Download - HKBU Institutional Repository

Hong Kong Baptist University
HKBU Institutional Repository
Open Access Theses and Dissertations
Electronic Theses and Dissertations
2013
Molecular studies of some developmental and
reproductive traits of Rayada rice
Rubaiyath Bin Rahman A N M
Hong Kong Baptist University
Follow this and additional works at: http://repository.hkbu.edu.hk/etd_oa
Recommended Citation
Bin Rahman A N M, Rubaiyath, "Molecular studies of some developmental and reproductive traits of Rayada rice" (2013). Open Access
Theses and Dissertations. Paper 51.
This Thesis is brought to you for free and open access by the Electronic Theses and Dissertations at HKBU Institutional Repository. It has been
accepted for inclusion in Open Access Theses and Dissertations by an authorized administrator of HKBU Institutional Repository. For more
information, please contact [email protected].
Molecular Studies of Some Developmental
and Reproductive Traits of Rayada Rice
BIN RAHMAN A N M Rubaiyath
A thesis submitted in partial fulfillment of the requirements
for the degree of
Doctor of Philosophy
Principal supervisor: Prof. ZHANG Jianhua
Hong Kong Baptist University
November 2013
Declaration
I hereby declare that this thesis represents my own work which has been done
after registration for the degree of PhD at Hong Kong Baptist University, and has
not been previously included in a thesis or dissertation submitted to this or any
other institution for a degree, diploma or other qualifications.
Signature
Date: November 2013
i
ii
Abstract
Crop domestication and subsequent breeding or directional selection have
narrowed the genetic diversity of elite varieties whereas land races, ecotypes, wild
relatives growing on native preferences still keep genetic diversities of stress
tolerances. Rayada is such an exceptional ecotype, variant of typical deepwater
rice, completely endemic to certain areas of Madhumati river tracts of Bangladesh
and still shares some features of wild rices. Multiple physiological features of
Rayadas are distinctly different from typical deepwater rice. In this PhD project,
we have studied the specialty of Rayada rice and identified that Rayada has
special tolerances to prolonged flood, submergence and cold along with longer
root system and prompt recovery capacity after water stress. All these features
make it as an elite resource of stress tolerance and might become a new focus of
rice germplasm research.
Among all deepwater rices, Rayada is the only exception, having virtually no seed
dormancy, but both physiological and molecular bases of this trait are completely
unknown. We examined the non-dormant nature of Rayadas as a natural variant of
deepwater rice. After comparing features of freshly harvested seeds of Rayada
with those of typical deepwater rice variety, we identified several concerted
features; for instance, less ABA content in freshly harvested seeds; faster ABA
catabolism and enhanced ROS accumulation after imbibition. Moreover, after
analyzing stepwise gene expressions of 32 bZIPs in seed germination, mild and
severe water stresses among three extreme ecotypes including Rayadas together
with homology search with reported genes, we identified OsbZIP84 as a candidate
gene for the regulation of ABA catabolism in Rayada rice. ABA content and
expression analysis of OsbZIP84 and ABA8oxs in four growth and developmental
stages along with phenotyping of mutant revealed the function of OSbZIP84 in
the dormancy regulation of Rayada rice.
Submergence tolerance during seed germination is one of the rare traits of rice,
even among cereals. Except few physiological indications of tolerance, most other
molecular signaling network is not known. We identified several positive and
negative regulators of shoot development under submergence inducting the
capacity of shoot development of Rayada rice under oxidative stress. We
iii
successfully developed a condition supplemented with riboflavin and H2O2 where
intolerant genotypes successfully developed shoot under submergence. However,
induced shoot development was completely inhibited by glucose, ABA and
mitochondrial complex IV inhibitor signifying ABA and glucose as negative
regulators, whereas ROS, riboflavin and mitochondrial complex IV as positive
regulators.
Gene
supplementation
expression
mimicked
analysis
aerobic
of
gene
α-amylases
expression
revealed
pattern.
H2O2
Plausible
mechanisms of riboflavin and H2O2 function in submergence tolerance were also
discussed.
Finally, we isolated a novel mutant of Rayada variety with Kaladigha background
and having four interesting phenotypes of practical implications. Mutant plant
shows purple pigmentation throughout the plants organs along with dense and
elongated trichomes on the adaxial leaf surface. In addition, the same mutant also
shows high frequency of stigma exsertion. But ultimately, we observed that the
mutant plant is completely sterile. The possible reason of the sterility was found
being related to the stigma receptivity. Severe reduction of ROS accumulation in
stigmas of mutant plant was observed after fluorescent H2DCF-DA staining.
