Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Therapeutic gene modulation wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Genome evolution wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Minimal genome wikipedia , lookup
Protein moonlighting wikipedia , lookup
Michael Allen November 29, 2010 UNT Health Science Center, Ft. Worth A Brief History of Rhodopseudomonas palustris (Our pal Rpal) ◦ Life, liberty and the pursuit of the soluble interactome Global Gene Regulation ◦ Extracytoplasmic Function Sigma Factors Regulating the Regulators Getting to Know Conserved Unknowns Conclusions and Future Directions You Are Here The dominant form of life on earth ◦ Estimated 1030 bacteria ◦ 1,000,000,000,000,000,000,000,000,000, 0 Oldest form of life 0 ◦ 2.8B years before multicellular animals 0 The largest source of genetic diversity ◦ 107 distinct species in 1g of soil Gram Negative α-Proteobacterium Capable of Anoxygenic photosynthesis 5.5 Mbp Genome sequenced (JGI) and annotated (Larimer et al. Nat. Biotech. 2004) Recently several additional strains have been sequenced by DOE (6 total) High metabolic diversity Four modes of metabolism + CO2 H CO2 ATP Thiosulfate H+ H+ Chemoautotrophic 1/2O 2 H2O ATP Photoautotrophic Thiosulfate H+ Lignin monomers Lignin monomers ATP H+ H+ 1/2 H2O O2 Chemoheterotrophic ATP Photoheterotrophic Nature Biotech. 2004 N2+16ATP+8H++8e- 2NH3+H2+16ADP+16Pi Nitrogen Fixation Nitrogen fixation releases H2 as a byproduct R. palustris has three different nitrogenases with different metal-containing co-factors: Molybdenum, Vanadium, Iron N2-Fixation Efficiency Hydrogen Production Derives Energy from Sunlight Needs only gaseous N2 Grows on a wide variety of carbon sources including CO2, lignin monomers and xenobiotic aromatics For all of these reasons, chosen as a subject for a DOE-funded Genomes To Life program Objective: To map out the entire soluble protein “interactome” ◦ High-throughput, heavily automated process 2-step affinity isolation tag affinity bead Elution tag Trypsin tag Lysis Cells tag tag Broad host range plasmid expression in R. palustris web portal data analysis Distinct Affinity-tagged Gene Products: Cloned (entry / expression) 1312 Cultured and harvested 859 Isolated and analyzed by LC-MS-MS 844 LC-MS-MS Identifications: Proteins (distinct) 3404 Photosynthetic complex 1 Pyruvate dehydrogenase Riboflavin biosynthesis CO2 assimilation complex Succinyl-CoA synthetase Fatty acid biosynthetic complex 1 Fatty acid biosynthetic complex 2 Photosynthetic complex 2 Heat shock …Including RPA4223 (bait) and RPA4224 (prey) Genes adjacent on the chromosome RPA4223 ◦ a predicted response regulator RPA4224 ◦ “hypothetical” protein RPA4206: beta-hydroxybutyrate dehydrogenase RPA2552: Unknown Response Regulator Anti-σ RPA4223 ECF σ Factor RPA4225 RPA4224 Predicted Operon HWE His Kin /CHASE/ RPA4226 In bacteria, sigma factors bind with RNAP to direct transcription of large sets of genes ◦ “Global Regulators” ◦ Ex’s: σ70 Housekeeping, σ32 Heat shock ◦ E. coli has 7 total The genome of R. palustris encodes 19 different sigma factors ◦ 16 are Extracytoplasmic Function (ECF) Sigma Factors (only 2 in E. coli ) AKA Type IV σ factors Distantly related to the σ70-type (Type I) housekeeping σ factors Respond to changes outside the plasma membrane (external or periplasmic) Often control expression of virulence factors, biofilm formation, stress responses, etc. Sigma 1 Sigma 3 Sigma 2 Sigma 2 Sigma 1 Sigma 3 Shotgun proteomics of R. palustris under different metabolic conditions -VerBerkmoes et al, J. Proteome Res. 2006 1 of the 16 ECF σ dominated: RPA4225 ◦ Present during stationary phase ◦ Growth on benzoate Cloned rpa4225 into a broad host range vector and transformed it into WT R. palustris CGA010 Extract total protein Analyzed the whole proteome for changes in protein abundance as a result of constitutive expression of rpa4225 (15NH4)2SO4 (14NH4)2SO4 Control Experiment Biological Technical LC/MS/MS Replicates Mix Replicates Mix Verified expression of rpa4225 in experiment vs. control strains containing empty vector 1 L 2 3 C1 E1 4 5 C2 6 E2 Biological Replicate 1 Locus Name Description Log2 Ratio Lower CI Upper CI Biological Replicate 2 Log2 Lower Upper Ratio CI CI RPA3310 KatE Catalase 3.8 3.4 4.1 4 3.5 4.3 RPA3726 CDS DUF892, YciF-like 3.7 3.2 4.2 3 2.3 3.5 RPA3568 CDS Conserved Unknown 3 2.6 3.5 2.1 1.6 2.6 RPA3943 CDS Conserved Hypothetical 2 1.5 2.5 2.1 1.6 2.7 RPA3309 CDS Conserved Unknown 2.2 1.9 2.6 1.6 1.3 1.9 RPA1481 CDS Putative CheY-like protein 1.9 1.5 2.4 1.9 1.5 2.2 RPA1500 CDS Unknown Protein 2 1.7 2.4 1.1 0.7 1.6 RPA3510 CDS Conserved Unknown 1.7 1.5 1.9 1.2 1 1.4 RPA3702 MetH Methionine Synthase 1.1 0.7 1.4 0.7 0.3 1.1 RPA1274 CDS DPS-like Protein 0.9 0.4 1.3 0.9 0.5 1.3 Quantitative PCR performed on mRNA from 13 different genes ◦ Selected Up, Down, and Unchanged examples ◦ Included RPA4224 Results similar for both techniques ◦ qPCR Data Indicate RPA4224 Strongly Upregulated Proteomics data inconclusive due to low abundance ◦ Indicates positive feedback Including the 4224-4225 operon 1274 1481 3568 4418 3308 3726 4224 3943 3510 Consensus -35 (1) (1) (1) (1) (1) (1) (1) (1) (1) (1) -35 -10 GGAACGCCACCGGACGCAGCGCGTTGATGAGGGGTCTAACGT-132N--GGATTCTCATCGTG GGAACGATCGTGGGGTTGAGCCCTTGATGATCGGTCGTGTCGAC-GAGAGGATGACTGAGGTG GGAACGCAGCGTGGAGTCCGCGGTTCTGTAGGCACCATTCAC-6N-AAGAGGGCAATCCTATG GGAACATCCGAGGAGCCTGCCGGTTGTCTCCACGAAGCTCACAAGTGAAGGAGACATTCAATG GGAACAGAATCGTTCGTCCCCGGTTCTCCGGTCGAGCCGCGG-15N-GGCGGAGGCAACGATG GGAACATTCGTCGGAAGGTCGCGTTGGGCGGTTGCACTGTCA-19N-CGGAGATCACAGCATG GGAACTTTCGCGCCGGGATCGCATT---------------------------AGGGTCCCATG GGAACGGCGGTCGCTGTCGCTGGTTAACGACCCGAACGGCCG-46N-AAGAGGCACCCCGATG GGAACCCAATGGCGCGCTGCGGGTTGACGTGGTGCATCTCGG-28N-TCTGGAGGGCATCATG GGAAC G GG G C GGTTG G G CG -10 Search the genome for the sequence: GGAAC-17N-TT Found in the promoter regions of ~150 genes, including ◦ DNA repair ◦ Heat shock sigma factor rpoH ◦ Superoxide dismutase sodB Suggests RPA4225 is a major regulator of the stress response in R. palustris RPA3310 RPA3726 RPA1481 RPA1274 RPA3702 ◦ KatE, Catalase 2 H2O2 → 2 H2O + O2 ◦ Mn Catalase Assoc (?) ◦ CheY-like Protein, Regulatory ◦ DPS-like Protein: Associated with DNA-protection as well as cytoplasmic sequestration of Fe ◦ MetH, one of two