Download EFFECTS OF INCREASED INFLAMMATION ON ANTIVIRAL CD8 T CELL

EFFECTS OF INCREASED INFLAMMATION ON ANTIVIRAL CD8+ T CELL
RESPONSES IN MICE OVEREXPRESSING THE HUMAN-CYSTEINYL
LEUKOTRIENE 2 RECEPTOR (hCysLT2R)
By
Aman Mehrotra
A thesis submitted to the Graduate Program of Microbiology and Immunology
in the Department of Biomedical and Molecular Sciences
In conformity with the requirements for the degree of Master of Science
Queen’s University
Kingston, Ontario, Canada
(December, 2015)
Copyright ©Aman Mehrotra, 2015
Abstract
Inflammation plays a vital role in promoting naïve cytotoxic T lymphocyte (CD8+ T cell)
differentiation. Infection with lymphocytic choriomeningitis virus (LCMV) elicits a robust CD8+
T cell response in the mouse. Cysteinyl leukotrienes (CysLTs) are involved in inflammation and
the transgenic mice (TG) overexpressing the cysteinyl leukotriene 2 receptor (hCysLT2R) exhibit
increased expression of pro-inflammatory transcription factors after stimulation. Here, we
investigate how increased inflammation can affect the activation of CD8+ T cells during viral
infection in TG mice with different doses (low vs. high) of LCMV.
Pro-inflammatory cytokine levels in the serum of TG mice were increased after infection
with low or high viral doses. The data also showed the accumulation of a higher number of
effector CD8+ T cells in TG mice compared to WT mice on day 12 p.i with low or high viral
doses in peripheral tissues.
Analysis of memory CD8+ T cells 40 days p.i indicated increased accumulation of central
memory CD8+ T cells in peripheral tissue (lungs) of TG mice compared to WT mice, irrespective
of the viral doses. However, for the lymphoid tissue (spleen) no difference in memory CD8+ T
cell formation was recorded during infection with a low viral dose, but a lower central memory
CD8+ T cell number was recorded in the spleen of TG mice compared to WT mice with higher
viral doses.
From the results obtained, it can be concluded that increased inflammation can cause a
stronger migration of effector and memory CD8+ T cells to peripheral tissue irrespective of the
viral dose. On the other hand, increased inflammation resulted in decreased central memory
CD8+ T cell formation in lymphoid tissue (spleen) during a high viral dose infection, but not
ii
during infection with a low viral dose. Therefore, using mice expressing the hCysLT2R has
enabled us to examine how increased inflammation during viral infections can impact the
activation of T cells and how this influences their memory phenotype formation.
iii
Acknowledgements
I would like to thank all the people who contributed in some way to the work reported in this
thesis. Firstly, I like to convey my thanks to my supervisor, Dr. Basta, who has supported me
throughout my thesis with his knowledge. Without his effort this thesis would not have been
completed. One merely could not hope for a better or friendlier supervisor. During my Master’s,
he contributed to a worthwhile graduate school experience by giving me rational liberty in my
work, supporting my presence at various conferences, engaging me in new ideas, and demanding
a high quality of work in all my undertakings.
I am also grateful to my committee members, Dr. Anne Ellis and Dr. Colin Funk for
providing me knowledgeable feedback and insightful comments to make my thesis work even
better.
I would like to thank the various members of the lab: Andra, Divya, Heather, Kelly,
Torki, and specially Rylend, with whom I had the opportunity and privilege to work with. I am
grateful for being a part of this amazing team where everyone had a keen scientific acumen,
knack for solving practical difficulties, and ability to put complex ideas into simple terms.
This research was funded by the Canadian Institutes of Health Research (CIHR) and
Natural Sciences and Engineering Research Council of Canada.
I would like to acknowledge the Department of Biomedical Sciences at Queen’s,
specially Dr. Nancy Martin. Also, special thanks to Diane Sommerfeld for making sure
everything ran smoothly with my Master’s paperwork/program and always providing a helping
hand when needed.
iv
Table of Contents
Abstract ......................................................................................................................................................... ii
Acknowledgements ...................................................................................................................................... iv
List of Figures ............................................................................................................................................ viii
List of Tables ................................................................................................................................................ x
List of Abbreviations ................................................................................................................................... xi
Chapter 1 Introduction .................................................................................................................................. 1
Chapter 2 Literature Review ......................................................................................................................... 3
2.1 Priming of CD8+ T cells after viral infection ...................................................................................... 3
2.1.1 CD8+ T cell activation and phenotype changes during an immune response .............................. 3
2.1.2 Signals required for CD8+ T cell activation ................................................................................. 6
2.1.2.1 MHC-peptide complex binding to TCR: the first activation signal for CD8+ T cells ........... 7
2.1.2.2 Second signal for CD8+ T cells activation: Interaction of costimulatory molecules ............ 7
2.1.2.3 Cytokines as the third signal for CD8+ T cells .................................................................... 10
2.1.3 Effector Function of CD8+ T cells ............................................................................................. 12
2.1.4 Localization of naïve, effector and memory T cells................................................................... 13
2.2 Inflammatory response during viral infection ................................................................................... 13
2.3 Role of cysteinyl leukotrienes in inflammation. ............................................................................... 16
2.3.1 Biosynthesis of cysteinyl leukotrienes ....................................................................................... 16
2.3.2 Role of CysLT receptors signaling in the inflammatory response ............................................. 19
2.3.2.1 CysLT receptor and its function .......................................................................................... 19
2.3.2.2 The role of CysLT2R in the inflammatory response ............................................................ 19
2.4 Lymphocytic choriomeningitis virus as a virus model to study the role of CD8+ T cells in antiviral
immune response .................................................................................................................................... 21
2.5 Endothelial cell-specific human cysteinyl leukotriene 2 receptor transgenic mice as an animal
model ...................................................................................................................................................... 24
2.6 Rationale and hypothesis .................................................................................................................. 25
Chapter 3 Materials and methods................................................................................................................ 27
3.1 Mice .................................................................................................................................................. 27
3.2 Virus production and titration ........................................................................................................... 27
3.3 Cell culture ........................................................................................................................................ 29
3.4 Tissue harvesting and processing...................................................................................................... 29
3.5 Generation of bone marrow-derived dendritic cells.......................................................................... 30
v
3.6 Measurement of activation level of CD8+ T cells ex vivo ................................................................. 31
3.7 Intracellular cytokine staining........................................................................................................... 31
3.8 Reverse transcription polymerase chain reaction (RT-PCR) ............................................................ 32
3.9 Genotyping for transgenic mice ........................................................................................................ 35
3.10 Cytokine luminex assay .................................................................................................................. 36
3.11 Statistical Analysis .......................................................................................................................... 37
Chapter 4 Results ........................................................................................................................................ 38
4.1 Detection of hCysLT2R gene in transgenic (TG) mice by PCR. ...................................................... 38
4.2 Induction of 5-lipoxygenase mRNA expression in immune cells after infection with LCMV ........ 38
4.3 Induction of pro-inflammatory cytokine gene expression in lungs and spleen of TG mice ............. 41
4.4 Increased pro-inflammatory cytokine levels in the serum of TG mice 2 days post infection with a
low and a high viral dose ........................................................................................................................ 43
4.5 T cells from naïve TG mice exhibit a similar phenotype to WT mice .............................................. 46
4.6 Analysis of CD8+ T cell activation in spleen and lungs of TG mice after low dose viral infection . 48
4.6.1 Increased inflammation has no effect on the number of CD8+ T cells in spleens of TG mice .. 50
4.6.2 Increased inflammation results in higher effector phenotype on CD8+ T cells in spleen of TG
mice on day 12 post infection with a low viral dose ........................................................................... 50
4.6.3 Increased CD8+ T cell accumulation in the lungs of TG mice on day 12 post infection during a
low dose viral infection. ...................................................................................................................... 54
4.7 Analysis of CD8+ T cell activation in spleens and lungs of TG mice after high dose viral infection
................................................................................................................................................................ 54
4.7.1 Increased inflammation has no effect on the number of CD8+ T cells in the spleen of TG mice
............................................................................................................................................................ 56
4.7.2 Decrease in expression of CD127 on CD8+ T cells in spleens of TG mice during high viral dose
infection on day 8 and day 12 post infection ...................................................................................... 56
4.7.3 Increased CD8+ T cell accumulation in lungs of TG mice on day 12 post infection ................. 60
4.8 Increased inflammation has no effect on activation of CD8+ T cells in spleens of TG mice on day 8
or day 12 post infection with a low or a high viral dose ......................................................................... 60
4.9 Increased inflammation results in stronger activation of CD8+ T cells in lungs of TG mice on day
12 post infection with low and high viral doses...................................................................................... 62
4.10 Detection of virus particles in spleens and lungs of TG mice after infection with a low or a high
viral dose ................................................................................................................................................. 62
4.11 Analysing the effects of increased inflammation on memory CD8+T cell formation in TG mice,
after low viral dose infection .................................................................................................................. 66
vi
4.12 Analysing the effects of increased inflammation on memory CD8+ T cell formation in TG mice
after infection with a high viral dose ...................................................................................................... 68
Chapter 5 Discussion .................................................................................................................................. 70
5.1 Up-regulation of 5-lipoxygenase mRNA expression and inflammatory cytokines after LCMV
infection .................................................................................................................................................. 70
5.2 The virus dose influences how inflammation regulates CD8+ T cells .............................................. 73
5.3 Conclusions and future work ............................................................................................................ 76
References ................................................................................................................................................... 78
vii
List of Figures
Figure 1. Kinetics for CD8+ T cells going through expansion, contraction and memory T cell formation
phase following a viral infection................................................................................................................... 4
Figure 2. Processing of endogenous protein to peptides and their presentation to TCR via class-I MHC
peptide complex. ........................................................................................................................................... 8
Figure 3. Costimulatory signals for CTL activation. .................................................................................... 9
Figure 4. Inflammatory cytokines acting as signal 3 for activation of CD8+ T cells. ................................. 11
Figure 5. Cells and mediators of the inflammatory response...................................................................... 15
Figure 6. Synthesis of leukotrienes by the 5-lipoxygenase pathway. ......................................................... 18
Figure 7. Signal transduction mechanism and the biological effects mediated by CysLT-CysLTR
interaction. .................................................................................................................................................. 22
Figure 8. Structure of lymphocytic choriomeningitis virus (LCMV). ........................................................ 23
Figure 9. Genotyping of mice for hCysLT2R gene expression. .................................................................. 39
Figure 10. Infection with LCMV results in expression of 5-LO in vitro and in vivo infected cells. .......... 40
Figure 11. Induction of pro-inflammatory cytokine gene expression in lungs and spleens of TG and WT
mice during (A) low and (B) high viral dose infection. Densitometry analyses of the PCR results are
shown in (C) for low dose experiment and (D) for high dose experiment.................................................. 42
Figure 12. Levels of IL-1α, IL-1β, IL-6, IL-17α and TNF-α recorded in serum samples of TG and WT
mice during (A) low and (B) high viral dose infection. .............................................................................. 45
Figure 13. Gating sequence for CD8+CD3+ specific marker+ T cells.......................................................... 47
Figure 14. Overexpression of CysLT2R has no effect on the phenotype of CD8+ T cells in naïve TG mice.
.................................................................................................................................................................... 49
Figure 15. Increased inflammation has no effect on the number of CD8+ T cells measured in spleens of
TG mice on day 8 (A) and day 12 (B) post infection with low viral dose. ................................................. 51
Figure 16. No difference in effector phenotype of CD8+ T cells in spleens of TG mice compared to WT
mice on day 8 post infection with low viral dose........................................................................................ 52
Figure 17. Increased inflammation during a low viral dose infection alters the expression of CD62L
(decrease) and KLRG1 (increase) on CD8+ T cells in spleens of TG mice on day 12 post infection. ....... 53
Figure 18. Increased accumulation of CD8+ T cells and higher numbers of effector CD8+ T cells in
peripheral organs (lungs) on day 12 post infection during a low viral dose infection. ............................... 55
Figure 19. Overexpression of CysLT2R has no effect on the number of CD8+ T cells recorded in TG mice
on day 8 and day 12 post infection with high viral dose............................................................................. 57
viii
Figure 20. Decreased expression of CD127 on CD8+ T cells in spleens of TG mice on day 8 post infection
with high viral dose..................................................................................................................................... 58
Figure 21. Decreased expression of CD127 on CD8+ T cells in spleens of TG mice on day 12 post
infection with high viral dose...................................................................................................................... 59
Figure 22. Accumulation of effector CD8+ T cells in peripheral tissue (lungs) on day 12 post infection
during a high viral dose infection. .............................................................................................................. 61
Figure 23. Function of CD8+ T cells is not affected in spleens of TG mice on day 12 post infection with
either a low viral dose (A) or a high viral dose (B). ................................................................................... 63
Figure 24. Increased numbers of functional CD8+ T cells specific for each peptide on day 12 post
infection with (A) low or (B) high viral dose. ............................................................................................ 64
Figure 25. Higher number of central memory CD8+ T cells and low number of effector memory CD8+T
cells in the lungs of TG mice after low viral dose infection (A). No difference in memory T cells in
spleens of TG mice (B). .............................................................................................................................. 67
Figure 26. Numbers of central and effector memory CD8+ T cells in (A) spleens and (B) lungs of TG and
WT mice during high viral dose infection. ................................................................................................. 69
ix
List of Tables
Table 1. Function and kinetics of surface markers expressed during the T cell differentiation from naïve to
effector and finally to memory formation phase. .......................................................................................... 5
Table 2. Expression of CysLT1R and CysLT2R on differnet cell types. ................................................... 20
Table 3. List of Primers for PCR Reaction. ................................................................................................ 34
Table 4. Virus titer in spleens and lungs collected on day 4 after infection with A) Low viral dose; B)
High viral dose ............................................................................................................................................ 65
x
List of Abbreviations
5-LO
5-HPETE
Ab
AP-1
BMDCs
cDNA
CTLs/CD8+ T cells
CysLTs
CysLT2R
cPLA2
DAMPs
DCs
DMEM
dNTP
DNA
EDTA
Egr-1
ER
FACS
FCS
FITC
GP
GPCRs
hCysLT2R
hMCs
ICAM-1
ICS
IFN
IL
KLRG1
LCMV
LFA-1
LTA4
LTB4
LTC4
LY6C
MHC-1
M-MuLV
MOI
mRNA
NF-κB
NP
pAPCs
5-lipoxygenase
5-hydro-peroxy-eicosa-tetra-enoic acid
antibody
activation protein-1
bone marrow-derived dendritic cells
complementary DNA
cytotoxic CD8+ T cells
cysteinyl leukotrienes
cysteinyl leukotriene 2 receptor
cytosolic phospholipase A2
damage-associated molecular patterns
dendritic cells
Dulbecco s Modified Eagle Medium
deoxyribonucleoside triphosphate
deoxyribonucleic acid
ethylenediaminetetraacetic acid
early growth response protein 1
endoplasmic reticulum
flow cytometry
fetal calf serum
flourescin-isothiocyanat
glycoprotein
G protein-coupled receptors
human cysteinyl leukotriene 2 receptor
human mast cells
intercellular adhesion molecule 1
intracellular cytokine staining
interferon
interleukin
killer cell lectin-like receptor G1
lymphocytic choriomeningitis virus
lymphocyte function associated antigen 1
leukotriene A4
leukotriene B4
leukotriene C4
lymphocyte antigen 6 complex, locus C1
major histocompatibility complex-1
Moloney murine leukemia virus
multiplicity of infection
messenger ribonucleic acid
nuclear transcription factor kappa B
nucleoprotein
professional antigen-presenting cells
xi
PAMPs
PBS
PCD
PFA
PFU
PG
p.i
PKC
PRRs
RPM
RPMI
rRNA
RT-PCR
s.c
SDS
SLECs
VCAM-1
TCR
TG
TLR
TNF
TNFR
WT
pathogen-associated molecular patterns
phosphate-buffered saline
programmed cell death
paraformaldehyde
plaque-forming unit
prostaglandins
post infection
protein kinase C
pattern recognition receptors
rotations per minute
Roswell Park Memorial Institute medium
ribosomal ribonucleic acid
reverse transcription polymerase chain reaction
subcutaneously
sodium dodecyl sulfate
short-lived effector function cells
vascular cell adhesion protein-1
T cell receptor
transgenic mice
Toll-like receptor
tumor necrosis factor
tumor necrosis factor receptor
wild type mice
xii
Chapter 1
Introduction
Cytotoxic T lymphocytes (CD8+ T cells) are the main cell type involved in clearance of
viral infection and are part of an adaptive immune response [1, 2]. The lymphocytic
choriomeningitis virus (LCMV) model is well characterized in the field of viral immunology and
has been used to study CD8+ T cell responses. The infection with LCMV provides a robust CD8+
T cell response, which makes this virus one of the most used models to study the role of CD8+
T cells during antiviral immunity [3-5]. CD8+ T cells are continuously circulating in a naïve state
by the interaction of T cell homing receptor CD62L and its ligand. CD62L belongs to the
selectin family of cell adhesion molecules and helps in rolling of naïve CD8+ T cells along the
blood vessel’s endothelial lining [6, 7]. For priming of naïve CD8+ T cells, they need to interact
with peptides bound to major histocompatibility molecules-I (MHC-I) [8]. In addition, costimulatory signals along with inflammatory cytokines such as Type I interferon (IFN),
interleukin (IL)-12 and IFN-γ secreted by professional antigen presenting cells (pAPCs) during
inflammation are also required [8-14]. Once activated, naïve CD8+ T cells proliferate and
differentiate into antigen specific effector CD8+ T cells, which migrate to the site of infection
and initiate the killing of infected cells by inducing programmed cell death (PCD) with the help
of perforin and granzymes [9-12].