However, pollen grains are completely viable with normal shape and size.
Interestingly, the fertility was partially restored after humidifying the panicles.
Mutant progeny showed dense black coloration in seeds with significant reduction
of grain weight. Moreover, it showed segregating ratio of 3:1 for purple
pigmentation, suggesting single gene mutation nature. Other phenotypic features
confirmed the mutant as a Rayada variety with Kaladigha background, not a seed
contamination. After extensive data mining of these four phenotypes, we
identified maize Lc gene with three similar phenotypes reported earlier excluding
stigma exsertion, hence considered as candidate gene of this mutant. The gene
expression of maize Lc homolog of rice, OsbHLH13, was exceptionally upregulated in the purple mutant. Further studies of genetic characterization may
open up the practical implications of this mesmerizing mutant.
In summary, Rayada is a primitive deepwater rice ecotype that can offer many
traits and genetic resources that are badly needed in rice breeding for stress
tolerance and the time is mature to do the more detailed research with rapid
advances in genome research weaponry .
iv
Acknowledgements
I would like to express my deepest gratitude to my principal supervisor, Professor
Jianhua Zhang for his supervision, encouragement, supports and inspiration over
the past three years. Without his support, guidance and care, I could never run my
projects as well as my life smoothly in abroad. If any credit earns this thesis,
naturally it belongs to him too.
Similarly, I want to thank my co-supervisor, Professor Yiji Xia for his advice,
guidance as well as research assistantship he offered me. Lucky me, have such
two notable scientists as my supervisors. Special thanks to our Dean of Science,
Professor Tang Tao, for his generosity as well as arrangement of prayer room
after my request.
Certainly, thanks to all of my teachers of Biology Department, HKBU, especially
to Chris Wong, Head of the department. All of you are so kind and cooperative. I
would remember Professor Ricky Wong ever, for his cordial behavior, I met him
in my very first day of HKBU, apart my supervisor.
Nothing would satisfy me unless I thank Hong Kong Baptist University as well as
the Research Grant Council for studentship of my PhD tenure. Sincere gratitude to
all of the scientific officers of Biology department who helped me in different
ways in my studies, especially to Ms. Olivia Chau Ching Wah and Louise Lai Ha
Ng. Similarly, thanks to Ho Yee, Fion, Pui Ling, Lo Kam Fai for their cooperation
and support.
My thesis completion would be impossible without the help my lab mates. I must
remember you all. You were too kind to me, made my life easy abroad, I am
grateful to you all, especially to Dr. Ye Nenghui, Jia Liguo, Shi Lu, Liu Rui, Zhi
Hui. All others including Professor Xia’s group are also acknowledged for their
favor and attention.
Hey, Larry! I wished to thank you some three years ago; Google was my
dependence since the beginning of the study. While I was alone as an alien in the
Sino Island, you played music for me. I was never been to library last three years,
only because of your awesome services of Google scholar, Note, YouTube and
v
certainly Google itself. I would be miser if I do not acknowledge you with my
gratefulness.
It’s my privilege to acknowledge the best scientists of the world, the farmers,
especially rice farmers who kept Rayada rice still growing in the field. I just
revealed scientifically whatever you know since long.
Finally, I do dedicate my thesis to my beloved parents, my lovely wife and to my
two little angels: Rudaba & Namira. Without your love, affection, encouragement,
spirit I would never finish it.
