• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Are dental diseases examples of ecological
Are dental diseases examples of ecological

... of the resident microflora of each site remains relatively stable over time. This stability (which has been termed microbial homeostasis) stems not from any biological indifference between the host and the microflora, but results from a dynamic balance arising out of numerous, coupled inter-microbia ...
GENESIS: genome evolution scenarios
GENESIS: genome evolution scenarios

... that transform one genome into another genome (or equivalently, to sort a signed permutation into the identity permutation). These algorithms can be categorized according to the genome rearrangement operations they can deal with, and as to whether they take multiple chromosomes into account. For uni ...
The bonobo genome compared with the chimpanzee and human
The bonobo genome compared with the chimpanzee and human

... human traits than they are to one another’s. No parsimonious reconstruction of the social structure and behavioural patterns of the common ancestor of humans, chimpanzees and bonobos is therefore possible. That ancestor may in fact have possessed a mosaic of features, including those now seen in bon ...
pdf
pdf

... and perennial OMZ. High primary productivity in the AS occurs during both the NE and SW monsoon seasons [Barber et al., 2001]. The sinking and decomposition of the locally produced and laterally advected organic carbon from the highly productive upwelling regions culminates in excessive consumption ...
Nitrogen fixation:
Nitrogen fixation:

... Nitrogen-fixing organisms are very diverse prokaryotes that have been identified scattered in the phylogenetic trees reconstructed from the comparative analysis of ribosomal RNA gene sequences (Martinez-Romero, 1985, Young, 1992). Although 16S rRNA gene-based phytogenies have been criticized and the ...
Genes and MS
Genes and MS

... Remember - having a family connection to MS increases the chances, but it doesn't mean someone will get MS. For example, risks might vary in different places, at different times, and according to what happens in someone's life. There are many factors affecting a person's risk for any health conditi ...
Construction of the optimal single gene ranking
Construction of the optimal single gene ranking

... to approximately 20 genes per GO group. Based on this, we report subsequent results using only those GO groups containing 20 or more genes. We also excluded GO groups of larger than 1000 genes in order to capture reasonably specific gene properties; however, this criterion had no noticeable effect o ...
The Macaque Genome: Lessons from Comparative
The Macaque Genome: Lessons from Comparative

... characteristics are derived from a given organism's DNA, or genome. That means that the finer details about the relatedness among organisms and the traits that make them similar or different, can often be inferred by examining them at the DNA level, i.e., by looking at their DNA sequences. Comparing ...
Consistent risk group-associated differences in human
Consistent risk group-associated differences in human

... used for vpr were 5'VPR-1 (5' GATCTCTACAITACTTGGCACT 3') (I = inosine) and YVPR-4 (5' CTTCTTCCTGCCATAGGAGATGCC Y), final MgCI~ concentration 2-4 m~, for the first PCR, and 5'VPR-2-Sp6 (5" ATTTAGGTGACACTATAGCACCTTTGCCTAGTGTTAIGAA 3') and YVPR-3-T7 (51 TAATACGACTCACTATAGGGAAAGCAACACTTTTTACAATAGCA 3'), ...
E NEWS -
E NEWS -

... The realization that Archaea could be a source of novel pharmaceuticals emerges from a study of wideQuestions? Feedback? spread horizontal gene transfer between different species conducted by a team of scientists from Vanderbilt University and Portland State University in Oregon. The researchers wer ...
Rhom-2 Expression Does Not Always Correlate With
Rhom-2 Expression Does Not Always Correlate With

... ern blot was prepared using BamHI-digested DNA. Hybridization of the Southern blot with a TCR-p probez4is shown in Fig 1A. As controls, DNAs from the KB and HPB cell lines were included. A germline band of 23 kb and two smaller rearranged bands for the TCR-p gene were observed for the Kl3 and HPB ce ...
- American Diabetes Association
- American Diabetes Association

... were regarded as final, validated findings (Supplementary Tables 1 and 3). Additionally, we required that the genes were determined as present in .50% of all individuals (at least in one sample per individual) using a two-component Gaussian mixture model for the Affymetrix data and detection P values ...
Genome Jigsaw: Implications of 16S Ribosomal RNA Gene
Genome Jigsaw: Implications of 16S Ribosomal RNA Gene

... interspersed within conserved regions of the gene. While conserved regions remain mostly constant over time, variable regions can be used for taxonomic identification purposes. Current methodologies for characterizing microbial communities, such as those used to study the human microbiome, involve s ...
Fc RIIIB Gene Duplication: Evidence for Presence and Expression of
Fc RIIIB Gene Duplication: Evidence for Presence and Expression of

... the Southern blot, obtained with a phospho-imager. For these two NA(11,21)SH(1) individuals, the ratio between the FcgRIIIB- and FcgRIIIA-specific band is 1.16 and 1.14, respectively. This is approximately three times higher than the ratio obtained for three individuals with only one FcgRIIIB gene ( ...
Rapid detection of multidrug-resistant tuberculosis
Rapid detection of multidrug-resistant tuberculosis