Inflammation is part of the innate immune response, but it is also needed for an adaptive
immune response. When foreign particles such as viruses are recognized within the body by the
immune system, inflammatory responses are initiated. Production of histamines and leukotrienes
1
is important for the inflammatory process [15, 16]. Leukotrienes bind to leukotriene receptors
and result in increased vascular permeability, thereby allowing plasma proteins and white blood
cells to migrate from the blood vessels to the site of infection, resulting in inflammation [15-17].
Cysteinyl leukotrienes (CysLTs) belong to the family of eicosanoid inflammatory
mediators, and their production involves the liberation of arachidonic acid from intracellular
membranes via the activity of cytosolic phospholipase A2 (cPLA2). The action of
5-lipoxygenase (5-LO) on cPLA2 along with several downstream enzymatic conversion steps
eventually leads to the production of inflammatory mediators such as leukotriene C4 (LTC4).
Interaction of LTC4 with the cysteinyl leukotriene 2 receptor (CysLT2R) contributes to
inflammatory responses by up-regulating transcription factors such as nuclear transcription factor
kappa B (NF-κB) and activation protein 1 (AP-1) [18-20]. Although leukotrienes are involved in
the inflammatory response, their influences on the function of CD8+ T cells during viral infection
have never been examined.
In this study, we investigate how altering an inflammatory condition by over-expressing
the human cysteinyl leukotriene 2 receptor (hCysLT2R) can affect the activation of CD8+ T cells
during viral infection.
2
Chapter 2
Literature Review
2.1 Priming of CD8+ T cells after viral infection
2.1.1 CD8+ T cell activation and phenotype changes during an immune response
Upon recognizing foreign particles and their presentation by pAPCs, CD8+ T cells go
through a clonal expansion, a contraction of the T cell population and a memory formation phase
(Figure 1) [1, 7]. During the clonal expansion phase the number of activated CD8+ T cells
increases and they acquire effector function, after which these effector CD8+ T cells travel to the
site of inflammation in order to clear the infection by killing the infected cells [9-12, 21]. Once
the clearance of infection is completed, effector CD8+ T cells experience a contraction phase
during which cells undergo apoptosis, and their numbers are reduced by 90-95%. The remaining
effector CD8+ T cells undergo a memory formation phase to form central or effector memory
T cells [1, 21-23]. Each of these phases have different phenotypic expressions of various surface
markers such as CD44 (adhesion molecules), CD25 (IL-2 receptor α chain), CD62L (L-selectin,
cell adhesion molecules), CD69 (activation marker), CD127 (IL-7 receptor α chain), KLRG1
(killer cell lectin-like receptor subfamily G member 1) and Ly6C (lymphocyte antigen 6
complex, locus C1). The expression of these markers can be used to identify T cell phenotypes
(Table 1).
3
Figure 1. Kinetics for CD8+ T cells going through expansion, contraction and memory T cell
formation phase following a viral infection.
During an expansion phase the number of naïve CD8+ T cells increases dramatically with one precursor
cell giving rise to more than 1000-10,000 daughter cells during the course of 7-8 days post infection.
When a pathogen is cleared, the majority of the effectors cells undergo contraction phase and the
remaining cells form CD8+ memory T cells. Figure adapted from [1].
4
Table 1. Function and kinetics of surface markers expressed during the T cell differentiation from
naïve to effector and finally to memory formation phase.
Marker
Description
CD25
Alpha chain of the IL-2 receptor
CD127
Marker for IL-7 alpha subunit
CD44
Adhesion molecule marker, plays a
Naïve T cells
+
Effector T
cells
Central
memory T cells
++
+
++
+
/-
+++
+
+++
+++
+++
+
+++
+
/-
++
+
/-
+
/-
++
+
/-
+
+++
+++
/-
/-
vital role in extravasation of T cells
into the site of inflammation
CD62L
Adhesion molecule playing a vital
role in movement of lymphocyte to
/-
secondary lymphoid tissues
CD69
Marker to detect T cells in their early
activation phase
KLRG1
Expressed on antigen experienced
T cells. used to identify short-lived
effector T cells on which this marker
is highly expressed
Ly6C
Plays role in lymphocyte-endothelial
cell adhesion
NOTE: “+/-”mean very low or no expression of the marker; “+” mean a lower expression of the marker
whereas “+++” means a high expression of the marker.
5
Naïve CD8+ T cells are characterised by high expression of CD62L and CD127 [24].
CD62L is a T cell homing receptor that allows naïve T cells to home specifically to the lymphoid
tissue [24], whereas CD127 plays a key role in the survival and proliferation of CD8+ T cells
during the early stages of T cell development [25, 26]. On the other hand, during clonal
expansion, T cells are activated by antigen presentation and undergo functional changes from the
naïve to early activated state and finally reach the effector state. The activation state can be
characterised by higher expression of CD25, CD69, and CD44 [27, 28]. As the cells progress
from the early activated state to effector state, the expression of CD25, CD69, CD127 and
CD62L gets down-regulated, whereas the expression of CD44, KLRG1 and Ly6C on these
antigen specific effector CD8+ T cells is up-regulated and reaches its peak (Table 1) [29-31].
Once the clearance of foreign particles has been achieved, effector CD8+ T cells undergo the
contraction phase and the cells that survive the contraction phase achieve a memory state. These
memory T cells express higher levels of CD44, CD62L and CD127 while the expression of
KLRG1 is reduced (Table 1) [26].
2.1.2 Signals required for CD8+ T cell activation
In order to activate naïve CD8+ T cells to become effector CD8+ T cells, they must be
presented with MHC-I peptide complexes, as well as bind to co-stimulatory signals on pAPCs,
and get exposed to inflammatory cytokines such as IL-12 for their optimal activation,
proliferation and differentiation [9-12]. In total, three signals are needed, the first being peptideMHC class I complexes which interact with the T cell receptor (TCR). The second signal needed
for activation is the costimulatory signal (CD28-B7). Finally, the inflammatory cytokines such as
IFN, IL-12 and IL-2 are considered as signal 3 [32]. The function of each of the signals and how
6
they affect the activation and proliferation of naïve CD8+ T cells is explained below in more
detail.
2.1.2.1 MHC-peptide complex binding to TCR: the first activation signal for CD8+ T cells
Antigen is first processed and broken down into smaller peptides by the proteasome in
the cytosol. Peptides get loaded onto MHC-I molecules within the endoplasmic reticulum (ER)
of the pAPCs, get transported onto the pAPCs’ surface and presented to the TCR [33-35]. Out of
thousands of peptides only a fraction of peptides are presented on the cell surface, based on their
ability to form a stable complex with MHC (Figure 2) [33, 34, 36]. The interaction of the TCR
with the peptide-MHC-I complex is not enough for optimal activation of T cells. To achieve this,
two more signals are needed, one of them being the co-stimulatory signal involving interaction
of CD28 with CD80 or CD86 (B7 family genes).
2.1.2.2 Second signal for CD8+ T cells activation: Interaction of costimulatory molecules
After the first signal being provided by the class I MHC-peptide complex, a second signal
must also be provided by the interaction of CD28/B7 (receptor/ligand) for the initial expansion
and survival of T cells (Figure 3) [37]. While the B7 family ligands are expressed on pAPCs, e.g.
dendritic cells and macrophages, CD28 receptor, a homodimer glycoprotein, is expressed on the
surface of CD8+ T cells [38, 39]. The importance of CD28/B7 signaling has been experimentally
recognized by using CD28-/- mice, where it has been shown that CD28-/- mice exhibited a clonal
expansion of CD8+ T cells, but fail to maintain their functionality [37, 40, 41]. Furthermore,
involvement of CD28 in IL-2 production and in regulating the early T cell activation has been
shown using the same CD28-/- mouse model [37, 40, 41].
7
Figure 2. Processing of endogenous protein to peptides and their presentation to TCR via class-I
MHC peptide complex.
Degradation of viral protein predominantly by the proteasome generates peptides that are actively
transported into the lumen of the endoplasmic reticulum (ER). With the help of peptide loading complex,
peptide gets loaded on MHC class I within the ER. Eventually the MHC I-peptide complex gets
transported to the cell surface, where the peptide is presented to T cell receptors (TCR) on cytotoxic CD8+
T cells (Figure adapted from [35] ).
8
Figure 3. Costimulatory signals for CTL activation.
Interaction of CD28/B7, CD27/CD70 results in positive costimulatory signalling. Also, CD40L a member
of the TNF ligand family, is expressed on activated T cells, and its binding to CD40 on dendritic cells
induces expression of 4-1BBL, OX40L and CD70, the ligands, respectively, for 4-1BB, OX40 and CD27
which further increases the positive costimulatory signalling for CTL activation (Figure adapted from
[37]). Abbreviations: TNF (tumour necrosis factors).
9
Binding of a receptor with its specific ligand initiates functional responses, for example,
binding of the CD28 receptor to B7 ligands provides the positive costimulatory signal for
cytotoxic CD8+ T cells (CTL) activation and prevents T cell apoptosis. On the other hand,
binding of the CD40 receptor to its ligand CD40L, activates macrophages and induces the
expression of costimulatory receptors on pAPCs [37, 42]. Of these different costimulatory
molecules, the signals produced by PD-1/PD-L (receptor and its ligand binding), act as an
inhibitory signal for CTL proliferation (Figure 3) [43, 44]. In addition to the CD28 family,
several members of the tumour necrosis factor receptor (TNFR) family are also involved in CTL
activation. CD40L, a member of the tumour necrosis factor (TNF) family is expressed on
activated T cells, and its binding to CD40 on dendritic cells induces expression of other TNFR
that up-regulates CTL activation (Figure 3) [45].
2.1.2.3 Cytokines as the third signal for CD8+ T cells
Signals provided to CD8+ T cells by MHC-peptide complex binding to TCR and the
costimulatory signals from CD28/B7 interactions along with cytokine signaling (IL-12 and/or
Type I IFN) significantly enhances the ability of CTLs to proliferate, survive, and clear the virus
[46-48]. Recent studies have indicated that inflammatory cytokines, especially IL-12, and Type I
IFN (IFNα, secreted by dendritic cells and IFNβ, secreted by fibroblast) are the major signal 3
cytokines that determine the differentiation of naïve CTLs into fully functional effector CTLs
(Figure 4) [13, 49-51]. It has also been reported that IL-2 secreted by CD4+ T cells helps in
expansion of effector CTLs [52]. IL-2 is initially produced by CTLs, but is required to be
presented by CD4+ T cells, as naïve CTLs ability to produce IL-2 is lost during their conversion
10
Figure 4. Inflammatory cytokines acting as signal 3 for activation of CD8+ T cells.
Inflammatory cytokines, such IL-12 or IFNα/β act as signal 3 and are required for naïve CD8+ T cells
activation. Absence of signal 3 results in compromised survival and suboptimal development of effector
functions. On the other hand, presence of signal 3 results in increased survival of CD8+ T cells; the cells
develop strong effector functions and a protective memory population (Figure adapted from [13]).
11
to effector CTLs [53]. CD25, which is a part of the IL-2 receptor, is not expressed constitutively
on CTLs, but is instead up-regulated upon activation of CTLs by cytokines such as IL-12 and
IL-2 [32, 54]. Delivery of a stronger IL-2 signal to activated CTLs, due to increased expression
of CD25 results in differentiation of CTLs more towards short-lived effector cells (SLECs) [55].
2.1.3 Effector Function of CD8+ T cells
The main function of activated effector CD8+ T cell is killing of infected cells via PCD,
also known as apoptosis. Apoptosis is a highly complex and sophisticated mechanism eventually
resulting in cell death [11]. CD8+ T cells initiate this via the perforin/granzyme pathway which
involves the secretion of a pore forming protein called perforin, followed by the release of
cytotoxic granules from CTLs into the target cell [56, 57]. The most important components of
these granules are granzyme A and granzyme B enzymes [56].
Granzyme B induces a cascade-based apoptosis of the infected cell through cleavage of
procaspase-10 at the aspartate residue, resulting in activation of procaspase-10 to caspase 10,
which results in activation of caspase-3, and ultimately DNA fragmentation [11, 58]. When
compared to the function of Granzyme B, it was seen that granzyme A is important in caspaseindependent pathway activation for PCD by cleavage of the protein SET complex. The protein
Set complex is a nucleosome assembly protein, which normally inhibits the NM23-H1 (a tumour
suppressor gene product). Cleavage of the SET complex via Granzyme A causes the release of
NM23-H1, resulting in degradation of DNA [11, 59].
12
2.1.4 Localization of naïve, effector and memory T cells.
In general, naïve T cells continuously circulate in the body from blood to secondary
lymphoid tissues, but once presented with MHC-I peptide complex along with co-stimulatory
signals and inflammatory cytokines, these naïve T cells proliferate, acquire effector functions,
and migrate to the site of infection [60]. Normally, a low number of naïve CD8+ T cells are
present in the non-lymphoid tissues such as lungs, but once activated, CD8+ T cells can migrate
to all non-lymphoid organs [61, 62]. It has been shown that after systemic viral infections, the
lungs are one of the main peripheral sites where major localization of effector and memory CD8+
T cells occur following an infection [63]. Galkina et al., in 2005, demonstrated that after
adoptive transfer of a mixture of naïve and effector CD8+ T cells intravenously in control noninfected mice, that the effector CD8+ T cells were the ones localized to the lungs [60]. This
difference in localization of effector T cells is due to the differences in the adhesion molecules
and chemokine receptors expressed on these effector T cells compared to naïve CD8+ T cells
[60]. Glakina et al. also showed that lymphocyte function-associated antigen 1 (LFA-1) which is
expressed on all leukocytes, plays a critical role in the prolonged residence of T lymphocytes
within the lungs. LFA-1 is known to interact with intercellular adhesion molecule-1 (ICAM-1),
which has been shown to be overexpressed in the transgenic (TG) mouse model over-expressing
the hCysLT2R [60].