vi
Table of Contents
Declaration
i
Abstract
iii
Acknowledgements
v
Table of Contents
vii
List of Figures and Tables
xii
List of Abbreviations
xv
Chapter 1 Introduction
1
1.1
General Introduction
1
1.2
Rice ecosystems
1
1.2.1 Irrigated lowland ecosystem
2
1.2.2 Rainfed lowland ecosystem
2
1.2.3 Upland rice ecosystem
3
1.2.4 Flood-prone ecosystem
3
1.2.4.1 Rayada ecotype
1.3
4
Molecular mechanisms of adaptation to flood-prone area
5
1.3.1 Prolonged flood with partial submergence
5
1.3.2 Flash flood of complete submergence
6
1.4
Seed dormancy and germination: two interrelated complex processes
7
1.5
ABA 8’-hydroxylases: key player after imbibition
11
1.6
ABA signaling pathway
12
1.7
ABA responsive transcription factors
13
1.7.1 bZIP transcription factors
14
1.7.2 bZIPs in rice
15
1.8
Crosstalk between ROS and ABA signaling
16
1.9
Seed germination under submergence
17
1.10
Anthocyanin biosynthesis and trichome development: linked
19
processes
1.11
Objectives of this study
22
vii
Chapter 2 Rayada specialty: the forgotten resource of elite features of
23
rice
2.1
Introduction
23
2.2
Deepwater rice in Bangladesh
24
2.3
Types of deepwater rice in Bangladesh
25
2.3.1 Rayada rice
25
2.4
Distribution of Rayada
27
2.5
Yearlong life cycle
28
2.6
Elongation ability of Rayada
29
2.7
Submergence tolerance
31
2.8
Seed dormancy
32
2.9
Cold tolerance
34
2.10
Longer root systems of Rayada
35
2.11
Photoperiod sensitivity
36
2.12
Quick recovery after water stress
38
2.13
Origin and evolution of Rayada
39
2.14
Rayada: the forgotten resource of elite features of rice
41
Chapter 3 OsbZIP84 is involved in seed dormancy regulation of
43
Rayada rice through ABA catabolism
3.1
Introduction
43
3.2
Materials and methods
46
3.3
3.2.1 Plant materials
46
3.2.2 Growth conditions and stress treatments
46
3.2.3 Microarray data analysis
53
3.2.4 RNA extraction and quantitative real-time (qRT)-PCR
53
3.2.5 Extraction and measurement of ABA
53
3.2.6 ROS staining and confocal laser scanning microscopy
54
3.2.7 Statistical analysis
54
Results
55
3.3.1 Lack of dormancy of freshly harvested Rayada seeds
55
3.3.2 ROS accumulation in freshly harvested Rayada seeds after
56
imbibition
3.3.3 Differential
expressions
of
viii
selected
OsbZIPs
in
seed
58
germination
3.3.4 Expression pattern of OsbZIP84 in mild and severe water
60
stresses
3.4
3.3.5 Homology search and possible functional homolog
62
3.3.6 Putative functions of VIP1or RSG homolog of rice
63
3.3.6.1 Inundation
64
3.3.6.2 Seed maturation
65
3.3.6.3 Water stress recovery
67
3.3.6.4 Seed germination
68
3.3.7 Dormancy phenotype of osbzip84
69
3.3.8 Elevated ABA in osbzip84 seeds but reversed in water stress
71
Discussion
73
3.4.1 Natural variation of seed dormancy
73
3.4.2 ABA, ROS and seed dormancy: linked altogether
74
3.4.3 Regulation of ABA catabolism: function of OsbZIP84 in
75
Rayada rice
3.4.4 Elevated ABA in osbzip84 seed results in dormancy phenotype
Chapter 4 Shoot development under submergence is regulated by ROS
76
79
and riboflavin in Rayada rice
4.1
Introduction
79
4.1.1 Submergence tolerance during seed germination: a rare trait
80
4.1.2 Physiological features of tolerant genotypes
80
4.1.3 Alternative
strategy
to
reveal
factors
regulating
shoot
81
development
4.2
4.3
Materials and methods
82
4.2.1 Plant materials and growth conditions
82
4.2.2 Different treatments
82
4.2.3 Uncoating of Rayada seeds
83
4.2.4 Electric conductivity measurement
83
4.2.5 RNA extraction and quantitative real-time (qRT)-PCR
84
4.2.6 Extraction and measurement of ABA
84
Results
86
4.3.1 High ABA restricts shoot development, not root
ix
86
4.3.2 Rayada seedlings: more tolerant to composite stress
87
4.3.3 Augmentation of seed germination by hydrogen peroxide
89
4.3.4 Shoot development of Rayadas under composite submergence
90
stress
4.3.5 Coatless Rayada seeds unable to develop shoot under
92
submergence
4.3.6 Riboflavin induces shoot development under submergence
94
4.3.7 Nitric oxide: not involved in in shoot development under
95
submergence
4.3.8 Both exogenous ABA and glucose restrict shoot development
96
under submergence
4.3.9 Mitochondrial complex IV inhibition: restrict seed germination
98
under submergence
4.3.10 H2O2 affects carbohydrate metabolism under submergence
4.4
99
Discussion
100
4.4.1 Rayada rice: is elixir of stress tolerances?
100
4.4.2 Riboflavin richness of red rice
101
4.4.3 Riboflavin: a signaling compound
101
4.4.4 How
might
riboflavin
induce
shoot
development
in 102
submergence?
