Taícia P. Fill1, Edson Rodrigues Filho1
tacaatccgttat g c cactcatgattagagtcgcgg gatt
Taboo cards
Tables of composition and nutritionol value of - e
Table xx - Hindawi
Table st04, DOC
Table S7. Kyoto Encyclopedia of Genes and Genomes (KEGG
Table S7
table S7
Table S6: Domains present in the primary network generated from
Table S6. List of essential reactions of tomato leaves for
Table S5: Genes with signs of intragenic recombination
Table S5. p300/CBP dependent genes downregulated in Crx
Table S5. DAVID functional classification of ixazomib genes.
Table S5.
Table S5 - G3: Genes | Genomes | Genetics
Table S4.
Table S4.
Table S4 List of 57 genes whose deletion mutant strain decreased
Table S4 Biological Process Gene Ontology Terms
