Functional and structural roles of parasite-specific inserts in the bifunctional S-adenosylmethionine decarboxylase/ornithine
... detection reaction is based on the generation of an acridium ester by the enzymatic action of HRP on Lumigen PS-3 acridan substrates. The esters react with peroxide under slightly alkaline conditions to produce a high-intensity chemiluminescence with emission wavelength of 430 nm. The washed membran ...
... detection reaction is based on the generation of an acridium ester by the enzymatic action of HRP on Lumigen PS-3 acridan substrates. The esters react with peroxide under slightly alkaline conditions to produce a high-intensity chemiluminescence with emission wavelength of 430 nm. The washed membran ...
Fatty acid and phospholipid metabolism in prokaryotes
... auxotrophy on a strain, such as a requirement for unsaturated fatty acids or glycerol phosphate. Such mutants have generally lost the ability to produce a key biosynthetic enzyme (e.g.fabA mutants, which require supplementation with unsaturated fatty acids), or they may be more complex (e.g. plsB mu ...
... auxotrophy on a strain, such as a requirement for unsaturated fatty acids or glycerol phosphate. Such mutants have generally lost the ability to produce a key biosynthetic enzyme (e.g.fabA mutants, which require supplementation with unsaturated fatty acids), or they may be more complex (e.g. plsB mu ...
By-product utilization
... along with wheat, rice and corn. Mostly potatoes are processed into a variety of products such as mashed potatoes, chips, fries and deep frozen and dehydrated products. Waste products from potatoes processing are a big disposal problem. Approximately 35% of the total processed potato crop is discard ...
... along with wheat, rice and corn. Mostly potatoes are processed into a variety of products such as mashed potatoes, chips, fries and deep frozen and dehydrated products. Waste products from potatoes processing are a big disposal problem. Approximately 35% of the total processed potato crop is discard ...
Identification and cDNA cloning of a Xenopus nucleolar
... using the oligonucleotide 5′GGTAAAAGGAAAAGATCTAGTACAGGCAAT3′. This novel BglII restriction site was then used as the site of insertion of two copies of a DNA sequence that encodes the amino acid sequence MEQKLISEEDLN from the human c-myc, which is the epitope recognised by the monoclonal antibody 9E ...
... using the oligonucleotide 5′GGTAAAAGGAAAAGATCTAGTACAGGCAAT3′. This novel BglII restriction site was then used as the site of insertion of two copies of a DNA sequence that encodes the amino acid sequence MEQKLISEEDLN from the human c-myc, which is the epitope recognised by the monoclonal antibody 9E ...
Chapter 1: Biological Introduction: RING domain proteins
... The RING domain is a cysteine-rich sequence motif that can bind two zinc atoms. In the canonical RING motif, also called the C3HC4 motif, one zinc is bound to four cysteines, and the other ion to three cysteines and a histidine. The tetrahedral coordination is atypical and referred to as a “cross-br ...
... The RING domain is a cysteine-rich sequence motif that can bind two zinc atoms. In the canonical RING motif, also called the C3HC4 motif, one zinc is bound to four cysteines, and the other ion to three cysteines and a histidine. The tetrahedral coordination is atypical and referred to as a “cross-br ...
Selected reaction monitoring applied to proteomics
... challenging task due to the complexity and large dynamic range of proteins present in such media. The first application of this type was the quantification of C-reactive protein, a diagnostic biomarker of rheumatoid arthritis, in serum after depletion of three abundant proteins.[16] The measurements ...
... challenging task due to the complexity and large dynamic range of proteins present in such media. The first application of this type was the quantification of C-reactive protein, a diagnostic biomarker of rheumatoid arthritis, in serum after depletion of three abundant proteins.[16] The measurements ...
CHE-120 Test 4
... A) side (R) group. B) alpha carbon. C) carboxyl group. D) hydrogen bonding. E) amino group. 9) The names of many enzymes can be recognized by the suffix ________. A) -ite B) -ine C) -ose D) -ate ...
... A) side (R) group. B) alpha carbon. C) carboxyl group. D) hydrogen bonding. E) amino group. 9) The names of many enzymes can be recognized by the suffix ________. A) -ite B) -ine C) -ose D) -ate ...
Microsoft Word
... affinity for the protein. Comparison of the Kas values for a series of structurally modified cap analogues enabled parsing of G into separate contributions from various stabilizing contacts inside the eIF4E cap-binding pocket [12]. Bearing in mind an approximate character of the approach due to la ...
... affinity for the protein. Comparison of the Kas values for a series of structurally modified cap analogues enabled parsing of G into separate contributions from various stabilizing contacts inside the eIF4E cap-binding pocket [12]. Bearing in mind an approximate character of the approach due to la ...
Article Lateral Gene Transfer and Gene
... latency. Over 76% of MDH activity was liberated when the organellar membranes were disintegrated by addition of 0.1% Triton X-100, which indicates that most organelles remain intact through all steps of isolation. The cellular distribution of MDH was investigated by immunofluorescence microscopy (fi ...