4.4.5 Hidden player masked riboflavin
103
4.4.6 Involvement of ABA and glucose signaling
104
Chapter 5 A novel natural mutant of Rayada rice, plausibly in 107
OsbHLH13, shows multiple phenotypes with potential use in hybrid
seed technology
5.1
5.2
Introduction
107
5.1.1 Stigma exsertion
107
5.1.2 Morphological markers
108
5.1.3 Trichome development
108
5.1.4 Anthocyanin and trichome development: linked processes
109
Materials and methods
110
5.2.1 Plant materials and growth condition
110
5.2.2 Determination of total anthocyanin content
110
x
5.3
5.2.3 RNA extraction and real-time PCR analysis
111
5.2.4 Estimation of trichome density and distribution
111
5.2.5 Determination of stigma exsertion
111
5.2.6 Pollen viability assay
112
5.2.7 Determination of stigma receptivity
112
5.2.8 Humidification of panicles
112
5.2.9 ROS staining and confocal laser scanning microscopy
113
Results
114
5.3.1 Phenotypic characterization of natural purple mutant
5.3.1.1 Purple pigmentation
114
5.3.1.1.1 Anthocyanin content
5.4
114
116
5.3.1.2 Profuse and elongated trichomes
117
5.3.1.3 Stigma exsertion
119
5.3.1.4 Sterility of purple mutant
120
5.3.2 Stigma receptivity: plausible cause of sterility
120
5.3.3 Reduced ROS accumulation in mutant stigma
121
5.3.4 Partial restoration of fertility
124
5.3.5 Phenotype of purple progeny
125
5.3.6 Candidate gene of theses phenotypes
125
5.3.7 Expression analysis of OsbHLH13
126
Discussion
128
5.4.1 Natural mutation, not seed contamination
128
5.4.2 Sterility and reduced ROS accumulation of stigmas: linked 129
together
5.4.3 Humidity and sterility
130
5.4.4 Black colored but reduced grain weight
130
5.4.4 Selection of OsbHLH13 as candidate gene
131
Chapter 6 General Discussion and Conclusion
133
References
139
xi
List of Figures and Tables
Fig. 1.1
Distribution of rice cultivation among different ecosystems in
2
Asia
Fig. 1.2
Total cultivation area of rice in different ecosystems in top five
4
rice producing countries in mid 1990s
Fig. 1.3
Two different strategies of survival of rice after flooding
6
Fig. 1.4
Vivipary or preharvest sprouting of different crops
9
Fig. 1.5
Generalized model of mechanism of seed dormancy induction
10
and release
Fig. 1.6
Simplified ABA biosynthetic and catabolic pathways in plants
12
Fig. 1.7
Model on the major ABA signaling pathway
13
Fig. 1.8
Submergence tolerant cultivars during seed germination and
18
phenotype of comparative tolerance
Fig. 1.9
Simplified anthocyanin biosynthesis and trichome development
21
regulation
Fig. 2.1
Flood-affected areas of Bangladesh
23
Fig. 2.2
Status of deepwater rice cultivation in Bangladesh
24
Table 1
Comparative features of different types of deepwater and wild
26
rice (O. rufipogon) of Bangladesh
Fig. 2.3
Distribution of Rayada rice in Bangladesh
28
Fig. 2.4
Internode elongation pattern of Rayada after inundation
30
Fig. 2.5
Comparative submergence tolerance of Sub1A introgressed
32
variety, BRRI 52 with Rayada variety, Kaladigha
Fig. 2.6
Climatic features of Rayada growing areas
33
Fig. 2.7
Comparative phenotype of cold tolerance of Rayada variety,
34
Kaladigha with upland rice, Manikmodhu
Fig. 2.8
Comparative root growth of Rayadas with others varieties in
36
different conditions
Fig. 2.9
Comparative time course leaf derolling after rewatering of water
38
stressed Rayada rice variety, Kaladigha and aus genotype,
Dudsor
Fig. 2.10 Phylogenetic analysis of snorkel protein sequences among
xii
40
deepwater and wild rices
Table 2
List of primer sequences used in this study
47
Fig. 3.1
Lack of dormancy of freshly harvested seeds of Rayada
56
Fig. 3.2
Comparative ROS accumulation of freshly harvested seeds
57
Fig. 3.3
Expression analyses
59
of selected OsbZIPs among three
ecotypes/varieties during seed germination
Fig. 3.4
Expression profile of OsbZIP84 after mild, severe water stresses
61
and recovery in three extreme ecotypes/varieties
Fig. 3.5
Phylogenetic tree of OsbZIP84 homolog among wild and
63
cultivated species
Fig. 3.6