2.2 Inflammatory response during viral infection
Inflammation plays an important role in activating the immune system after infection
[64]. The classic inflammatory condition is characterised by five symptoms: redness, swelling,
13
heat, pain, and loss of tissue function. These symptoms reflect increased permeability of the
vascular endothelium allowing leakage of the serum components and extravasation of immune
cells [64, 65]. Alteration of vascular permeability plays an important role in the inflammatory
response. Histamine, prostaglandins, and nitric oxide act on vascular smooth muscle to cause
vasodilation, which increases blood flow and brings in circulating leukocytes, whereas
inflammatory mediators, including histamine and leukotrienes act on endothelial cells to increase
vascular permeability and allow plasma proteins and leukocytes to exit the circulation (Figure 5)
[15, 65]. On the other hand, cytokines such as TNF and IL-1 secreted during innate immunity
promote leukocyte extravasation by increasing the levels of leukocyte adhesion molecules on
endothelial cells, playing an important role in movement of adaptive immune cells to the site of
inflammation [15, 65].
Cytokines that are responsible for movement of T cells to the site of inflammation are
produced during innate immune responses. Innate immunity is the rapid first line of the body’s
defence against an infection, which can be mediated by innate immune cells, including
macrophages and dendritic cells (DCs). Not only innate immune cells, but non-professional cells
such as epithelial cells, endothelial cells, and fibroblasts can also contribute to innate immunity
[64-66]. The innate immune defences are non-specific, and their capacity in fighting an infection
is general [15, 66]. Innate immune cells recognize pathogen invasion or cell damage with
intracellular or surface-expressed pattern recognition receptors (PRRs). PRRs, either directly or
indirectly interact with pathogen-associated molecular patterns (PAMPs), such as microbial
nucleic acids, lipoproteins, and carbohydrates, or damage-associated molecular patterns
(DAMPs) released from injured cells [15, 67, 68]. One such PRR is Toll-like receptor (TLR),
14
Figure 5. Cells and mediators of the inflammatory response.
Changes in vascular permeability and leukocytes migration and activation can be stimulated from
molecules derived from plasma proteins and cells in response to tissue damage or pathogen-mediated
inflammation. Leukotrienes are one of the many inflammatory mediators secreted from macrophages and
mast cells at the site of infection or inflammation and play a role in vascular permeability and leukocyte
attraction (Figure adapted from [15]).
15
which after recognizing the PAMPs, results in the production of pro-inflammatory cytokines
such as IL-1β and IL-18. These inflammatory cytokines enhance the inflammatory response
resulting in regulation of CTL (CD8+ T cell) responses as well as play a role during the
activation and contraction phase of CD8+ T cells [48, 69, 70].
We know that inflammation is important for attraction of immune cells to the site of
infection and cytokines produced during inflammation play a vital role in activation of CD8+
T cells. Next, I will discuss the role of CysLTs in the inflammatory responses.
2.3 Role of cysteinyl leukotrienes in inflammation.
2.3.1 Biosynthesis of cysteinyl leukotrienes
Lipid molecules which are a primary nutrient energy source and the major components of
cell membranes play an important role in the regulation of many normal cellular functions during
homeostasis [64, 71]. The role of lipid molecules in production of mediators or bioactive lipids
such as prostaglandins (PGs) and leukotrienes (LTs) is well studied. These mediators (PGs and
LTs) have been recognized as potent inflammatory mediators who initiate and propagate a
diverse range of biological responses [64, 71, 72].
CysLTs belong to a family of potent inflammatory lipid mediators and have been shown
to play an important role in initiating the inflammatory responses against infection [15, 64, 71].
Other lipid mediators such as PGs have also been shown to initiate and propagate a diverse range
of biological responses, one of them being the inflammatory response [64, 71, 72]. Arachidonic
acid, which is a common precursor for the production of lipid mediators can be oxidatively
16
metabolized by the cyclooxygenase pathway resulting in the formation of PGs or by the 5-LO
pathway resulting in the formation of LTs as shown in Figure 6 [64, 73].
Arachidonic acid is synthesized by a variety of cells, including mast cells, eosinophils,
basophils and macrophages [74]. They get liberated from nuclear membrane phospholipids by
cytosolic phospholipase A2 (cPLA2) in response to cell activation [72]. Cytokines/mediators
produced against infection and inflammation allow arachidonic acid liberation and activation of
the 5-lipoxygenase pathway (5-LO pathway), which results in production of CysLTs [18, 72,
75]. The substrate for the 5-LO, arachidonic acid is first oxidized to 5-hydro-peroxy-eicosa-tetraenoic acid (5-HPETE) followed by a dehydration step resulting in formation of leukotriene A4
(LTA4), an unstable intermediate (Figure 6) [72, 76]. Two different classes of LTs can be
produced from LTA4: 1) LTB4 formed by LTA4 hydrolase expressed by mast cells, macrophages,
and neutrophils [77], or 2) LTA4 is conjugated to reduced glutathione by leukotriene C4 synthase
(LTC4S), converting LTA4 to LTC4, a more stable CysLTs. LTC4 gets converted to LTD4 and
LTE4 by the action of γ-glutamyl transpeptidase (γ–GT) and dipeptidase (DiP), respectively
(Figure 6) [76, 78].
17
Adjacent cell
Figure 6. Synthesis of leukotrienes by the 5-lipoxygenase pathway.
Arachidonic acid is metabolised to leukotriene A4 (LTA4) by 5-lipoxygenase (5-LO) and 5-LO activating
protein (FLAP). LTA4 is an unstable LT which can be converted to LTB4 (by LTA4H) or the cysteinyl
leukotriene C4 (LTC4) by leukotriene C4 synthase (LTC4S). LTC4 then can be converted in LTD4 and
LTE4 by γ-GT or γ-GL and DiP, respectively. These LTs then bind to the indicated G protein-coupled
receptors. Abbreviations: cPLA2: cytosolic phospholipase A2; BLT: leukotriene B receptor; DiP:
dipeptidase; γ-GL: γ-glutamyl leukotrienase; γ-GT: γ-glutamyl transpeptidase; 5-HPETE: 5-hydroperoxy-eicosatetraenoic acid. Figure adapted from [64].
18
2.3.2 Role of CysLT receptors signaling in the inflammatory response
2.3.2.1 CysLT receptor and its function
CysLTs bind to G protein-coupled receptors (GPCRs), which mediate the ligand-induced
signalling between the extracellular and intracellular environments via interactions with
intracellular G proteins [79]. There are two kinds of CysLT receptors: 1) Cysteinyl leukotriene 1
receptor (CysLT1R), which has been shown to be involved in the airway-related inflammatory
allergic diseases such as asthma [80], and 2) Cysteinyl leukotriene 2 receptor (CysLT2R), which
plays a major role in inflammatory diseases of the endocrine and cardiovascular systems [81].
CysLT1R is expressed on a variety of immune-component cells and structural cells, whereas
CysLT2R is co-expressed with CysLT1R in many cell types, including endothelial cells,
eosinophils, mast cells and macrophages (Table 2) [74, 82].
The role of CysLT2R is not fully understood, but its distinct pro-inflammatory action,
which is not shared by CysLT1R has been described [82, 83]. The presence of CysLT2R on the
human mast cells (hMCs) and its role in the up regulation of NF-κB and AP-1 (transcription
factors for inflammatory cytokines) is well established [20, 82]. How CysLT2R plays a role in
inflammatory response is described in the next section.
2.3.2.2 The role of CysLT2R in the inflammatory response
One of the main functions of CysLT is to act as the initiator of leukocyte recruitment,
attracting the first immune cells into tissues. These initial responding immune cells produce
cytokines locally, which in turn induce the local release of chemokines [19, 84, 85]. Each of the
CysLTs have different binding affinity and binding of a higher affinity ligand with its receptor
19
Table 2. Expression of CysLT1R and CysLT2R on differnet cell types.
Type of cell
CysLT1R
CysLT2R
Macrophage or monocyte
+
+
Dendritic cell
+
?
Eosinophil
+
+
Basophil
+
+
Mast cell
+
+
B cell
+
?
CD4+ T cell
+
?
CD8+ T cell
?*
?
Endothelial cell
+
+
Epithelial cell
+
+
Airway smooth muscle cell
+
?
Expression of receptor is classified as positive (+), negative (-), or as yet undetermined (?).Table adapted
from [74]. Note: *CysLT1R expression may be up-regulated upon activation of the cells.
20
results in membrane-bound receptor conformational changes. This results in activation of G
protein GDP-GTP exchange, hydrolysis of GTP and intracellular signalling events as shown in
Figure 7 [19, 86]. The signaling events result in increased intracellular Ca2+, which causes
increased vascular permeability, airway hypersensitivity and bronchoconstriction (in the case of
asthma), as well as eosinophil activation [87, 88].
2.4 Lymphocytic choriomeningitis virus as a virus model to study the role of CD8+ T cells in
antiviral immune response
LCMV belongs to the Arenaviridae family, is known to be a natural mouse pathogen, and
has been used to study host-pathogen interactions. Use of LCMV as the virus model in order to
study the CD8+ T cell role in viral immunity had led to major advancement in the field of
immunology,
including
understanding
viral
pathogenesis,
viral
persistence,
major
histocompatibility complex (MHC) restriction in T cell recognition, and their roles in viral
clearance and immunopathology [3-5].
LCMV is an enveloped negative strand RNA virus with a dense lipid envelope, and a
surface layer covered by equally spaced characteristic spiked-like surface structures representing
the viral glycoproteins (GP-1 and GP-2) (Figure 8) [89]. The viral nuclear material consists of
two RNA genomes, large (L) (5.7kb) and small (S) (2.8kb) segments. The L segments encode for
the RNA-dependent RNA polymerase and small RING finger proteins called Z protein, which
inhibit RNA synthesis mediated by the virus polymerase and can interact with several host cell
proteins [90]. On the other hand, the S segment directs the synthesis of the glycoprotein
precursor (GPC) which will be cleaved into mature viral glycoproteins GP-1 and GP-2 (Figure 8)
[90].
21
Figure 7. Signal transduction mechanism and the biological effects mediated by CysLT-CysLTR
interaction.
CysLTs and LTB 4 act through GPCR coupled to G protein and their interaction results in hydrolysis of
GTP. Phospholipase C activated from GTP hydrolysis results in conversion of PIP2 into IP3 (plays role in
increasing intracellular calcium) and DAG (plays role in secretion of PKC, which is a protein kinase
enzyme playing role in regulating expression of transcription factors). CysLTs cause increased airway
hyper-reactivity (AHR), increased mucus secretion and increased capillary permeability. They also cause
activation of eosinophils and their recruitment, and decrease eosinophil apoptosis. Figure adapted from
[19]. Abbreviations: PIP2: Phosphatidylinositol diphosphate; IP3: inositol triphosphate; DAG:
diacylglycerol; ER: endoplasmic reticulum; PKC = protein kinase C.
22
Figure 8. Structure of lymphocytic choriomeningitis virus (LCMV).
LCMV is an enveloped negative strand RNA virus. Viral ribonucleoproteins are packed into two circular
structures and are associated with RNA-dependent L polymerase. The virus nuclear material consists of
two RNA genomes, large (L) and a small (S) segment. The L segment (5.7 Kb) encodes for the RNAdependent RNA polymerase (L polymerase) and a small RING finger protein called Z protein. The S
segment (2.8 Kb) directs the synthesis of the glycoprotein precursor (GPC) and the nucleoprotein (NP).
GPC is usually cleaved into mature viral glycoprotein GP-1 and GP-2. The glycoproteins, GP-1 and GP-2
form a complex that becomes a spike on the virion envelope aligned with Z protein and mediates virus
interaction with the receptor on the host cells. (Figure adapted from [5]).
23
Importance of CTLs in LCMV clearance was first shown by employing adoptive transfer
experiments by Zinkernagel and Welsh, where they transferred the CD8+ T cells from LCMVimmune mice into infected animals and observed that there was reduced viral replication in the
recipient mice [91]. They showed that using LCMV as the virus model will help in overcoming
an obstacle of not getting a stronger CD8+ T cell response during a viral study [91].
2.5 Endothelial cell-specific human cysteinyl leukotriene 2 receptor transgenic mice as an
animal model
The mouse model created by Hui et al. [17] which over-expresses hCysLT2R in vascular
endothelium (EC-hCysLT2R transgenic mouse) is the mouse model used in this study. Hui et al.
demonstrated that an EC-hCysLT2R mouse, which is referred to as transgenic mice (TG) in this
report, has increased vascular permeability. Hui et al. also showed that over-expressing the
CysLT2R may intensify inflammation by increasing vascular permeability by recruiting more
neutrophils through enhanced P-selectin expression on endothelial cells [17]. Further
experiments by Jiang et al. in 2008 [92] indicated that over-expression of CysLT2R in
endothelial cells is in some way responsible for intensifying myocardial injury after ischemia
reperfusion [92]. Their studies showed the increased expression of pro-inflammatory genes such
as early growth response protein 1 (Egr-1), vascular cell adhesion protein-1 (VCAM-1) and
ICAM-1 in transgenic mice [92].
Experiments from Hui et al. also showed a stronger expression of the hCysLT2R in lungs
compared to other peripheral tissues such as liver. The reason for this is that the expression of
hCysLT2R was achieved by use of the tie2 promoter/enhancer, which is specific to endothelial
cells. Hence, the expression of hCysLT2R is specific to endothelial cells. The surface area of
24
lungs expressing endothelial cells is higher compared to liver; therefore, northern blotting
analysis detected a strong band transcript in lungs of TG mice, but not in liver [17]. This stronger
expression of the receptor in localised tissue (lungs) may also provide us an understanding on
how altering localized inflammatory responses in peripheral tissue affects an antiviral CD8+
T cell response.
So far, no model has been employed to study the role of CysLT2R in regulating immunity
during viral infections and there are still knowledge gaps in understanding the effects of altered
inflammatory conditions on CD8+ T cells activation, proliferation, and function. This model will
help in understanding the effect of increased systemic and localized inflammatory conditions on
CD8+ T cell responses.
2.6 Rationale and hypothesis
CD8+ T cells are important for the clearance of viral infection and the importance of
inflammation in the contraction phase of CD8+ T cells after clearance of viral infection has
already been reported [70]. Also, it has been demonstrated that after systemic viral infection,
lungs are the main peripheral site for localization of effector and memory CD8+ T cells [63]. The
engagement of the CysLT2R results in the up-regulation of transcription factors such as NF-κB
and AP-1, important for the induction of pro-inflammatory cytokines. [83].
Since the transgenic mice over-expressing the CysLT2R have been shown to have
increased vascular permeability, and increased expression of pro-inflammatory transcription
factors after coronary artery occlusion surgery were found [92], we hypothesized that
production of CysLTs after infection with LCMV will bind the CysLT2R resulting in
increased inflammation and altered CD8+ T cell responses in the TG mice.
25
To test this hypothesis, we formulated the following aims:
1. Determine the effect of over-expressing the CysLT2R on inflammatory cytokine production.
2. Study the effects of altered inflammation on CD8+ T cell phenotype and function after virus
infection.
3. Investigate the effects of altered inflammation on virus-specific memory CD8+ T cell
formation.
26
Chapter 3
Materials and methods
3.1 Mice
C57BL/6 mice were purchased from The Jackson Laboratory (Bar Harbor, Maine), and
used for breeding setup for TG mice. The progeny was genotyped and differentiated between TG
and WT mice and used for the experiments.
Eight to twelve weeks old mice were used for experiments, in accordance with the
guidelines of the Canadian Council of Animal Care with protocols approved by the Queen’s
Animal Care Committee. For most of the experiments performed, four of each strain of mice
(TG and WT) were used.
3.2 Virus production and titration
LCMV-WE was originally obtained from F. Lehmann-Grube (Germany) and propagated
on L929 cells. These viruses were propagated as previously described[93]. Briefly, L929 cells
were allowed to grow to approximately 80% confluence in (T150) flasks with DMEM containing
5% FCS. Medium was removed, and L929 cells were infected with LCMV-WE at a multiplicity
of infection (MOI) of 0.01 in 5 mL of fresh medium. Flasks were incubated for 1 h at room
temperature on a shaker, after which 15 mL of fresh medium was added. Flasks were incubated
for 48 hours at 37°C. Supernatant containing virus was collected and aliquoted on ice. Stocks
were kept frozen at -80°C for further use.