methionine synthases ◦ B12-dependent, not sensitive to oxidation in E. coli, unlike MetE All Point to Oxidative Stress Response “Common mechanism of cellular death induced by bactericidal antibiotics” -Kohanski et. al Cell ’07 Found that 3 classes of bactericidal antibiotics all stimulated the production of hydroxyl radicals, causing death End result was induction of oxidative damage cellular death pathway ◦ Destabilization of Fe-S clusters, and Fenton reaction H2O2 + Fe2+ Fe3+ + OH¯+ ●OH Implies that: 1) Drugs targeting the bacterial response to oxidative damage would act synergistically with existing bactericidal antibiotics 2) There is apparently a lot we don’t know about bacterial response to oxidative stress Performed qPCR on wild type R. palustris under oxidative stress conditions katE upregulated under H2O2 conditions as expected rpa4224 operon also upregulated under H2O2 conditions rpa3568 upregulated under H2O2 conditions but less than predicted …was not particularly convincing H2O2 not the only kind of ROS ◦ Singlet oxygen ◦ Superoxide ◦ Alkyl peroxides And Rpa4225 not the only ECF σ factor R. palustris encodes 19 σ factors (16 ECF) Preliminary data indicated increased abundance of transcripts for other sigma factors during stationary phase Targeted rpa0550, rpa1813, rpa1819 RpoERs associated with response to singlet oxygen Genes rpa0550 and chrR in R. palustris (top) and their homologs in Rhodobacter sphaeroides (Newman et al. JMB ‘99) R. pal. 5’-TGATCCAAACGATCGGCCGGCTCGTATCAGAACAAAT-3’ R. s. 5’-TGATCCAGACTGGCCCGGCCGCCGTAAGAAGGACGTT-3’ Close proximity to each other Also upregulated during stationary phase/starvation No homologs or positional clues mRNA Fold-Change 50 40 30 pH 5.0 pH 8.0 20 10 0 rpa0550 rpa1813 rpa1819 rpa4225 Sigma factors rpa0550 and rpa1813 had highest response singlet oxygen Less known about the latter Back to shotgun proteomics Locus RPA4834 RPA4070 RPA2544 RPA4194 RPA0225 RPA1206 RPA4069 RPA1941 RPA1205 RPA1576 Log2 ratio 4.7 4.6 4.2 3.0 2.9 2.9 2.9 1.1 1.0 1.0 Description MsrA2, pms peptide methionine sulfoxide reductase MsrA1 possible peptide methionine sulfoxide reductase RPA2544 conserved hypothetical protein OsmC osmotically inducible protein OsmC SodC putative periplasmic superoxide dismutase (Cu/Zn) aldehyde dehydrogenase DUF25 possible 2-nitropropane dioxygenase putative alcohol dehydrogenase putative glutathione S-transferase Ezraty et al. BBA ‘05 ECF σ4225: ◦ Controls expression of numerous genes ◦ Likely responds to multiple stresses including oxidative and pH stress ◦ Downstream genes in turn may be controlled by multiple regulators (e.g. OxyR) ECF σ1813: ◦ Controls genes related to methionine oxidation rpa3568 strongly associated with pH stress Part II Brooks and Buchanan, 2007 “Sequence homology indicates that two component signaling activation of an ECF sigma factor may regulate the activity of σE from the Gram positive bacterium Streptomyces coelicolor A3(2) [18]. However, to date, this has not been seen in Gram negative bacteria and thus two-component signaling in ECF activation may be limited to Gram positive bacteria.” Brooks and Buchanan, 2007 Response Regulator