Time course ABA content and selected genes expression after
65
inundation in Rayada variety, Kaladigha
Fig. 3.7
Time course ABA content and selected genes expression during
66
seed maturation in Rayada variety, Kaladigha
Fig. 3.8
Time course ABA content and ABA8ox1 and OsbZIP84
67
expression during water stress recovery in Rayada variety,
Kaladigha
Fig. 3.9
Time course ABA content and gene expression of ABA8ox1,
68
OsbZIP84 and water absorption pattern during imbibition in
Rayada variety, Kaladigha and dose dependent effect of ABA on
seed germination of Kaladigha
Fig. 3.10 Time course relative gene expression of NCEDs after imbibition
69
Fig. 3.11 Germination and seedling growth performance of osbzip84
70
Fig. 3.12 Change of ABA content, grain size and weight of osbzip84
72
Fig. 4.1
87
Effect of high ABA and mild salinity on seed germination of
Rayadas
Fig. 4.2
Composite stress tolerance capacity of Rayadas to modern rice
88
varieties
Fig. 4.3
Effect of H2O2 on seed germination, coleoptile growth and ABA
90
content
Fig. 4.4
Exceptional submergence tolerance capacity of Rayada varieties
91
under composite submerged stress
Fig. 4.5
Effect of seed coat on germination and electric conductivity
xiii
93
Fig. 4.6
Effect of vitamin-B complexes supplementation in shoot
95
development under submergence
Fig. 4.7
Effect of SNP either singly or in combination with H2O2 under
96
submergence
Fig. 4.8
Effect of glucose, ABA and osbzip84 on shoot development
97
under submergence
Fig. 4.9
Effect of mitochondrial complex IV inhibition on shoot
98
development under submergence
Fig. 4.10 Gene expression patterns of selected amylases in either
99
coleoptile or caryopsis after submergence
Fig. 5.1
Comparative pigmentation of purple mutant with control plants
Fig. 5.2
Comparative total anthocyanin content in different parts of both 116
115
control and purple mutants
Fig. 5.3
Trichome density and distribution of control and purple mutant
118
Fig. 5.4
Stigma exsertion of purple mutant
119
Fig. 5.5
Percentage of seed setting in control, purple and humidified 120
purple mutant plants
Fig. 5.6
Comparative reproductive features of mutant plants
Fig. 5.7
ROS accumulation of whole stigma and stigmatic papillae level 123
121
in both control and purple mutant plants
Fig. 5.8
Seed setting in purple mutant panicles after humidification
124
Fig. 5.9
Phenotype of purple mutant progeny
125
Fig. 5.10 Relative expression OsbHLH13 in leaf, leaf sheath and 126
internode of both control and mutant plants
xiv
List of Abbreviations
ABA
abscisic acid
ABA8ox
ABA 8'-hydroxylase
ABA-GE
ABA-glucose ester
ABF
ABRE binding factor
abi
ABA insensitive
ABRE
ABA-responsive element
ano
anoxia
ATP
adenosine 5'-triphosphate
B1
thiamine
B2
riboflavin
B3
niacin
B5
pantothenic acid
B6
pyridoxine
BAP
6-benzylaminopurine
bHLH
basic helix-loop-helix
BRRI
Bangladesh Rice Research Institute
BVP
basic vegetative phase
bZIP
basic leucine zipper
CaMV
cauliflower mosaic virus
Col
Columbia
Cvi
Cape Verde Islands
cpm
counts per minute
xv
CYP
cytochrome
DAH
days after harvest
Din
diniconazole
DNA
deoxyribonucleic acid
DOG
delay of germination
DPA
dihydrophaseic acid
DPI
diphenylene iodonium
DWR
deepwater rice
EC
electric conductivity
EGL
enhancer of glabrous
era
enhanced response to exogenous ABA
ERF
ethylene-responsive factor
EUI
elongated uppermost internode
FAD
flavin adenine dinucleotide
FMN
flavin mononucleotide
FR
flood resistant
FW
fresh weight
GA
gibberellic acid
GA20ox
gibberellin 20 oxidase
GDP
gross domestic product
GL
glabrous
GOI
gene of interest
GWAS
genome-wide association study
H2DCF-DA
2',7'-dichlorodihydrofluorescein diacetate
xvi
H2O2
hydrogen peroxide
HBSS
Hanks’ balanced salt solution
IRRI
International Rice Research Institute
KD
Kaladigha
Lc
leaf color
min
minute
NADH
nicotinamide adenine dinucleotide
NaN3
sodium azide
NCED
9-cis-epoxycarotenoid dioxygenase
NO
nitric oxide
O2－
superoxide radical
OH．
hydroxyl radical
PA
phaseic acid
PAC1
pale aleurone color 1
PCD
programmed cell death