... latency. Over 76% of MDH activity was liberated when the organellar membranes were disintegrated by addition of 0.1% Triton X-100, which indicates that most organelles remain intact through all steps of isolation. The cellular distribution of MDH was investigated by immunofluorescence microscopy (fi ...
ffd4f0aea63ca53
... • Caveolae vesicles use Dynamin to pinch off • Caveolins do not dissociate from formed vesicles, so they are delivered to the target compartments. ...
... • Caveolae vesicles use Dynamin to pinch off • Caveolins do not dissociate from formed vesicles, so they are delivered to the target compartments. ...
Participation of DDDD and KPAR
... enzyme was identified in a metagenomic dataset established from microbial community resides in the LCL environment. The metagenome-derived MerA enzyme (ATII-LCL MerA) has simple and limited alterations in its primary structure relative to that of an ortholog from uncultured soil bacterium. Both enzy ...
... enzyme was identified in a metagenomic dataset established from microbial community resides in the LCL environment. The metagenome-derived MerA enzyme (ATII-LCL MerA) has simple and limited alterations in its primary structure relative to that of an ortholog from uncultured soil bacterium. Both enzy ...
CHAPTER FOUR U n
... that are unique to the “tester” population. cDNA RDA is a modification of the original RDA technique, in which the starting material is derived from mRNA rather than genomic DNA. Accordingly, targets are only genes which are expressed at the time total RNA is isolated (Hubank and Schatz, 1994 and 19 ...
... that are unique to the “tester” population. cDNA RDA is a modification of the original RDA technique, in which the starting material is derived from mRNA rather than genomic DNA. Accordingly, targets are only genes which are expressed at the time total RNA is isolated (Hubank and Schatz, 1994 and 19 ...
The variable and conserved interfaces of modeled olfactory receptor
... of the OR model. We observed that out of 36 hypervariable residues ~whose variability value is more than one standard deviation above the average variability in the TM segments!, in the entire OR protein, 26 are in the three variable helices, most of which ~20 residues! are on the predicted inner su ...
... of the OR model. We observed that out of 36 hypervariable residues ~whose variability value is more than one standard deviation above the average variability in the TM segments!, in the entire OR protein, 26 are in the three variable helices, most of which ~20 residues! are on the predicted inner su ...
Full Text
... volatile anesthetics in the LGICs are the cavities formed within the core of transmembrane four-helix bundles. For many years since the era of Meyer and Overton,1,2 the mechanisms of anesthetic action were thought to be mediated via the lipid bilayer of cells involved in neuronal pathways fundamenta ...
... volatile anesthetics in the LGICs are the cavities formed within the core of transmembrane four-helix bundles. For many years since the era of Meyer and Overton,1,2 the mechanisms of anesthetic action were thought to be mediated via the lipid bilayer of cells involved in neuronal pathways fundamenta ...
biological chemistry. the bank of mcq test questions 2016-2017
... B. Absolute grouped substrate specificity C. Stereochemical specificity D. Relative grouped substrate specificity E. Relative substrate specificity (reaction specificity). 20. One of the important properties of enzymes is their action specificity for urease: A. Absolute substrate specificity B. Abso ...
... B. Absolute grouped substrate specificity C. Stereochemical specificity D. Relative grouped substrate specificity E. Relative substrate specificity (reaction specificity). 20. One of the important properties of enzymes is their action specificity for urease: A. Absolute substrate specificity B. Abso ...
Lecture 5
... Structural hierarchy in proteins • Primary structure (1º structure)-for a protein is the amino acid sequence of its polypeptide chain(s). • Secondary structure (2º structure)-the local spatial arrangement of a polypeptide’s backbone atoms without regard to the conformations of their side chains. • ...
... Structural hierarchy in proteins • Primary structure (1º structure)-for a protein is the amino acid sequence of its polypeptide chain(s). • Secondary structure (2º structure)-the local spatial arrangement of a polypeptide’s backbone atoms without regard to the conformations of their side chains. • ...
SUPPLEMENTARY INFORMATION TABLE OF CONTENTS: 1
... the translation of the extensions. The extensions allow the examination of all translation frames and past stop codons. To tentatively reconstitute chimeric proteins from the analyzed DIRE, frame shifts were removed manually from the DNA sequences using the BER outputs to precisely determine the fr ...
... the translation of the extensions. The extensions allow the examination of all translation frames and past stop codons. To tentatively reconstitute chimeric proteins from the analyzed DIRE, frame shifts were removed manually from the DNA sequences using the BER outputs to precisely determine the fr ...
Human IFNγ ELISA Kit
... A. Prepare human IFNγ standard: IFNγ standard solution is prepared within two hours of use. The kit provides two tubes of IFNγ standard (10 ng per tube). i. Prepare 10,000 pg/ml of human IFNγ stock standard: Add 1 ml sample diluent buffer into one tube containing 10 ng of IFNγ standard. Keep it at r ...