Anti-σ ECF σ Factor HWE His Kin RPA4224 RPA4223 RPA4225 /CHASE/ RPA4226 R. palustris Smc01504 Sinorhizobium meliloti rpoE2 Smc01507 7001 Bradyrhizobium sp. 7003 7004 1644 Brucella abortus 1645 1646 This ORF has not been annotated but twoway translated BLAST analysis reveals protein homology with rpa4224 Organization of four genes conserved among multiple α-Proteobacteria The homolog of RPA4224 in S. meliloti, Smc01505, was shown to be a negative regulator of ECF σ factor RpoE2 Presence of Response Regulator and HWE Histidine Kinase flanking σ/anti-σ pair strong evidence of their involvement in regulation CHASE HWE_HK σ70_r4_2 RR σ70_r2 RPA4226 (588 aa) RPA4223 (268 aa) σ70_r4_2 RPA4225 (181 aa) RPA4224 (70 aa) No Recognizable Domains Methylobacterium extorquens Francez-Charlot et al. PNAS ‘09 Histidine kinase sensor 1. Environmental Signal RPA4226 ATP 2. Autophosphorylation PO4 ADP 3. RR Activation PO4 Resp Reg RPA4223 b Anti-s RPA4224 PO4 Resp Reg RPA4223 Anti-s RPA4224 4. Sequestration/Degradation of anti-sigma factor s-ECF RPA4225 ECF-s RPA4225 b’ a a RNA polymerase 5. Active Complex RPA4223-RPA4224 shown to interact by pulldown assay and LC/MS-MS What about RPA4223-RPA4226? E. coli Green Fluorescent Protein (GFP) cytoplasmic distribution DivIVA E. coli division protein localizes to poles No Interaction X- Y- GFP fused to protein X -X X Y -X Y -X Y -XY / -X -X Y Y -X Y X- -X -X -X Y DivIVA fused to protein Y X-Y Interaction YX YX YX YX XY XY XY XY RPA4226-GFP + RPA4223-DivIVA RPA4226-GFP 2μm 2μm PhyR-NepR system conserved in R. palustris RPA4226 Histidine Kinase appears to be signal transducer for PhyR (RPA4223) Response of system oxidative, pH stress suggests role for CHASE domain in bacteria Part III Unknowns – proteins without known function Conserved unknowns – broadly distributed, evolutionarily conserved of the above Hypothetical proteins – Predicted based on bioinformatics but no data on transcript or protein ◦ Ghosts in the machine In E. coli (and bacteria in general) ◦ We know the function of about 1/3 of the genes ◦ We think we know functions of about another 1/3 ◦ The last third we are almost entirely clueless about katE upregulated under pH stress rpa4224 operon upregulated under pH stress rpa3568 dramatically upregulated by pH shift RPA3568 strongly linked to pH stress CHASE domain linked to stress response Analysis of conserved unknowns to be the subject of an HHMI-sponsored undergrad research-based class ◦ Generate and screen KO’s for stress sensitivity ◦ Investigate auxotrophies under stress conditions ◦ High risk/high reward Still attempting deletion of RPA4223-4226 ◦ Screen for stress sensitivity phenotype ◦ Mutational analysis of HK and RR In vitro phosphotransfer Reconstitution in E. coli Investigate 4226 CHASE-domain binding affinities ◦ Domain found in bacteria, plants ◦ No solid information on target (plants cytokinin) ◦ Direct oxidation? Lipid peroxides? UNT ◦ ◦ ◦ ◦ Leslie Perry Sarah Martinez Stephanie Simon David Visi Funding Provided by: ORNL ◦ ◦ ◦ ◦ Dale Pelletier Greg Hurst Jenny Morrell-Falvey and many others… Office of Research University of North Texas Health Science Center