... This study was conducted following requests from clinicians for a rapid assessment of the possibility of transmission from a known MDR-TB index case. Based on strain-typing and analysis of resistance-associated mutations, the present results strongly suggested that patient No. 2 had, in fact, been i ...
DNA Polymorphism Studies of β-Lactoglobulin Gene in Saudi Goats
DNA Polymorphism Studies of β-Lactoglobulin Gene in Saudi Goats

... As it is obvious from the current study, phylogenetic analysis of β-LG gene in Saudi goat breeds represent initial and important step for acquiring genetic information about these local breed and in the same time could contribute in conservation of these genetic resource. On the other hand, this ste ...
Distinct and stage specific nuclear factors regulate the expression of
Distinct and stage specific nuclear factors regulate the expression of

... homology and are different only at three amino acids positions. The 5' upstream regions however, are quite varied. The gene specific primers (GSP1 and GSP2) were the same for these falcipains, while GSP3 was designed immediately upstream to the translational start site and was essential for determin ...
Towards identifying the full set of genes involved in post
Towards identifying the full set of genes involved in post

... to genes whose expression had increased or decreased according to two criteria to be identified. The criteria applied to the downregulated genes were stricter than those applied to the up, as otherwise an unmanageable number of clones would have been selected. However, it is possible that the criter ...
embr201439791-sup-0014
embr201439791-sup-0014

... Table S3. Mapped sequences were run through featureCount and differential expression analysis was performed on the raw counts using the R packages DESeq2 (gene level) and DEXSeq (exon level). Since DESeq2 and DEXSeq requires replicates, the salmIR and salm-FRT samples were used as biological replica ...
Deletions of ultraconserved elements have no obvious phenotype
Deletions of ultraconserved elements have no obvious phenotype

... Evolutionary conservation has become a powerful means for identifying functionally important genomic sequences [1,2]. Ultraconserved elements have been defined as a group of extremely conserved sequences that show 100% identity over 200 bp or greater between the human, mouse, and rat genomes [3]. Thi ...
Breeding desired quality wheat by reverse genetics
Breeding desired quality wheat by reverse genetics

... 16 mutants were identified in 7A3 and 7D3 fragments from 369 0.7% EMS treated plants and 14 mutants identified in 308 0.6% EMS treated plants, mutation frequency being about one in 33 kb. These mutation frequencies are quite high compared to Arabidopsis TILLING (1 in 170 kb, Colbert et al. 2001; Gre ...
Answers #2
Answers #2

... Transform E. coli, plate on amp, screen colonies for plasmids that are cut by BamHI plus XbaI into two fragments of expected size. For correct-looking clones sequence, especially across the critical junction at the N-terminus of the coding region for the fusion protein. No student answer addressed ...
Two groups of human herpesvirus 6 identified by sequence
Two groups of human herpesvirus 6 identified by sequence

... studies of this virus DNA have shown that the organization of conserved genes and their encoded amino acid sequences are more related to those of human cytomegalovirus (HCMV) than those of the other human herpesviruses (Lawrence et al., 1990; Neipel et aL, 1991). However, these viruses are distant r ...
(FA-SAT) in a Cat Fibrosarcoma Might Be Related to Chromosomal
(FA-SAT) in a Cat Fibrosarcoma Might Be Related to Chromosomal

... All these suppositions, at this stage of the work, are speculative. To attest them, the verification of additional kinetochore formation at these regions is needed. Also important would be the analysis of the marker chromosome’s clonal evolution, besides the concomitant study of the amplified repeti ...
Determination of the entire sequence of turtle CR1: the first open
Determination of the entire sequence of turtle CR1: the first open

... were extensively truncated at their 5’ ends, no ORF with significant similarity to ORFs that encode known polypeptides was identified (HachC and Deeley 1988). CR1 elements were subsequently detected in representatives of nine orders that encompass a wide spectrum of species in the class Aves (Chen e ...
< 1 ... 92 93 94 95 96 97 98 99 100 ... 359 >

Metagenomics



Metagenomics is the study of genetic material recovered directly from environmental samples. The broad field may also be referred to as environmental genomics, ecogenomics or community genomics. While traditional microbiology and microbial genome sequencing and genomics rely upon cultivated clonal cultures, early environmental gene sequencing cloned specific genes (often the 16S rRNA gene) to produce a profile of diversity in a natural sample. Such work revealed that the vast majority of microbial biodiversity had been missed by cultivation-based methods. Recent studies use either ""shotgun"" or PCR directed sequencing to get largely unbiased samples of all genes from all the members of the sampled communities. Because of its ability to reveal the previously hidden diversity of microscopic life, metagenomics offers a powerful lens for viewing the microbial world that has the potential to revolutionize understanding of the entire living world. As the price of DNA sequencing continues to fall, metagenomics now allows microbial ecology to be investigated at a much greater scale and detail than before.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report