... A. Prepare human IFNγ standard: IFNγ standard solution is prepared within two hours of use. The kit provides two tubes of IFNγ standard (10 ng per tube). i. Prepare 10,000 pg/ml of human IFNγ stock standard: Add 1 ml sample diluent buffer into one tube containing 10 ng of IFNγ standard. Keep it at r ...
Journal of Bacteriology
... acids of groups 1a and 2a such as Na⫹ and Ca2⫹, which form ionic bonds with hard Lewis bases, for example the oxygen of protein carboxylates. The metalloids As(III) and Sb(III) of group 5a have properties similar to those of soft Lewis acids. For the purposes of this review, alkali and alkaline eart ...
... acids of groups 1a and 2a such as Na⫹ and Ca2⫹, which form ionic bonds with hard Lewis bases, for example the oxygen of protein carboxylates. The metalloids As(III) and Sb(III) of group 5a have properties similar to those of soft Lewis acids. For the purposes of this review, alkali and alkaline eart ...
The Effect of Actidione and other Antifungal Agents on Nucleic Acid
... a hot perchloric acid extract as a measure of the total nucleic acid. The nucleic acid was removed by two 20 min. extractions at 70" with 2-0 ml. 0-5 N-perchloric acid (Ogur & Rosen, 1950). The deoxyribonucleic acid (DNA), content of the perchloric acid extract was measured by the diphenylamine meth ...
... a hot perchloric acid extract as a measure of the total nucleic acid. The nucleic acid was removed by two 20 min. extractions at 70" with 2-0 ml. 0-5 N-perchloric acid (Ogur & Rosen, 1950). The deoxyribonucleic acid (DNA), content of the perchloric acid extract was measured by the diphenylamine meth ...
Chapter 5- Enzymes
... A farm worker accidentally was splashed with a powerful insecticide. A few minutes later, he went into convulsion, stopped breathing, and died. The insecticide was a competitive inhibitor of an enzyme important in the function of the nervous system. 6. Describe the relationship between the structure ...
... A farm worker accidentally was splashed with a powerful insecticide. A few minutes later, he went into convulsion, stopped breathing, and died. The insecticide was a competitive inhibitor of an enzyme important in the function of the nervous system. 6. Describe the relationship between the structure ...
Polar amino acids with negative charge
... • Amino acids are critical to life, and have many functions in metabolism. One particularly important function is to serve as the building blocks of proteins, which are just linear chains of amino acids, or more precisely, amino acid residues. • Every protein is chemically defined by the order of a ...
... • Amino acids are critical to life, and have many functions in metabolism. One particularly important function is to serve as the building blocks of proteins, which are just linear chains of amino acids, or more precisely, amino acid residues. • Every protein is chemically defined by the order of a ...
The world of proteases Diversity and function
... PROTEASE SUBSTRATES Protein is a highly diverse substrate 20 different amino acids to ...
... PROTEASE SUBSTRATES Protein is a highly diverse substrate 20 different amino acids to ...
N-Terminal Intramolecularly Conserved Histidines of Three Domains
... respectively (Figure 2B-D). The amino acid sequences for the N-terminal regions of the three domains are compared in Figure 3; the first amino acid of each of the truncated peptides is marked with an asterisk at its upper left corner. Histidines Are Responsible for Loss of ActiVity at Alkaline pH. F ...
... respectively (Figure 2B-D). The amino acid sequences for the N-terminal regions of the three domains are compared in Figure 3; the first amino acid of each of the truncated peptides is marked with an asterisk at its upper left corner. Histidines Are Responsible for Loss of ActiVity at Alkaline pH. F ...
Western blot
The western blot (sometimes called the protein immunoblot) is a widely used analytical technique used to detect specific proteins in a sample of tissue homogenate or extract. It uses gel electrophoresis to separate native proteins by 3-D structure or denatured proteins by the length of the polypeptide. The proteins are then transferred to a membrane (typically nitrocellulose or PVDF), where they are stained with antibodies specific to the target protein. The gel electrophoresis step is included in western blot analysis to resolve the issue of the cross-reactivity of antibodies.There are many reagent companies that specialize in providing antibodies (both monoclonal and polyclonal antibodies) against tens of thousands of different proteins. Commercial antibodies can be expensive, although the unbound antibody can be reused between experiments. This method is used in the fields of molecular biology, immunogenetics and other molecular biology disciplines. A number of search engines, such as CiteAb, Antibodypedia, and SeekProducts, are available that can help researchers find suitable antibodies for use in western blotting.Other related techniques include dot blot analysis, immunohistochemistry and immunocytochemistry where antibodies are used to detect proteins in tissues and cells by immunostaining, and enzyme-linked immunosorbent assay (ELISA).The method originated in the laboratory of Harry Towbin at the Friedrich Miescher Institute. The name western blot was given to the technique by W. Neal Burnette and is a play on the name Southern blot, a technique for DNA detection developed earlier by Edwin Southern. Detection of RNA is termed northern blot and was developed by George Stark at Stanford.