Virus titration was carried out by LCMV-NP FACS assay as described by Johnson et al.
[94]. Vero cells were plated in flat bottom 96-well tissue culture plates in DMEM at 50,000 cells
27
per well and incubated at 37°C and 5% CO2 overnight. Serial dilutions of the 1x106 PFU/ml
LCMV-WE viral stock (2 to 3 duplicate 3-fold dilutions) were prepared as positive controls in
DMEM media and 100 µl of each dilution was added to Vero cells. Vero cells were then
incubated with virus for 48 hrs. Cells were then washed with cold 1xPBS and incubated with
60 µl of warm 0.25% trypsin at 37°C for 5 minutes. Thereafter, 60 µl of cold DMEM with 5%
FCS was added to each well, the cells were removed by gentle pipetting, and transferred to a
96-well round-bottom plate. Cells were pelleted by centrifugation at 300 G, resuspended in 4%
paraformaldehyde (PFA) with 1% saponin, and incubated at room temperature for 15 minutes.
The cells were pelleted by centrifugation at 300 G and washed twice in PBS with 1% saponin.
The cells were then resuspended in primary rat anti-LCMV-NP Ab (clone VL4) with 0.5%
saponin and incubated at room temperature for 60 minutes. The cells were pelleted by
centrifugation at 300 G and washed twice in PBS with 0.5% saponin. Next, the cells were stained
with FITC-conjugated goat anti-rat IgG Ab (1 μg/ml, Cedarlane), incubated at room temperature
for 30 minutes. The cells were then washed twice in PBS with 0.5% saponin, re-suspended in
FACS buffer (PBS, 1% FCS and 0.5% sodium azide), and the results were acquired using FACS.
To assess virus titer in tissues, spleen and lungs were collected on day 4 p.i with low and
high viral doses. Harvested spleens and lungs were cut into smaller pieces, 1 ml of DMEM was
added, and the tissue samples were homogenized. Following the homogenization, samples were
centrifuged at 300x G for 5 min., followed by collection of the supernatant. Collected
supernatant samples were stored at -80°C until the virus titration was performed.
28
3.3 Cell culture
Vero cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) containing 5%
fetal calf serum (FCS) at 37°C in a 5% CO2 humidified incubator according to the previously
described protocol [94]. The murine macrophage cell line BMA was obtained from Dr. K. Rock
(University of Massachusetts Medical School, Worcester, MA). Cells were grown in media
containing Roswell Park Memorial Institute medium (RPMI) and 5% FBS, at 37°C in a CO2
humidified incubator according to the previously described protocol [95]. Before experiments,
cells were counted with a hemocytometer [American Optical, Buffalo, NY] and viability was
determined by using the 0.3% (v/v) trypan blue exclusion method [Sigma-Aldrich, Oakville].
3.4 Tissue harvesting and processing
For infections, mice were injected subcutaneously (s.c) with either 3x104 (low viral dose)
plaque-forming units (PFU) or 1x106 PFU (high viral dose) of the virus. Spleen and lung cells
were analysed 6, 8, 12, and 40 days post infection (p.i).
For spleen and lung harvesting, mice were sacrificed on the specific day as per
experiment requirement. Spleens were harvested in phosphate-buffered saline (PBS) and then
mashed against the strainer to collect the cells and leave behind any tissue on the strainer. Cells
collected in PBS were subsequently centrifuged at 300xg for 5 min. Splenocytes collected at the
bottom were washed with sterile PBS followed by incubation with lysis buffer (1.66% w/v
ammonium chloride) for 5 minutes to lyse the red blood cells. Splenocytes were re-washed with
sterile PBS and cells suspension was passed through a metal sieve to remove any debris.
Splenocytes were counted with a hemocytometer [American Optical, Buffalo, NY] and viability
was determined by using the 0.3% (v/v) trypan blue exclusion method [Sigma-Aldrich,
29
Oakville]. The cell suspension was made according to the number of cells needed per ml for each
experiment.
Lungs were harvested on specific days as per experiment requirement, and processed in
accordance with the protocol explained by Rayamajhi et al., with some modifications [96].
Briefly explained, lungs were harvested in cold PBS following which they were cut down into
smaller pieces and incubated with 3 ml 1mg/ml of collagenase D for 25-30 min. After
incubation, EDTA was added to a final concentration of 10mM to stop the collagenase D enzyme
activity, and the samples were placed on ice. Samples were then mashed against strainers, and
cells collected were suspended in 10 ml PBS and then centrifuged at 500xg for 5 min. Cells were
then incubated with lysis buffer (1.66% w/v ammonium chloride) for 10 min, were washed with
PBS, and cell suspension was passed through a metal sieve to remove any debris. Live cells were
counted with a hemocytometer [American Optical, Buffalo, NY] and viability was determined by
using the 0.3% (v/v) trypan blue exclusion method [Sigma-Aldrich, Oakville]. The cell
suspension was then made according to the number of cells needed per ml for each experiment.
3.5 Generation of bone marrow-derived dendritic cells
Mouse bone marrow-derived dendritic cells (BMDCs) were generated from bone marrow stem
cells in the presence of GM-CSF for 8 days as previously described [97]. Femurs and tibias from
naïve 6-8 weeks old mice were collected and the bone marrow was flushed with PBS using a
26 g3/8 sterile needle (Becton-Dickinson, Rutherford, N.J, U.S.A). Bone marrow cells were
washed with PBS twice and resuspended in lysis buffer (1.66% w/v ammonium chloride) for
5 min. Cells were washed again twice with PBS and cell suspension was passed through a metal
sieve to remove any debris.
30
Bone marrow cells were cultured in 6-well tissue culture plates (3-5 x 106 cells/ well) in
RPMI containing 10% FBS, supplemented with 50 μM 2ME (Bioshop Canada Inc., Burlington,
Ontario), 10 ng/ml GM-CSF (Cedarlane, Ontario, Canada), and 3 μg/ml of gentamicin
(Invitrogen, Ontario, Canada). Every 2 days, 2 mL of the media was removed and replenished
with fresh medium. On day 6, non-adherent cells were transferred to a new 6-well plate and left
for 72 h at 37°C before using in the assays. The loosely adherent cells (highly enriched CD11c+
MHC-II+ BMDCs) were harvested on day 8 and used for experiments.
3.6 Measurement of activation level of CD8+ T cells ex vivo
Splenocytes and lung cells were plated in 96-well round bottom plates and centrifuged at
300xg for 5 min. All the wells were stained with PE-Cy5-conjugated anti-mouse CD8α (clone
53-6.7) and with Alexa Fluor® 488-conjugated anti-mouse CD3 (clone 17A2) to stain CD8+
T cells, followed by staining of each well with specific markers such as flourescin-isothiocyanat
(FITC) labeled CD25 (clone 3C7), CD127, CD44, CD62L, CD69 (cone H1.F3), KLRG1, and
with biotin anti-mouse LY6C (clone HK1.4) for 25 min. Biotin antibody Ly6c was then
additionally stained with FITC-labeled streptavidin for 25 min. Samples were then acquired
using flow cytometry (FACS).
3.7 Intracellular cytokine staining
For measuring IFN-γ production by CD8+ T cells, intracellular cytokine staining (ICS)
was performed in peptide restimulation assays [93, 95]. Splenocytes (2x106/well) were incubated
with APCs (BMA cells) at a ratio of 1:10 (APCs:responders) in the presence of brefeldin A
(10 mg/ml). The APCs were loaded with one of the following synthetic LCMV peptides:
31
GP33-41 (KAVYNFATC), GP276-286 (SGVENPGGYCL), and NP396-404 (FQPQNGQFI)
[95]. The peptides (purity >90%) were synthesized at CPC Scientific (San Jose, CA).
T lymphocytes were stained with a TRI-COLOR conjugated, rat anti-mouse CD8a, clone 5H1
(Cedarlane Hornby, ON) at 4°C, fixed with 1% paraformaldehyde, before adding
FITC-conjugated anti-IFN-γ antibody (clone XMG1.2) with 0.1% saponin for overnight staining
at 4°C. Data were acquired with FACS (Epics XL-MCL) and analyzed with a live gate on the
CD8+ T cells using the Expo 32 Software package (Beckman Coulter, Miami, FL). In order to
calculate the number of peptide-specific CD8+ T cells in the spleen, we counted total
splenocytes, then made use of the percentage of cells that were double-positive for both IFN-γ
and CD8+ T cells after the live gating in the FSC and SSC panels to calculate the number of
epitope-specific CD8+ T cells. In addition, we also enumerated the absolute number of CD8+
T cells in the spleen by counting total splenocytes and then extrapolating to CD8+ T cells after
the live gating.
3.8 Reverse transcription polymerase chain reaction (RT-PCR)
For in vitro experiments BMDCs (3 × 106 cells per condition) were infected with LCMV
(MOI-1) for either 30 min, 2 hrs, 4 hrs, or 8 hrs following which total RNA was extracted. For in
vivo experiments, TG and WT mice were infected s.c either with a low or a high viral dose.
Day 2 p.i spleens and lungs were harvested, and total RNA was extracted.
To isolate RNA, the pellet of cells (in vitro experiment) or the homogenized tissue (in
vivo experiment) was resuspended in 1 mL of Tri reagent [Sigma-Aldrich, St. Louis, MO] and
left for 5 min. 50 μL of bromoanisole [Sigma Aldrich, Oakville] per 1 ml of Tri reagent was
added, tubes were shaken vigorously for 15 sec, left at room temperature for 5 min, then
32
centrifuged for 15 min, at 4°C and 13,000 rotations per minute (RPM). The upper aqueous phase
containing the RNA was aliquoted into a new 1.5 mL micro tube, mixed with 500 μL of
isopropanol [Sigma Aldrich, Oakville], stored for 10 min at room temperature, and centrifuged
for 8 min, at 4°C and 13,000 RPM. Supernatant was then removed, the pellet was washed in
1 mL of 75% ethanol, and was allowed to air dry for approximately 5 min. The pellet was then
resuspended in 50 μL of nucleus-free water and frozen at -20°C.
The isolated RNA was quantified and was diluted to a concentration of 1 μg/μl to use for
reverse transcription. Once diluted, 10 μL of the RNA was added to a master mix containing
1 μL random primers [Integrated DNA Technologies, Toronto], 1 μL dNTP nucleotide solution
mix [Biolabs, Ipswich, MA], 2 μL 5x M-MLV RT buffer [Promega, Madison, WI], 1 μL RNase
inhibitor [Invitrogen, Burlington], and 4.5 μL of nucleus-free water, all combined in a 200 μL
PCR tube [Axygen, Union City, CA]. The reverse transcriptase enzyme MMULV [Promega,
Madison, WI] was then added at 0.5 μL. The RT reaction was run using the PCR thermal cycler
machine (Thermo Electron Corporation, Milford, MA) with cycling described as follows: Step 1
(25°C for 15 min), Step 2 (42°C for 1 hour), Step 3 (95°C for 5 min). The reverse transcription
step is required to convert the RNA into cDNA.
Once the reverse transcription step was complete, 2 μL of the 10 μg/μl cDNA product (a
total of 20 μg) was added to 0.2 μM primer (all primers purchased from Integrated DNA
Technologies, Coraville, Iowa) and 3 μL of i-Taq 5x master mix (Biolabs, New England) in a
200 μL PCR tube. The primer used was specific for the cytokine or protein of interest. A list of
primers used for these experiments are shown in Table 3. The PCR reaction was run using the
PCR thermal cycler machine, with cycling temperature specific for the cytokine or protein to be
33
Table 3. List of Primers for PCR Reaction.
Primer Name
Forward and Reverse Primer Sequence
IL-1β
5’- CAACCAACAAGTGATATTCTCCATG -3’ (F)
5’- GATCCACACTCTCCAGCTGCA -3’ (R)
IL-6
5’- CCTCTCTGCAAGAGACTTCC -3' (F)
5’- GCACAACTCTTTTCTCATTTCC -3’ (R)
TNF-α
5’- CAGGGGCCACGCTCTTC -3’ (F)
5’- TGACCTCAGCGCTGAGTTGGT -3’ (R)
18S
5’ – AAACGGCTACCACATCCAAG – 3’ (F)
5’ – CCTCCAATGGATCCTCGTTA -3’ (R)
5-LO
5’- CCTCAAGCAGCACAGACGTA -3’ (F)
5’- TTTGGTTGAGCTGGATGGCA -3’ (R)
Specific forward and reverse primers designed for specific cytokines or 5-LO enzyme was used in PCR to
amplify their mRNA sequence. NOTE: *F indicates forward, R indicates reverse primer
34
amplified. The PCR program was run in a series of heating and cooling steps allowing for
denaturation and separation of the cDNA strand, annealing of primers to a single strand of
cDNA, and elongation of the primer strand, in the three steps described as follows: Step 1 (95°C
for 1 min), 40 cycles of Step 2 (i. 96°C for 1 min, ii. melting temperature (specific for each
primer) for 1 min, iii. 72°C for 1 min), and Step 3 (72°C for 10 min).
Intensity of the PCR band in percentage was measured using image j software [98]. For
analysis, the bands were selected and the intensity of one in comparison to another band was
compared. For an example, intensity of bands for TG lung samples were compared to intensity of
bands from WT lung samples.
3.9 Genotyping for transgenic mice
Hemizygous transgene progeny was genotyped by PCR using hCysLT2R specific primers
(forward
primer:
5’-TGCTCCTGGACAGTGGCTCTGAG-3’;
reverse
primer:
5’-GCTCCTTATACTCTTGTTTCCTTTCTCAACC - 3’) on DNA extracted from ear clipping.
For extraction of DNA, ear clippings were incubated with lysis buffer ( 164 ml
ddH2O,
8 ml of
5M NaCl, 4 ml 10% SDS, 2 ml of 0.5 EDTA, 20 ml of 1M Tris HCl), containing proteinase K
(40 mg/ml). To prepare the working lysis buffer, 50 μl of 40 mg/ml proteinase K was added to
10-12 ml of lysis buffer and was used for DNA extraction. Ear clippings were incubated in
300 μl for 60-90 min. at 56-58°C, following which the samples were centrifuged and the
supernatant was transferred into new tubes. Isopropanol was added to the supernatant, and
samples were then centrifuged at 13,000 RPM for 5 min. The supernatant was removed, and the
pellet was led to air dry for a few minutes, following which the pellet was dissolved in 100300 μl of ddH2O and stored at -20°C for genotyping.
35
3.10 Cytokine luminex assay
Cytokine levels in the serum of infected mice were determined using the Bio-Plex mouse
cytokines 23-plex assay (catalog no. 10014905; Bio-Rad, Hercules, CA, USA) according to the
manufacturer's directions.
For the serum collection, mice were injected with low or high viral dose. On day 2 p.i,
blood was collected from cheeks using a 5 mm lancet, in accordance with the guidelines of the
Canadian Council of Animal Care with protocols approved by the Queen’s Animal Care. Once
collected, blood was allowed to clot at room temperature for 45 to 60 min, following which the
samples were centrifuged at 1000 x G for 15 min at 4°C. The serum was then transferred to a
clean polypropylene tube and centrifuged at 10,000 x G for 10 min at 4°C to completely remove
platelets and precipitates, following which samples were stored at -80°C for further experiments.
For the experiment, serum samples were diluted at a ratio of 1:4 (serum: sample diluent),
whereas the standard curve was prepared from the standard mixture provided with the kit. Once
the standard mixture was prepared, a series of fourfold dilutions was carried out to prepare the
standard curve as per manufacturer’s directions. For the experiment 50 µl of diluted samples and
standards were incubated in the 96-well plates with the magnetic beads at room temperature for
30 min while regularly shaking at 850 RPM. After incubation, three washing steps were carried
out using washing buffer, following which samples were incubated with 25 µl detection antibody
for 30 min at room temperature. After incubation with detection antibody, samples were washed
and incubated with 50 µl of streptavidin-PE for 10 min at room temperature while constantly
shaking at 850 RPM. Samples were then washed and 125 µl of assay buffer was added to each
36
well. Samples were measured with the Luminex Bio-Plex 200 system (Bio-Rad) and
subsequently analyzed with Bio-Plex Manager 6.1 software (Bio-Rad)
3.11 Statistical Analysis
Statistical analysis was done using a 1-tailed student’s t-TEST assuming unequal
variance. Statistical analysis is denoted in each Figure using * p≤05, ** p≤0.01 and *** p≤0.001.
