aetiology of known and unknown conditions to be discovered.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report