37
Chapter 4
Results
4.1 Detection of hCysLT2R gene in transgenic (TG) mice by PCR.
To differentiate between TG and WT progeny mice after breeding WT with TG mice,
PCR was performed on DNA extracted from ear clippings. Once PCR was performed, the DNA
samples were run on a 1.2% agarose gel with 10 μL of 500 μg/mL ethidium bromide, following
which the gel was visualized using a fluorochem HD2 gel imager. The TG mice were defined by
the positive band (532 bp) after PCR tests were performed, whereas WT mice were negative by
the absence of the band on the gel as shown in Figure 9.
4.2 Induction of 5-lipoxygenase mRNA expression in immune cells after infection with
LCMV
To investigate if LCMV infection activates the pathway leading to production of
leukotrienes (LTC4), we measured mRNA expression of 5-LO (the enzyme responsible for
leukotriene synthesis) by running RT-PCR on mRNA extracted from cells infected with LCMV
in vitro and in vivo. During an in vitro infection, DC (3x106/mL) were infected with LCMV with
an MOI-1 for either 30 min, 2 hrs, 4 hrs, or 8 hrs following which total RNA was extracted. RTPCR was performed using the primers specific for 5-LO as described in the methods section.
The data in Figure 10A indicate that uninfected BMDCs did not express 5-LO constitutively in
vitro. After infection with LCMV for 30 min, the expression of 5-LO was up-regulated and was
still detected by 2 hrs, but was down-regulated thereafter. This suggests that infection of DCs
with LCMV results in increased expression of 5-LO, which is a main enzyme responsible for
production of CysLTs.
38
1
2
3
4
5
6
7
8
9
10
11
12
13
Figure 9. Genotyping of mice for hCysLT2R gene expression.
DNA was isolated from mouse ear clippings and PCR was conducted using primers for hCysLT2R gene.
Column 1 contains the DNA ladder; the size of the PCR product was 532 bp. Presence of positive bands
(Colum 4, 7, 11, 13) represent TG mice whereas no bands (2, 3, 5, 6, 8, 9, 10, 12) represent WT mice.
39
A)
0 min
30 min
2 hr
4 hr
8 hr
5-LO
18 S
5-LO
5-LO
18 S
18 S
WT spleen
TG Spleen
WT Lung
High Dose
TG Lung
WT spleen
C)
TG Spleen
WT Lung
Low Dose
TG Lung
B)
Figure 10. Infection with LCMV results in expression of 5-LO in vitro and in vivo infected cells.
For in vitro experiments BMDCs were incubated with LCMV at MOI -1 for a specific time period (10 A)
and total RNA was isolated. For in vivo experiments mice were infected with low or high viral doses and
on day 2 p.i lungs and spleens from mice were harvested for total RNA extraction. RT-PCR was
performed using primers for 5-LO with the product size of 611 bp. A) During an in vitro experiment
LCMV infection resulted in expression of 5-LO 30 min and 2 hrs after infection. B) During a low viral
dose infection, higher expression of 5-LO was recorded in the lungs and spleens of TG mice, C) During a
high viral dose infection lower expression of 5-LO was present in the lungs and spleens of TG mice.
Ribosomal 18S was used as a loading control. This experiment was performed once using one mouse per
condition.
40
During an in vivo experiment, spleen and lungs were collected from TG and WT mice
2 days p.i with a low viral dose (3x104 PFU) or a high viral dose (1x106 PFU). Upon performing
RT-PCR analysis on the isolated RNA, a positive signal for 5-LO was observed in both low and
high viral dose infection. However, with low viral dose infection, a stronger signal appears to be
present in lungs and spleens of TG mice compared to WT mice (Figure 10 B). On the other hand,
during a high viral dose infection a lower signal for 5-LO was detected in TG mice compared to
WT mice (Figure 10 C).
4.3 Induction of pro-inflammatory cytokine gene expression in lungs and spleen of TG mice
To investigate the effects of over-expressing the CysLT2R on pro-inflammatory cytokine
mRNA expression, mice were infected with low or high viral doses s.c. On day 2 p.i total RNA
was extracted from lungs and spleens. RT-PCR was performed on RNA using specific primers
described in material and methods, and 18S was used as a loading control.
Results from the low virus dose infected mice showed stronger mRNA expression for IL-1β and
TNF-α in the lungs and stronger mRNA expression of IL-1β, IL-6 and TNF-α in the spleens of
TG mice compared to WT mice (Figure 11 A), suggesting an increase of pro-inflammatory
cytokines at the mRNA level in TG mice over-expressing the CysLT2R. On the other hand,
during the high viral dose infection, no difference in mRNA signals for IL-1β was detected, but a
stronger signal for IL-6 and a weak signal for TNF-α was present in the lungs of TG mice
(Figure 11 B). In spleens, during a high viral dose experiment, there were no differences in the
mRNA expression of IL-1β or IL-6. However, a lower signal for TNF-α was present in TG mice
(Figure 11 B).
41
B)
A)
D)
Low viral dose
High viral dose
Band intensity of mRNA (%)
C)
Figure 11. Induction of pro-inflammatory cytokine gene expression in lungs and spleens of TG and
WT mice during (A) low and (B) high viral dose infection. Densitometry analyses of the PCR results
are shown in (C) for low dose experiment and (D) for high dose experiment.
Mice were injected with low or high viral dose s.c and on day 2 p.i lungs and spleen were harvested for
total RNA isolation following which RT-PCR for pro-inflammatory cytokines was performed using
specific primers mentioned in material and methods. Ribosomal 18S was used as a loading control. A)
IL-1β, IL-6 and TNF-α mRNA levels in lungs and spleens of TG and WT mice during a low viral dose
infection. B) IL-1β and IL-6 mRNA levels in lungs and spleens of TG and WT mice during a high viral
dose infection. This experiment was performed once using one mouse per condition.
42
The intensity of the PCR bands in percentage was measured using image j software,
shown in Figure 11 C (low viral dose results) and in Figure 11 D (high viral dose results). For
analysis, the bands were selected and their intensity was compared. For an example, intensity of
TG lung samples were compared to intensity of WT lungs, and TG spleen samples were
compared with WT spleen samples.
4.4 Increased pro-inflammatory cytokine levels in the serum of TG mice 2 days post
infection with a low and a high viral dose
To measure the amount of pro-inflammatory cytokines present in serum after infection
with low and high viral doses, blood samples were collected from mice on day 2 p.i and were
analysed using a cytokine luminex assay to quantify the amount of pro-inflammatory cytokines
present in the serum. For the experiment, serum samples were diluted at a 1:4 ratio (serum:
sample diluent) and incubated with magnetic beads followed by detection antibody binding and
finally labelled with streptavidin-PE. Standards were prepared as per the protocol explained in
materials and methods, and the samples were acquired using the Bio-plex 200 system. Values for
each cytokine from the samples were calculated using the standard curve.
During a low viral dose infection, TG mice had increased level of pro-inflammatory
cytokines (IL-1α, IL-1β, IL-6, IL17a and TNF-α) compared to WT mice, as shown in Figure
12A, confirming our low viral dose RT-PCR results (Figure 11 A). Also, during a high viral dose
infection, high levels of pro-inflammatory cytokines (IL-1β, and TNF-α) were present in the
serum of TG mice compared to WT mice. It was also interesting to see a higher level of IL-10
(an anti-inflammatory cytokine) present in the serum of TG mice (Figure 12 B).
43
A) Low dose viral infection
Serum cytokines level (pg/ml)
*
***
**
**
44
B) High viral dose infection
Serum cytokines level (pg/ml)
**
**
**
Figure 12. Levels of IL-1α, IL-1β, IL-6, IL-17α and TNF-α recorded in serum samples of TG and
WT mice during (A) low and (B) high viral dose infection.
Mice were injected with low or high viral doses and on day 2 p.i, serum samples were collected
(according to the method explained in materials and methods), following which a cytokine luminex assay
was performed. Data depicted are mean ±SD from four mice with (*), (**) and (***) indicating statistical
significance with P≤0.05, P≤0.01 and P≤0.001 respectively.
45
These results indicate that increased expression of hCysLT2R results in increased proinflammatory cytokines in the serum of TG mice compared to WT mice during low and high
viral dose infection. However, during a high viral dose experiment an increased antiinflammatory cytokine (IL-10) was present in the serum of TG mice compared to WT mice. No
differences in cytokines levels were recorded in serum of naïve TG mice compared to naïve WT
mice (data not shown).
4.5 T cells from naïve TG mice exhibit a similar phenotype to WT mice
During FACS measurements, a specific gating sequence was used (Figure 13). First, a gate was
made around scattered cells to include only those cells that were alive (13 A). Once a live gate
was made, the scattering pattern was changed to side-scattered on the Y-axis and CD8 on the Xaxis and a gate was made around CD8+ T cells (13 B). The next step in the gating sequence was
to gate around CD8+CD3+ T cells. To do so the cells gated in 13 B were scattered on the Y-axis
with side scattering and on the X-axis with CD3 marker, and CD8+CD3+ T cells were gated (13
C). Now the cells that have been gated and analysed were CD8+CD3+ T cells. The next step was
to gate on cells that were triple-positive, for example, CD8+CD3+CD25+ T cells. To do so, the
double-positive cells were scattered with CD8 marker on the X-axis and a specific marker on the
Y-axis (13 D). A gate was drawn to separate the cells into four sections with the cells that were
triple-positive appearing in the upper right section.
For a naïve experiment, splenocytes collected from naïve TG and WT mice were
analysed to see if the over-expression of CysLT2R causes any effects on the basal phenotype of
CD8+ T cells. For the experiment, naïve mice were sacrificed and spleens were harvested.
46
Specific marker+
CD8+ T cells
CD8+CD3+ T cells
CD8+CD3+ T cells
Figure 13. Gating sequence for CD8+CD3+ specific marker+ T cells.
A gate was made was made around live cells (A) to include only live cells during analysis. Next, the live
cells were differentiated between CD8+ and CD8- T cells and a gate was made around CD8+ T cells (B).
The next step was to analyse the cells positive for both CD8 and CD3 marker and a gate was made around
CD8+CD3+ T cells (C). The last step in the gating sequence was to test CD8+CD3+ T cells positivity for a
specific marker (D).
47
The harvested spleens were processed for the collection of splenocytes as explained in material
and methods. The collected splenocytes were plated in 96-well plates and stained with antibodies
against CD8 (PE-Cy5-conjugated) and CD3 (Alexa fluor 488-conjugated), along with specific
markers (FITC-labelled). The list of markers, their function and expression level on naïve mice
have been explained in Table 1.
From the results presented in Figure 14, there appears to be no effect of over-expression
of CysLT2R on CD8+ T cells in naïve TG mice compared to WT mice. These results indicated
that over-expression of CysLT2R does not cause any changes in the naïve state of CD8+ T cells
in TG mice when compared to WT mice.
4.6 Analysis of CD8+ T cell activation in spleen and lungs of TG mice after low dose viral
infection
Inflammation has been shown to play a role in activation and contraction phase of CD8+
T cells during virus infection [70]. The mice used in my study have been shown to have
increased pro-inflammatory cytokine levels (section 4.4). Hence, the aim of the experiment was
to analyse the effects of inflammation on phenotype and function of CD8+ T cells in spleen and
lung of mice on day 8 and day 12 p.i, infected with a low viral dose.
48
% of CD8+CD3+ T cells positive for specific marker
Figure 14. Overexpression of CysLT2R has no effect on the phenotype of CD8+ T cells in naïve TG
mice.
Splenocytes were collected from non-infected mice (naïve mice) and cells plated in 96-well plates at a
concentration of 2x106 cells per well. Each well was stained for CD8+CD3+ and a specific marker as
explained in the material and methods. Data depicted are mean ±SD from four mice. Data is
representative of one experiment from a total of three independent trials.
49
4.6.1 Increased inflammation has no effect on the number of CD8+ T cells in spleens of TG
mice
On day 8 and 12 p.i with low viral dose, spleen and lungs were harvested and processed
as explained in the methods section. Once processed, the cells were analysed for the number of
CD8+ T cells. Using the percentage of CD8+ T cells and total number of splenocytes, the number
of CD8+ T cell was recorded. No significant differences in the number of CD8+ T cells were
recorded on day 8 and day 12 p.i, in the spleen of TG mice compared to WT mice after low viral
dose infection (Figure 15 A and B).
4.6.2 Increased inflammation results in higher effector phenotype on CD8+ T cells in spleen
of TG mice on day 12 post infection with a low viral dose
To investigate the impact of increased inflammation on specific marker expression during
a low viral dose infection, spleens were collected from TG and WT mice on day 8 and day 12 p.i
and analysed for expression of specific surface markers on CD8+ T cells. No differences between
TG and WT mice were recorded on day 8 p.i, (Figure 16). However, on day 12 p.i, lower
expression of CD62L and higher expression of killer cell lectin-like receptor G1 (KLRG1) were
found on CD8+ T cells from TG mice compared to WT mice (Figure 17 A and B). CD62L is a
marker which plays a role in homing of CD8+ T cells to lymph nodes. Its expression is higher on
cells in naïve mice and is down-regulated on effector T cells. KLRG1 on the other hand, is a
marker expressed on NK cells. It is not expressed on naïve CD8+ T cells, but the expression of
KLRG1 is up-regulated on effector T cells after being presented with an antigen. The lower
expression of CD62L and higher expression of KLRG1 suggest an increased effector phenotype
of splenic CD8+ T cells in TG mice compared to WT mice on day 12 p.i.
50
No. of CD8+ T cells in spleen (106)
A)
Day 8
No. of CD8+ T cells in spleen (106)
B)
Day 12
Figure 15. Increased inflammation has no effect on the number of CD8+ T cells measured in spleens
of TG mice on day 8 (A) and day 12 (B) post infection with low viral dose.
Mice were infected with low viral dose and on day 8 (15 A) and day 12 p.i (15 B), spleens were harvested
and the total number of CD8+ T cells was recorded. Data depicted are mean ±SD from four mice. Data is
representative of one experiment from a total of three independent trials.
51
% CD8+CD3+ T cells positive for specific marker
Figure 16. No difference in effector phenotype of CD8+ T cells in spleens of TG mice compared to
WT mice on day 8 post infection with low viral dose.
Mice were infected s.c with low viral dose and on day 8 p.i, spleens were harvested and splenocytes were
stained for CD8+CD3+ and specific markers as explained in the materials and methods. Data depicted are
mean ±SD from four mice. Data are representative of one experiment from a total of three independent
trials.
52
TG
WT
A)
26.6
17.2
CD62L
82.8
73.4
43.7
50.1
KLRG1
49.9
56.3
B)
% CD8+CD3+ T cells positive for specific marker
CD8
Low dose
Figure 17. Increased inflammation during a low viral dose infection decreases the expression of
CD62L and increases KLRG1 on CD8+ T cells in spleens of TG mice on day 12 post infection.
Mice were injected with low viral dose. On day 12 p.i, splenocytes collected from harvested spleens were
stained for CD8+CD3+ T cells positive for expression of specific markers. Data depicted are mean ±SD
from four mice. (**) and (***) indicate statistical significance with p≤0.01 and P≤0.001, respectively.
Data are representative of one experiment from 3 independent trials.
53
4.6.3 Increased CD8+ T cell accumulation in the lungs of TG mice on day 12 post infection
during a low dose viral infection.
Effector CD8+ T cells can accumulate for a longer time in peripheral organs such as lungs
[60]. The overexpression of CysLT2R in TG mice occurs on endothelial cells leading to a
stronger band for CysLT2R recorded in the lungs of TG mice [17]. Therefore, the aim of this
experiment was to investigate the effect of increased localised inflammation on localisation of
CD8+ T cells in peripheral tissues (i.e. lungs), where a higher surface area is over-expressing the
receptor. It was interesting to see that there was no difference in the number of CD8+ T cell in
the lungs of TG mice on day 8 p.i (Figure 18 A). However, by day 12, higher numbers of CD8+
T cells were accumulated in the lungs of TG mice (Figure 18 B). This correlates with a higher
number of CD8+ T cells expressing the effector phenotype in the lungs of TG mice compared to
WT mice on day 12 p.i as shown in Figure 18 C.
4.7 Analysis of CD8+ T cell activation in spleens and lungs of TG mice after high dose viral
infection
The aim of these experiments was to analyse the effects of increased inflammatory
conditions on phenotype and function of CD8+ T cells in spleens and lungs on day 8 and day 12
p.i with a high viral dose.
54
A)
WT
B)
No. of CD8+ T cells in lungs (105)
No. of CD8+ T cells in lungs (105)
TG
Day 12 Low dose
lungs (105)
No. of CD8+CD3+ T cells positive for specific marker in
C)
Figure 18. Increased accumulation of CD8+ T cells and higher numbers of effector CD8+ T cells in
peripheral organs (lungs) on day 12 post infection during a low viral dose infection.
Mice were injected s.c with low viral dose. On day 8 and day 12 p.i lungs were harvested and were
processed according to the protocol explained in materials and methods. Cells collected from lungs were
stained for CD8+CD3+ and specific markers. Data depicted are mean ±SD from four mice. (*) and (**)
indicate statistical significance with p≤0.05 and P≤0.01, respectively. Data are representative of one
experiment from a total of three independent trials.
55
4.7.1 Increased inflammation has no effect on the number of CD8+ T cells in the spleen of
TG mice
After infection with a high viral dose, spleens and lungs were harvested on day 8 and day
12 p.i and cells were analysed for the number of CD8+ T cells. The number of CD8+ T cell was
measured using the percentage of CD8+ T cells and total number of cells counted. No differences
in the number of CD8+ T cells were recorded on day 8 and day 12 in the spleens of TG mice
compared to WT mice after high viral dose infection (Figure 19 A and B).
4.7.2 Decrease in expression of CD127 on CD8+ T cells in spleens of TG mice during high
viral dose infection on day 8 and day 12 post infection
To investigate if a high viral dose infection during an increased inflammation has similar
effects on expression of specific markers as recorded during a low viral dose infection, mice
were infected s.c with a high viral dose. Spleens were collected from mice on day 8 and day 12
p.i and analysed for expression of specific surface markers on CD8+ T cells. The expression of
CD127, which plays a key role in the survival and proliferation during early stages of T cell
development [25, 26], was decreased on CD8+ T cells from spleens of TG mice on day 8 p.i
(Figure 20 A and B) and day 12 p.i (Figure 21 A and B) compared to WT mice. These results
indicate that increased inflammation during a high viral dose infection may reduce the number of
cells capable of producing memory CD8+ T cells in TG mice compared to WT mice.
56
No. of CD8+ T cells in spleen (107)
A)
Day 8
No. of CD8+ T cells in spleen (106)
B)
Day 12
Figure 19. Overexpression of CysLT2R has no effect on the number of CD8+ T cells recorded in TG
mice on day 8 and day 12 post infection with high viral dose.
Mice were infected with a high viral dose, and on day 8 and day 12 p.i splenocytes collected from
harvested spleens were stained to record the number of CD8+ T cells. Data are representative of one
experiment from a total of three independent trials.
57
WT
TG
CD127
A)
B)
% CD8+CD3+ T cells positive for specific marker
CD8
Figure 20. Decreased expression of CD127 on CD8+ T cells in spleens of TG mice on day 8 post
infection with high viral dose.
Mice were injected s.c with a high viral dose. On day 8 post infection splenocytes isolated from harvested
cells were stained for CD8+CD3+ and specific markers as explained in the material and methods. Data
depicted are mean ±SD from four mice. (***) indicates statistical significance with P≤0.001. Data are
representative of one experiment from a total of three independent trials.
58
WT
TG
CD127
A)
B)
% CD8+CD3+T cells positive for specific marker
CD8
Day 12: High viral dose
Figure 21. Decreased expression of CD127 on CD8+ T cells in spleens of TG mice on day 12 post
infection with high viral dose.
Mice were infected with a high viral dose. On day 12 p.i splenocytes isolated from harvested spleens were
stained with CD8+CD3+ and specific markers as explained in the materials and methods. Data depicted
are mean ±SD from four mice. (***) indicates statistical significance with P≤0.001. Data are
representative of one experiment from a total of three independent trials.
59
4.7.3 Increased CD8+ T cell accumulation in lungs of TG mice on day 12 post infection
Effector CD8+ T cells can accumulate for longer time in peripheral organs such as lungs
[60]. The expression of hCysLT2R is specific to endothelial cells. Since lungs have a large
surface area covered with endothelial cells the overexpression of CysLT2R is particularly high in
lungs. Therefore, the aim of this experiment was to investigate the effect of increased localised
inflammation due to overexpression of CysLT2R in the localisation of CD8+ T cell in peripheral
tissues such as lungs.
It was interesting to see that there was no difference in the number of CD8+ T cells in the
lungs of TG or WT mice on day 8 p.i (Figure 22 A) with high viral dose infection. However, by
day 12 p.i a higher number of CD8+ T cells had accumulated in the lungs of TG mice
(Figure 22 B). This also meant that higher numbers of CD8+ T cells expressing the effector
phenotype were present in the lungs of TG mice on day 12 p.i (Figure 22 C).
4.8 Increased inflammation has no effect on activation of CD8+ T cells in spleens of TG
mice on day 8 or day 12 post infection with a low or a high viral dose
To assess if T cell activation differs in TG mice after viral infection, CD8+ T cell
functional activities were analysed using ICS to measure IFN-γ production after restimulation of
effector CD8+ T cells with a macrophage cell line (BMA). TG and WT mice were injected s.c
with low or high viral doses. On day 12 p.i, splenocytes were collected and re-stimulated with
LCMV-specific peptide-pulsed BMA cells. The cells were surface-stained with CD8 and stained
for IFN-γ using ICS, to identify and analyse the number of activated CD8+ T cells specific for
the LCMV peptides (NP369, GP33 and GP276).
60
B)
No. of CD8+ T cells in lungs (105)
No. of CD8+ T cells in lungs (105)
A)
C)
No. of CD8+CD3+ T cells positive for specific marker in lungs (105)
Day 8
Day 12
Day 12 High dose
Figure 22. Accumulation of effector CD8+ T cells in peripheral tissue (lungs) on day 12 post
infection during a high viral dose infection.
After infection with high viral dose lungs from infected mice were collected on day 8 and day 12 and
processed according to the protocol explained in materials and methods. Cells were stained for
CD8+CD3+ and specific markers as explained in materials and methods. Data depicted are mean ±SD
from four mice. (**) indicates statistical significance with P≤0.01. Data are representative of one
experiment from a total of three independent trials.
61
From the acquired data, no difference in the functional assay was detected in spleens of TG mice
on day 12 p.i during a low viral dose infection (Figure 23 A) or high viral dose infection (Figure
23 B). Only the results from day 12 p.i are shown. However, similar results were recorded for
day 8 p.i experiments with a low or a high virus dose experiment.
4.9 Increased inflammation results in stronger activation of CD8+ T cells in lungs of TG
mice on day 12 post infection with low and high viral doses
CD8+ T cell activation was tested as before using ICS to measure IFN-γ production after
restimulation of the effector CD8+ T cells. In this experiment, increased numbers of CD8+ T cell
specific for peptides were recorded in the lungs of TG mice on day 12 p.i with a low viral dose
(Figure 24 A) and a high viral dose (Figure 24 B). No differences were recorded in the lungs on
day 8 p.i either with a low or a high viral dose (data not shown).
4.10 Detection of virus particles in spleens and lungs of TG mice after infection with a low
or a high viral dose
Spleens and lungs were collected from mice on day 4 after infection with low or high
viral doses. Once collected, spleens and lungs were homogenised and centrifuged following
which the supernatant was collected and stored to perform the virus titration as explained in
methods and materials. A positive control (virus with known titer) was used to make the standard
curve using Prism 5.0 software, and the unknown samples were analysed according to the
protocol explained by Johnson and Homann [94]. Results from the performed experiments
showed that TG mice had low levels of virus present in lungs and spleens on day 4 after infection
with low viral dose (Table 4 A).
62
Day 12 low viral dose
6
No. of activated T cells in spleen (10 )
A)
Day 12 high viral dose
6
No. of activated T cells in spleen (10 )
B)
Figure 23. Function of CD8+ T cells is not affected in spleens of TG mice on day 12 post infection
with either a low viral dose (A) or a high viral dose (B).
TG and WT mice were injected s.c with a low or a high viral dose. On day 12 p.i splenocytes were
collected and ICS was conducted according to the protocol explained in materials and methods. Data
depicted are mean ±SD from four mice. Data are representative of one experiment from a total of three
independent trials. Similar results were recorded on day 8 with either of the viral doses (data not shown).
63
No. of activated T cells in lungs (104)
A)
B)
No. of activated T cells in lungs (104)
Day 12 high viral dose
Figure 24. Increased numbers of functional CD8+ T cells specific for each peptide on day 12 post
infection with (A) low or (B) high viral dose.
Mice were injected s.c with a low or a high viral dose. On day 12 p.i, lung cells were collected and
intracellular staining for IFN-γ was performed according to the protocol. Data depicted are mean ±SD
from four mice. (*) and (***) indicate statistical significance with P≤0.05 and P≤0.001, respectively. Data
are representative of one experiment from a total of two independent trials. No differences were recorded
on day 8 with either of the viral doses (data not shown).
64
Table 4. Virus titer in spleens and lungs collected on day 4 after infection with A) Low viral dose;
B) High viral dose
Data depicted are mean ±SD from four mice where (*), (**) and (***) indicate statistical significance
with P≤0.05, P≤0.01 and P≤0.001 respectively.
65
On the other hand, during a high viral dose experiment, no difference in virus level between TG
and WT mice was noticed in the spleens, but lower virus titers were recorded in lungs of TG
mice compared to WT mice (Table 4 B).
4.11 Analysing the effects of increased inflammation on memory CD8+T cell formation in
TG mice, after low viral dose infection
Central memory T cells can be differentiated from effector memory T cells by measuring
the expression of CD62L and CD44 surface markers on memory T cells, where central memory
T cells have higher expression of CD62L and CD44, and effector memory T cells have higher
expression of CD44 and lower expression of CD62L [99].
The aim of this experiment was to determine the effect of increased inflammation on
memory CD8+ T cell formation during a low dose viral infection. Mice were infected s.c. On day
40 p.i, spleens and lungs were harvested and analysed to measure the central and effector
memory CD8+ T cells in TG and WT mice. To differentiate between central and effector
memory CD8+ T cells, cells were stained with CD8, CD62L and CD44 and, once stained;
samples were acquired using FACS. When analysed, no differences in central memory CD8+
T cells or effector memory CD8+ T cells were recorded in the spleens of TG mice compared to
WT mice (Figure 25 A). This result suggested that increased inflammation during a low viral
dose infection has no effect on formation of either the central memory or effector memory
T cells in the spleens of TG mice compared to WT mice. However, when lungs were analysed,
higher numbers of central memory CD8+ T cells and lower numbers of effector memory CD8+
T cells were accumulated in the lungs of TG mice compared to WT mice (Figure 25 B).
66
No. of memory T cells (105)
No. of memory T cells (105)
A) Spleen
+
+
+
+
Central memory CD8 T cells (CD8 CD62L CD44 )
+
+
-
+
+
+
-
+
Effector memory CD8 T cells (CD8 CD62L CD44 )
B) Lungs
WT
No. of memory T cells (103)
No. of memory T cells (103)
TG
+
+
+
+
Central memory CD8 T cells (CD8 CD62L CD44 )
Effector memory CD8 T cells (CD8 CD62L CD44 )
Figure 25. Higher number of central memory CD8+ T cells and low number of effector memory
CD8+T cells in the lungs of TG mice after low viral dose infection (A). No difference in memory
T cells in spleens of TG mice (B).
Mice were injected s.c with low viral dose and on day 40 p.i, spleens and lungs were harvested and
processed to collect the total number of cells from spleens and lungs. Once collected, cells were stained
with CD8, CD44 and CD62L to differentiate between central memory T cells (CD8+CD62L+CD44+) or
effector memory T cells (CD8+CD62L-CD44+) as explained in materials and methods. Data depicted are
mean ±SD from four mice where (*) and (***) indicate statistical significance with P≤0.05 and P≤0.001,
respectively. Data are representative of one experiment from a total of two independent trials.
67
Overall the results from the experiments suggest that increased inflammation during a low viral
dose infection has no effect on central or effector memory T cell formation in the spleen, but
causes an increased central memory T cell accumulation in peripheral tissue (lungs).
4.12 Analysing the effects of increased inflammation on memory CD8+ T cell formation in
TG mice after infection with a high viral dose
To determine the effect of increased inflammation on memory CD8+ T cell formation
during a high dose viral infection, mice were infected s.c. On day 40 p.i, spleens and lungs were
harvested and analysed to measure the central and effector memory CD8+ T cells in TG and WT
mice. To differentiate between central and effector memory CD8+ T cells, cells were stained with
CD8, CD62L and CD44 and, once stained; samples were acquired using FACS. When analysed,
lower numbers of central memory CD8+ T cells and higher numbers of effector memory CD8+
T cell were recorded in the spleens of TG mice compared to WT mice (Figure 26 A). However,
higher numbers of central memory CD8+ T cells and lower numbers of effector memory CD8+
T cells were accumulated in the lungs of TG mice compared to WT mice (Figure 26 B).
Overall, the results from the experiment suggest that increased inflammation during a
high viral dose infection reduces the central memory CD8+ T cells in the spleens of TG mice, but
increases the accumulation of central memory T cells in peripheral tissue (lungs). These results
also suggest that a stronger immune response increases the accumulation of central memory
T cells in peripheral tissue (lungs) irrespective of the viral dose as similar results were measured
in lungs during both a low and a high viral dose experiment.
68
No. of memory T cells (105)
No. of memory T cells (105)
A) Spleen
+
+
+
+
+
Central memory CD8 T cells (CD8 CD62L CD44 )
+
-
+
Effector memory CD8 T cells (CD8 CD62L CD44 )
No. of memory T cells (103)
No. of memory T cells (103)
B) Lungs
+
+
+
+
Central memory CD8 T cells (CD8 CD62L CD44 )
+
+
-
+
Effector memory CD8 T cells (CD8 CD62L CD44 )
Figure 26. Numbers of central and effector memory CD8+ T cells in (A) spleens and (B) lungs of TG
and WT mice during high viral dose infection.
Mice were injected s.c with a high viral dose. On day 40 p.i spleens and lungs were harvested and
processed to collect the total number of cells from spleens and lungs. Once collected, cells were stained
with CD8, CD44 and CD62L to differentiate between central memory T cells (CD8+CD62L+CD44+) or
effector memory T cells (CD8+CD62L-CD44+). Data depicted are mean ±SD from four mice where (*),
(**) and (***) indicate statistical significance with P≤0.05, P≤0.01 and P≤0.001, respectively. Data are
representative of one experiment from a total of two independent trials.
69
Chapter 5
Discussion
Inflammation has been shown to play a vital role in activation, proliferation and differentiation
of naïve CD8+ T cells during a viral infection [8, 13, 49-51]. On the other hand, leukotrienes
have been found to play a vital role in inflammatory responses by regulating vascular
permeability and by regulating chemokine and cytokine production through induction of NF-κB,
AP-1, and PKC transcription factors [15, 17, 72, 92]. Therefore, we investigated the effect of an
increased inflammatory environment, achieved by overexpression of hCysLT2R on endothelial
cells in mice, on the antiviral CD8+ T cell response following LCMV infection with different
viral doses.
5.1 Up-regulation of 5-lipoxygenase mRNA expression and inflammatory cytokines after
LCMV infection
Since CysLTs production requires enzymatic activity of 5-LO [64, 73], it was important
to examine if infection with LCMV results in induction of 5-LO genes. To achieve this goal an in
vitro experiment was performed, where DCs were infected with LCMV and gene expression was
tested. In non-infected cells, we failed to detect any signal for 5-LO mRNA. After 30 min of
infection with LCMV, there was an upregulation of 5-LO, which was noticeable for another
2 hrs. However, by 4 hrs the mRNA expression of 5-LO was not detectable anymore. We then
extended our findings to in vivo experiments, where we tested mRNA expression of 5-LO in
lungs and spleens of TG and WT mice on day 2 p.i. We confirmed that LCMV infection induces
70
5-LO gene expression in vivo. It was also interesting to detect strong mRNA expression of 5-LO
in lungs and spleen of TG mice after low viral dose infection compared with the high viral dose
experiments. This difference was probably due to a downregulation of the inflammatory
response after a high viral dose infection. TG mice possess an increased inflammatory response
[92]. Thus, a high viral dose will elicit a stronger inflammatory response in TG mice, causing a
robust secretion of 5-LO at the earlier time point which needs to be downregulated to avoid
tissue damage. Nevertheless, the experiments are the first to show that LCMV infection can
induce expression of 5-LO.
Next, we wanted to confirm that TG mice exhibit an increased inflammatory response
compared to WT mice. It has been shown that leukotrienes contribute to vascular permeability
[17, 100], as well as in induction of Egr-1 [101], production of IL-8 (a chemokine that plays a
role in the attraction of various immune cells to the site of infection) [85], and also in production
of TNF-α and macrophage inflammatory protein (MIP)-1β from human mast cells (hMCs) as
well as other pro-inflammatory cytokines [82, 102, 103]. In order to measure the effect of overexpression of CysLT2R on the secretion of pro-inflammatory cytokines, RT-PCR and luminex
assays were performed. To conduct RT-PCR for pro-inflammatory cytokines, mice were infected
with either low or high viral doses, following which lungs and spleen were collected on day 2 p.i.
mRNA expression levels were tested for important pro-inflammatory cytokines such as IL-1β
[69, 104], IL-6 [105], and TNF-α [106] after a low viral dose infection. As expected, their levels
of expression were increased in the lungs and spleens of TG mice, suggesting increased
inflammation in TG mice compared to WT mice.
71
On the other hand, during a high viral dose experiment, lower mRNA expression levels
of TNF-α were recorded in the spleens and lungs of TG mice, whereas a higher expression of
Il-1β mRNA was seen in the lungs of TG mice. No such differences were recorded in the spleens
of TG mice in comparison to WT mice, suggesting that similar levels of inflammation occur in
the two mice strains after infection with high viral doses.
To confirm the RT-PCR results, mice were infected with a low or a high viral dose, blood
samples were collected on day 2 p.i and were processed to collect the serum so that cytokine
luminex assay could be performed. In the low viral dose experiments, higher level of IL-1β, IL-6
and TNF-α were recorded in the serum of TG mice, confirming the low viral dose RT-PCR
results. Also, a higher expression of other pro-inflammatory cytokines such as IL-1α and IL-17
was recorded in the serum of TG mice during the low viral dose experiment. In a high viral dose
cytokine luminex assay, higher levels of IL-1β, and TNF-α were recorded in the serum of TG
mice suggesting an increased inflammatory condition in TG mice after infection with a high viral
dose. However, a higher expression of IL-10 was also recorded in the TG mice during a high
viral dose experiment which indicates that high virus load may result in excessive inflammation,
causing quicker expression of the anti-inflammatory cytokine IL-10 [107]. It is also interesting
that IL-10 has been shown to downregulate the expression of leukotriene receptors [108], which
would result in a negative feedback causing a reduction of leukotriene production. This could
explain our low 5-LO mRNA expression during the high viral dose experiments. Also, IL-10
inhibits TNF-α secretion [107], confirming the result of the RT-PCR, where low mRNA
expression levels were recorded in TG mice. Thus, the data indicate that infection with LCMV
results in up-regulation of 5-LO mRNA expression. Also, overexpressing the hCysLT2R in TG
72
mice resulted in increased inflammatory after LCMV infection with a low and high viral dose,
confirming the role of CysLT2R in the regulation of inflammatory cytokines.
5.2 The virus dose influences how inflammation regulates CD8+ T cells
The involvement of inflammatory cytokines in activating pAPCs and thus affecting T cell
responses has been well established. IL-12 and type I interferon (IFNα/β) have also been proven
to play a vital role for optimal effector cell accumulation and are important in supporting
memory formation [13, 46, 52, 109]. Furthermore, early inflammation plays a role in the
contraction phase, which can be affected by reduced inflammation [70]. We examined the effect
of the increased inflammation present in TG mice on CD8+ T cell activation and their function
after infection with either a low or a high viral dose.
Functional assays showed no differences in the number of splenic CD8+ T between TG
and WT mice on day 8 or 12 p.i after a low or a high viral dose. No differences in the expression
of surface markers on day 8 p.i with a low viral dose were recorded. However, for TG mice,
lower CD62L and higher KLRG1 expression levels were recorded for splenic CD8+ T cells on
day 12 p.i, indicating the presence of a higher number of SLECs during a low viral dose [110,
111]. On the other hand, during a high viral dose experiment, no such differences were observed.
Rather, a lower expression of CD127 was recorded on splenic CD8+ T cells from TG mice on
day 8 and day 12 p.i. These results indicate that increased inflammation during a low viral dose
results in an increased number of SLECs, whereas the same increased inflammatory conditions
with a high viral dose infection may affect the capability of memory T cell formation. These
73
results also correlate with our virus titer results where a lower virus amount was recorded in
spleens of TG mice compared to WT mice during a low viral dose experiment. However, no
differences in virus titer in the spleens were recorded during a high viral dose experiment. This is
in line with our high viral dose infection phenotype results, where no increased function
phenotype for CD8+ T cell was recorded in spleens; however, reduced CD127 expression was
present, which may affect the capability of memory T cell formation.
For the activation assay in which peptide-specific IFN-γ+ T cells were measured no
differences between TG mice and WT mice were recorded during a low or a high viral dose
infection. However, it was interesting to notice an increased accumulation of effector CD8+
T cells in peripheral organs (i.e. lungs) of TG mice on day 12 p.i with a low or a high viral dose.
It has been shown before that migration of T cells into lungs is up-regulated after viral infection.
Moreover, the lungs have been reported to be the major site where localization of
effector/memory CD8+ T cells occurs after viral infection [60, 63]. Our results show that after
increased inflammation in TG mice, higher numbers of effector CD8+ T cells were localized in
the lungs of TG mice after a low or a high viral dose. These results suggest that localization of
effector T cells can increase in peripheral tissue with increased localized inflammation
irrespective of the viral dose.
The conditioning for expansion, contraction, acquisition of effector function, and the
development of long-lived memory CD8+ T cells occurs during the first few days of an acute
infection [1, 23, 112, 113]. The presence of constant inflammation during chronic infection
results in impaired development of memory CD8+ T cells.[114, 115]. However, our experiments
74
which involved increased inflammation during an acute infection, indicate an increased central
memory CD8+ T cell accumulation in the peripheral tissue (lungs) of TG mice irrespective of the
viral dose. We also recorded a lower effector memory T cell accumulation in the lungs of TG
mice during a low and a high viral dose experiment. Effector memory T cells act as a first line of
defense, whereas central memory T cells act as second line of defense during a secondary
infection [116]. Our results indicate that TG mice may have a weaker first line response in lungs,
but a stronger immune response during a secondary viral infection, since a higher number of
central memory CD8+ T cells is present in the lungs of these mice.
Our results also indicate that the effect of increased inflammation on memory CD8+
T cell formation in lymphoid tissue (spleen) also depends on the viral dose. Even though an
increased inflammation during a low viral dose infection had no effect on splenic central or
effector memory CD8+ T cell formation, a high viral dose with increased inflammatory
conditions resulted in decreased central memory CD8+ T cells and increased effector memory
CD8+ T cell formation in the spleen of TG mice.
These results suggest that increased inflammation may provide higher accumulation of
memory T cells in peripheral tissue irrespective of the viral dose. However, an increased
inflammation during a high viral dose infection has a negative effect on central memory
formation. In conclusion, our work indicates that increased inflammation during a low viral dose
infection may provide a better effector response in lymphoid tissues (spleen), but has no effect
on memory CD8+ T cell formation. Furthermore, a high viral dose infection with increased
inflammation results in decreased memory formation in the lymphoid tissues (spleen), but has no
75
effect on effector CD8+ T cell formation. This study also points out the role of inflammation in
localisation of effector and memory T cells in peripheral tissues (lungs). Amplified localised
inflammation in lungs of TG mice due to overexpression of hCysLT2R resulted in an increased
accumulation of effector and memory T cells in the lungs irrespective of viral dose
5.3 Conclusions and future work
Overall, the data from in vitro and in vivo experiments conducted during my research
conclude that infection with LCMV results in up-regulation of 5-LO, which is important for
secretion of CysLTs. Also, experiments performed with TG mice over-expressing the hCysLT2R
showed increased inflammation during low and high viral dose infection compared to WT.
It appears that increased inflammation provides a better effector response during
infection with a low viral dose, but has a negative effect on CD8+ T cell memory formation in
lymphoid tissues (spleen) during infection with high viral doses. With regard to peripheral tissue
(lungs), we found increased accumulation of effector CD8+ T cells irrespective of the viral dose.
The memory formation experiments conducted also showed that increased inflammation
leads to accumulation of a higher number of central memory T cells in peripheral tissues (lungs).
These results indicate that having an increased inflammatory response can be beneficial in
immune responses depending on the viral dose. This information might be beneficial in vaccine
design, where manipulating the inflammatory response after vaccination may be beneficial in
memory T cell formation depending on the nature of the vaccine.
76
Future studies should examine the antiviral CD8+ T cell response during a secondary
infection and evaluate if increased inflammatory conditions elicit a stronger immune response
after secondary infections. Also, it has been shown that cross-priming of defined antigenic
entities can significantly influence immunodominance hierarchies during subsequent pathogen
encounters [93]. Thus, cross-priming combined with manipulating inflammation could
potentially be used in immunotherapy or for vaccine design, where specific immunodominant
patterns of T cell responses are sought to control viral infections [93].
77
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Williams, M.A. and M.J. Bevan, Effector and Memory CTL Differentiation. Annu Rev Immunol,
2007. 25: p. 171-92.
Zhou, S., et al., Differential tissue-specific regulation of antiviral CD8+ T-cell immune responses
during chronic viral infection. J Virol, 2004. 78(7): p. 3578-600.
Clegg, J.C., Molecular phylogeny of the arenaviruses. Curr Top Microbiol Immunol, 2002. 262:
p. 1-24.
Borrow, P., Mechanisms of viral clearance and persistence. J Viral Hepat, 1997. 4 Suppl 2: p. 1624.
Laposova, K., S. Pastorekova, and J. Tomaskova, Lymphocytic choriomeningitis virus: invisible
but not innocent. Acta Virol, 2013. 57(2): p. 160-70.
Nicholson, M.W., et al., Affinity and kinetic analysis of L-selectin (CD62L) binding to
glycosylation-dependent cell-adhesion molecule-1. J Biol Chem, 1998. 273(2): p. 763-70.
Oehen, S. and K. Brduscha-Riem, Differentiation of naive CTL to effector and memory CTL:
correlation of effector function with phenotype and cell division. J Immunol, 1998. 161(10): p.
5338-46.
Haring, J.S., V.P. Badovinac, and J.T. Harty, Inflaming the CD8+ T cell response. Immunity,
2006. 25(1): p. 19-29.
Joshi, N.S. and S.M. Kaech, Effector CD8 T cell development: a balancing act between memory
cell potential and terminal differentiation. J Immunol, 2008. 180(3): p. 1309-15.
Barber, G.N., Host defense, viruses and apoptosis. Cell Death Differ, 2001. 8(2): p. 113-26.
Elmore, S., Apoptosis: a review of programmed cell death. Toxicol Pathol, 2007. 35(4): p. 495516.
Cui, W., et al., Effects of Signal 3 during CD8 T cell priming: Bystander production of IL-12
enhances effector T cell expansion but promotes terminal differentiation. Vaccine, 2009. 27(15):
p. 2177-87.
Curtsinger, J.M. and M.F. Mescher, Inflammatory cytokines as a third signal for T cell activation.
Curr Opin Immunol, 2010. 22(3): p. 333-40.
Kim, M.T. and J.T. Harty, Impact of Inflammatory Cytokines on Effector and Memory CD8+ T
Cells. Front Immunol, 2014. 5: p. 295.
Newton, K. and V.M. Dixit, Signaling in innate immunity and inflammation. Cold Spring Harb
Perspect Biol, 2012. 4(3).
Funk, C.D., Prostaglandins and leukotrienes: advances in eicosanoid biology, in Science2001:
United States. p. 1871-5.
Hui, Y., et al., Directed vascular expression of human cysteinyl leukotriene 2 receptor modulates
endothelial permeability and systemic blood pressure. Circulation, 2004. 110(21): p. 3360-6.
Hui, Y. and C.D. Funk, Cysteinyl leukotriene receptors. Biochem Pharmacol, 2002. 64(11): p.
1549-57.
Singh, R.K., et al., Cysteinyl leukotrienes and their receptors: molecular and functional
characteristics. Pharmacology, 2010. 85(6): p. 336-49.
Hoffmann, E., et al., Multiple control of interleukin-8 gene expression. J Leukoc Biol, 2002.
72(5): p. 847-55.
Sprent, J. and C.D. Surh, T cell memory. Annu Rev Immunol, 2002. 20: p. 551-79.
Butz, E.A. and M.J. Bevan, Massive expansion of antigen-specific CD8+ T cells during an acute
virus infection. Immunity, 1998. 8(2): p. 167-75.
78
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
Prlic, M., G. Hernandez-Hoyos, and M.J. Bevan, Duration of the initial TCR stimulus controls
the magnitude but not functionality of the CD8+ T cell response. J Exp Med, 2006.
Bachmann, M.F., et al., Functional properties and lineage relationship of CD8+ T cell subsets
identified by expression of IL-7 receptor alpha and CD62L. J Immunol, 2005. 175(7): p. 4686-96.
Goldrath, A.W., et al., Cytokine requirements for acute and Basal homeostatic proliferation of
naive and memory CD8+ T cells. J Exp Med, 2002. 195(12): p. 1515-22.
Huster, K.M., et al., Selective expression of IL-7 receptor on memory T cells identifies early
CD40L-dependent generation of distinct CD8+ memory T cell subsets. Proc Natl Acad Sci U S
A, 2004. 101(15): p. 5610-5.
Kalia, V., et al., Prolonged interleukin-2Ralpha expression on virus-specific CD8+ T cells favors
terminal-effector differentiation in vivo. Immunity, 2010. 32(1): p. 91-103.
Simms, P.E. and T.M. Ellis, Utility of flow cytometric detection of CD69 expression as a rapid
method for determining poly- and oligoclonal lymphocyte activation. Clin Diagn Lab Immunol,
1996. 3(3): p. 301-4.
Pure, E. and C.A. Cuff, A crucial role for CD44 in inflammation. Trends Mol Med, 2001. 7(5): p.
213-21.
Henson, S.M. and A.N. Akbar, KLRG1--more than a marker for T cell senescence. Age (Dordr),
2009. 31(4): p. 285-91.
Hanninen, A., et al., Ly6C supports preferential homing of central memory CD8+ T cells into
lymph nodes. Eur J Immunol, 2011. 41(3): p. 634-44.
Pipkin, M.E., et al., Interleukin-2 and inflammation induce distinct transcriptional programs that
promote the differentiation of effector cytolytic T cells. Immunity, 2010. 32(1): p. 79-90.
Dalchau, N., et al., A peptide filtering relation quantifies MHC class I peptide optimization. PLoS
Comput Biol, 2011. 7(10): p. e1002144.
Elliott, T. and A. Williams, The optimization of peptide cargo bound to MHC class I molecules
by the peptide-loading complex. Immunol Rev, 2005. 207: p. 89-99.
Starodubova, E.S., M.G. Isaguliants, and V.L. Karpov, Regulation of Immunogen Processing:
Signal Sequences and Their Application for the New Generation of DNA-Vaccines. Acta Naturae,
2010. 2(1): p. 53-60.
Vyas, J.M., A.G. Van der Veen, and H.L. Ploegh, The known unknowns of antigen processing
and presentation. Nat Rev Immunol, 2008. 8(8): p. 607-18.
Bertram, E.M., W. Dawicki, and T.H. Watts, Role of T cell costimulation in anti-viral immunity.
Semin Immunol, 2004. 16(3): p. 185-96.
June, C.H., et al., Role of the CD28 receptor in T-cell activation. Immunol Today, 1990. 11(6): p.
211-6.
Allison, J.P., CD28-B7 interactions in T-cell activation. Curr Opin Immunol, 1994. 6(3): p. 4149.
Shahinian, A., et al., Differential T cell costimulatory requirements in CD28-deficient mice.
Science, 1993. 261(5121): p. 609-12.
Kundig, T.M., et al., Duration of TCR stimulation determines costimulatory requirement of T
cells. Immunity, 1996. 5(1): p. 41-52.
Greenwald, R.J., G.J. Freeman, and A.H. Sharpe, The B7 family revisited. Annu Rev Immunol,
2005. 23: p. 515-48.
Freeman, G.J., et al., Engagement of the PD-1 immunoinhibitory receptor by a novel B7 family
member leads to negative regulation of lymphocyte activation. J Exp Med, 2000. 192(7): p. 102734.
79
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
Dong, H., et al., B7-H1, a third member of the B7 family, co-stimulates T-cell proliferation and
interleukin-10 secretion. Nat Med, 1999. 5(12): p. 1365-9.
Dempsey, P.W., et al., The signaling adaptors and pathways activated by TNF superfamily.
Cytokine Growth Factor Rev, 2003. 14(3-4): p. 193-209.
Curtsinger, J.M., et al., Inflammatory cytokines provide a third signal for activation of naive
CD4+ and CD8+ T cells. J Immunol, 1999. 162(6): p. 3256-62.
Schmidt, C.S. and M.F. Mescher, Adjuvant effect of IL-12: conversion of peptide antigen
administration from tolerizing to immunizing for CD8+ T cells in vivo. J Immunol, 1999. 163(5):
p. 2561-7.
Arens, R. and S.P. Schoenberger, Plasticity in programming of effector and memory CD8 T-cell
formation. Immunol Rev, 2010. 235(1): p. 190-205.
Curtsinger, J.M., et al., Type I IFNs provide a third signal to CD8 T cells to stimulate clonal
expansion and differentiation. J Immunol, 2005. 174(8): p. 4465-9.
Valenzuela, J., C. Schmidt, and M. Mescher, The roles of IL-12 in providing a third signal for
clonal expansion of naive CD8 T cells. J Immunol, 2002. 169(12): p. 6842-9.
Pham, N.L., V.P. Badovinac, and J.T. Harty, Differential role of "Signal 3" inflammatory
cytokines in regulating CD8 T cell expansion and differentiation in vivo. Front Immunol, 2011. 2:
p. 4.
Mescher, M.F., et al., Signals required for programming effector and memory development by
CD8+ T cells. Immunol Rev, 2006. 211: p. 81-92.
Deeths, M.J., R.M. Kedl, and M.F. Mescher, CD8+ T cells become nonresponsive (anergic)
following activation in the presence of costimulation. J Immunol, 1999. 163(1): p. 102-10.
Obar, J.J., et al., CD4+ T cell regulation of CD25 expression controls development of short-lived
effector CD8+ T cells in primary and secondary responses. Proc Natl Acad Sci U S A, 2010.
107(1): p. 193-8.
Cox, M.A., L.E. Harrington, and A.J. Zajac, Cytokines and the inception of CD8 T cell responses.
Trends Immunol, 2011. 32(4): p. 180-6.
Trapani, J.A. and M.J. Smyth, Functional significance of the perforin/granzyme cell death
pathway. Nat Rev Immunol, 2002. 2(10): p. 735-47.
Ishii, E., et al., Review of hemophagocytic lymphohistiocytosis (HLH) in children with focus on
Japanese experiences. Crit Rev Oncol Hematol, 2005. 53(3): p. 209-23.
Pinkoski, M.J., et al., Granzyme B-mediated apoptosis proceeds predominantly through a Bcl-2inhibitable mitochondrial pathway. J Biol Chem, 2001. 276(15): p. 12060-7.
Fan, Z., et al., Tumor suppressor NM23-H1 is a granzyme A-activated DNase during CTLmediated apoptosis, and the nucleosome assembly protein SET is its inhibitor. Cell, 2003. 112(5):
p. 659-72.
Galkina, E., et al., Preferential migration of effector CD8+ T cells into the interstitium of the
normal lung. J Clin Invest, 2005. 115(12): p. 3473-83.
Masopust, D., et al., Activated primary and memory CD8 T cells migrate to nonlymphoid tissues
regardless of site of activation or tissue of origin. J Immunol, 2004. 172(8): p. 4875-82.
Steinert, E.M., et al., Quantifying Memory CD8 T Cells Reveals Regionalization of
Immunosurveillance. Cell, 2015. 161(4): p. 737-49.
Ely, K.H., et al., Nonspecific recruitment of memory CD8+ T cells to the lung airways during
respiratory virus infections. J Immunol, 2003. 170(3): p. 1423-9.
Fanning, L.B. and J.A. Boyce, Lipid mediators and allergic diseases. Ann Allergy Asthma
Immunol, 2013. 111(3): p. 155-62.
80
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
Takeuchi, O. and S. Akira, Pattern recognition receptors and inflammation. Cell, 2010. 140(6):
p. 805-20.
Medzhitov, R. and C.A. Janeway, Jr., Innate immunity: impact on the adaptive immune response.
Curr Opin Immunol, 1997. 9(1): p. 4-9.
Kumar, H., T. Kawai, and S. Akira, Toll-like receptors and innate immunity. Biochem Biophys
Res Commun, 2009. 388(4): p. 621-5.
Medzhitov, R., Recognition of microorganisms and activation of the immune response. Nature,
2007. 449(7164): p. 819-26.
Becker, C.E. and L.A. O'Neill, Inflammasomes in inflammatory disorders: the role of TLRs and
their interactions with NLRs. Semin Immunopathol, 2007. 29(3): p. 239-48.
Badovinac, V.P., B.B. Porter, and J.T. Harty, CD8+ T cell contraction is controlled by early
inflammation. Nat Immunol, 2004. 5(8): p. 809-17.
Shimizu, T., Lipid mediators in health and disease: enzymes and receptors as therapeutic targets
for the regulation of immunity and inflammation. Annu Rev Pharmacol Toxicol, 2009. 49: p. 12350.
Kanaoka, Y. and J.A. Boyce, Cysteinyl leukotrienes and their receptors: cellular distribution and
function in immune and inflammatory responses. J Immunol, 2004. 173(3): p. 1503-10.
Schaloske, R.H. and E.A. Dennis, The phospholipase A2 superfamily and its group numbering
system. Biochim Biophys Acta, 2006. 1761(11): p. 1246-59.
Okunishi, K. and M. Peters-Golden, Leukotrienes and airway inflammation. Biochim Biophys
Acta, 2011. 1810(11): p. 1096-102.
Murphy, R.C., S. Hammarstrom, and B. Samuelsson, Leukotriene C: a slow-reacting substance
from murine mastocytoma cells. Proc Natl Acad Sci U S A, 1979. 76(9): p. 4275-9.
Brock, T.G., Regulating leukotriene synthesis: the role of nuclear 5-lipoxygenase. J Cell
Biochem, 2005. 96(6): p. 1203-11.
Mancini, J.A. and J.F. Evans, Cloning and characterization of the human leukotriene A4
hydrolase gene. Eur J Biochem, 1995. 231(1): p. 65-71.
Laidlaw, T.M. and J.A. Boyce, Cysteinyl leukotriene receptors, old and new; implications for
asthma. Clin Exp Allergy, 2012. 42(9): p. 1313-20.
Gentles, A.J. and S. Karlin, Why are human G-protein-coupled receptors predominantly
intronless? Trends Genet, 1999. 15(2): p. 47-9.
Dahlen, S.E., et al., Leukotrienes as targets for treatment of asthma and other diseases. Current
basic and clinical research. Am J Respir Crit Care Med, 2000. 161(2 Pt 2): p. S1.
Kamohara, M., et al., Functional characterization of cysteinyl leukotriene CysLT(2) receptor on
human coronary artery smooth muscle cells. Biochem Biophys Res Commun, 2001. 287(5): p.
1088-92.
Mellor, E.A., et al., Expression of the type 2 receptor for cysteinyl leukotrienes (CysLT2R) by
human mast cells: Functional distinction from CysLT1R. Proc Natl Acad Sci U S A, 2003.
100(20): p. 11589-93.
Thompson, C., et al., Signaling by the cysteinyl-leukotriene receptor 2. Involvement in chemokine
gene transcription. J Biol Chem, 2008. 283(4): p. 1974-84.
Sadik, C.D. and A.D. Luster, Lipid-cytokine-chemokine cascades orchestrate leukocyte
recruitment in inflammation. J Leukoc Biol, 2012. 91(2): p. 207-15.
Harada, A., et al., Essential involvement of interleukin-8 (IL-8) in acute inflammation. J Leukoc
Biol, 1994. 56(5): p. 559-64.
Capra, V., Molecular and functional aspects of human cysteinyl leukotriene receptors. Pharmacol
Res, 2004. 50(1): p. 1-11.
81
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.
Viola, A. and A.D. Luster, Chemokines and their receptors: drug targets in immunity and
inflammation. Annu Rev Pharmacol Toxicol, 2008. 48: p. 171-97.
Luster, A.D. and A.M. Tager, T-cell trafficking in asthma: lipid mediators grease the way. Nat
Rev Immunol, 2004. 4(9): p. 711-24.
Buchmeier, M., et al., fields virology. Lippincott Williams & Wilkins, 2007. II: p. 1793-1826.
Meyer, B.J., J.C. de la Torre, and P.J. Southern, Arenaviruses: genomic RNAs, transcription, and
replication. Curr Top Microbiol Immunol, 2002. 262: p. 139-57.
Zinkernagel, R.M. and R.M. Welsh, H-2 compatibility requirement for virus-specific T cellmediated effector functions in vivo. I. Specificity of T cells conferring antiviral protection against
lymphocytic choriomeningitis virus is associated with H-2K and H-2D. J Immunol, 1976. 117(5
Pt 1): p. 1495-502.
Jiang, W., et al., Endothelial cysteinyl leukotriene 2 receptor expression mediates myocardial
ischemia-reperfusion injury. Am J Pathol, 2008. 172(3): p. 592-602.
Dunbar, E., A. Alatery, and S. Basta, Cross-Priming of a Single Viral Protein from Lymphocytic
Choriomeningitis Virus Alters Immunodominance Hierarchies of CD8(+) T Cells during
Subsequent Viral Infections. Viral Immunol, 2007. 20(4): p. 585-98.
Korns Johnson, D. and D. Homann, Accelerated and improved quantification of lymphocytic
choriomeningitis virus (LCMV) titers by flow cytometry. PLoS One, 2012. 7(5): p. e37337.
Siddiqui, S., et al., Altered immunodominance hierarchies of CD8+ T cells in the spleen after
infection at different sites is contingent on high virus inoculum. Microbes Infect, 2010. 12(4): p.
324-30.
Rayamajhi, M., et al., Non-surgical intratracheal instillation of mice with analysis of lungs and
lung draining lymph nodes by flow cytometry. J Vis Exp, 2011(51).
Alatery, A. and S. Basta, An efficient culture method for generating large quantities of mature
mouse splenic macrophages. J Immunol Methods, 2008. 338(1-2): p. 47-57.
Savard, C.E., et al., Expression of cytokine and chemokine mRNA and secretion of tumor necrosis
factor-alpha by gallbladder epithelial cells: response to bacterial lipopolysaccharides. BMC
Gastroenterol, 2002. 2: p. 23.
Ahlers, J.D. and I.M. Belyakov, Memories that last forever: strategies for optimizing vaccine Tcell memory. Blood, 2010. 115(9): p. 1678-89.
Harizi, H., J.B. Corcuff, and N. Gualde, Arachidonic-acid-derived eicosanoids: roles in biology
and immunopathology. Trends Mol Med, 2008. 14(10): p. 461-9.
Uzonyi, B., et al., Cysteinyl leukotriene 2 receptor and protease-activated receptor 1 activate
strongly correlated early genes in human endothelial cells. Proc Natl Acad Sci U S A, 2006.
103(16): p. 6326-31.
Mellor, E.A., K.F. Austen, and J.A. Boyce, Cysteinyl leukotrienes and uridine diphosphate
induce cytokine generation by human mast cells through an interleukin 4-regulated pathway that
is inhibited by leukotriene receptor antagonists. J Exp Med, 2002. 195(5): p. 583-92.
Rovati, G.E. and V. Capra, Cysteinyl-leukotriene receptors and cellular signals.
ScientificWorldJournal, 2007. 7: p. 1375-92.
Piper, S.C., et al., The role of interleukin-1 and interleukin-18 in pro-inflammatory and anti-viral
responses to rhinovirus in primary bronchial epithelial cells. PLoS One, 2013. 8(5): p. e63365.
Diehl, S. and M. Rincon, The two faces of IL-6 on Th1/Th2 differentiation. Mol Immunol, 2002.
39(9): p. 531-6.
Michlewska, S., et al., Macrophage phagocytosis of apoptotic neutrophils is critically regulated
by the opposing actions of pro-inflammatory and anti-inflammatory agents: key role for TNFalpha. FASEB J, 2009. 23(3): p. 844-54.
82
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
Shin, D.I., et al., Interleukin 10 inhibits TNF-alpha production in human monocytes
independently of interleukin 12 and interleukin 1 beta. Immunol Invest, 1999. 28(2-3): p. 165-75.
Woszczek, G., et al., IL-10 inhibits cysteinyl leukotriene-induced activation of human monocytes
and monocyte-derived dendritic cells. J Immunol, 2008. 180(11): p. 7597-603.
Xiao, Z., et al., Programming for CD8 T cell memory development requires IL-12 or type I IFN. J
Immunol, 2009. 182(5): p. 2786-94.
Ye, F., J. Turner, and E. Flano, Contribution of pulmonary KLRG1(high) and KLRG1(low) CD8
T cells to effector and memory responses during influenza virus infection. J Immunol, 2012.
189(11): p. 5206-11.
Voehringer, D., et al., Viral infections induce abundant numbers of senescent CD8 T cells. J
Immunol, 2001. 167(9): p. 4838-43.
Badovinac, V.P., B.B. Porter, and J.T. Harty, Programmed contraction of CD8(+) T cells after
infection. Nat Immunol, 2002. 3(7): p. 619-26.
Wong, P. and E.G. Pamer, Feedback regulation of pathogen-specific T cell priming. Immunity,
2003. 18(4): p. 499-511.
Stelekati, E., et al., Bystander chronic infection negatively impacts development of CD8(+) T cell
memory. Immunity, 2014. 40(5): p. 801-13.
Krishnamurty, A.T. and M. Pepper, Inflammatory interference of memory formation. Trends
Immunol, 2014. 35(8): p. 355-7.
Henao-Tamayo, M.I., et al., Phenotypic definition of effector and memory T-lymphocyte subsets
in mice chronically infected with Mycobacterium tuberculosis. Clin Vaccine Immunol, 2010.
17(4): p. 618-25.
83