PCR
polymerase chain reaction
PEG
polyethylene glycol
PHS
preharvest sprouting
POSTECH
Pohang University of Science and Technology
PP2C
protein phosphatase 2C
PSP
photoperiod sensitive phase
PYL
PYR1-like
PYR1
pyrabactin resistance1
qRT-PCR
quantitative reverse transcription PCR
xvii
QTL
quantitative trait loci
RAP-DB
rice annotation project -database
rboh
respiratory burst oxidase
RCAR
regulatory components of ABA receptors
RIA
radioimmunoassay
rin
ripening inhibitor
RLD
root length density
RNA
ribonucleic acid
ROS
reactive oxygen species
rpm
revolution per minute
RSG
repression of shoot growth
RWC
relative water content
SAPK
stress activated protein kinase
SD
standard deviation
sdr
seed dormancy rice
sec
second
SK
snorkel
SLR1
slender rice-1
SLRL1
slr1 like-1
SNF1
sucrose nonfermenting 1
SNP
single nucleotide polymorphism
SNP
sodium nitroprusside
SnRK2
SNF1-related protein kinase 2
SS
Sarsari
xviii
Sub1
submergence 1
TF
transcription factor
TMV
tobacco mosaic virus
TT
transparent testa
TTG
transparent testa glabra
VIP
VirE2 interacting protein
YD6
Yang Dao 6
xix
xx
Chapter 1 Introduction
1.1 General Introduction
Rice (Oryza sativa L.) belongs to the family Poaceae. It is the single most
important crop of primary food source for half of the world’s population.
Interestingly, nearly all, i.e. 90% rice is produced in Asia (Maclean et al. 2002).
Rice accounts for 35% to 75% of the calories consumed by more than 3 billion
Asians. Moreover, rice is also the single most important food source of the poor.
It accounts over 70% of the daily calorie intake in some developing countries like
Bangladesh, Cambodia, Laos, Myanmar (Khush 1997). The majority of the
population in rice-producing areas, particularly in many Asian and African
countries, is still suffering from hunger, malnutrition and extreme poverty (Hirano
et al. 2008). It is projected that global rice production need to be doubled by 2030
to cope with the impending population increase (Li and Zhang 2013). This will
not be possible without new discoveries in breeding and growing methods as well
as development of new plant types with high yield potential (Varshney and
Koebner 2006).
Scientifically, rice is also very important since being a model crop plant offering
various advantages for functional genomics research (Varshney and Koebner
2006). Moreover, information obtained from rice is also helpful for studying other
cereal crops as these seem to have a monophyletic origin (Clark et al. 1995).
1.2 Rice ecosystems
Rice grows in different ecosystems. It can be classified in different ways. Some
countries like Bangladesh , classify rice ecosystems based on growing seasons and
it includes 1) boro (winter rice), 2) aus (summer rice), 3) transplanted aman
(autumn rice), 4) broadcast aman (typical deepwater rice-DWR), 5) Rayada (long
duration DWR), 6) ashwina (photoinsensitive DWR) and 7) hill rice (Khush
1997). Out of 7, three of them are flood-prone rice ecosystems i.e. deepwater rice
ecosystems. However, International Rice Research Institute (IRRI) classifies rice
ecosystems into four broad groups: i) irrigated, ii) rainfed lowland, iii) upland and
1
iv) flood-prone ecosystems (Fig.1.1) (Maclean et al. 2002). The distribution of
rice cultivation among these four ecosystems in Asia is shown in Figure 1.1.
Fig. 1.1 Distribution of rice cultivation among different ecosystems in Asia. (a)
irrigated lowland, (b) rainfed lowland, (c) upland, and (d) flood‐prone (deepwater)
rice. Adopted from Bouman et al. (2007).
1.2.1 Irrigated lowland ecosystem
Half of the global rice cultivated area covers irrigated ecosystem, accounts 75% of
global rice production (Fig. 1.1a). Generally semi-dwarf improved modern
varieties are cultivated in irrigated rice ecosystems. Genetic diversity of irrigated
rice ecosystem has been significantly narrowed due to high yielding varietal
dominance (Maclean et al. 2002).
1.2.2 Rainfed lowland ecosystem
Rainfed lowland ecosystem comprising about 34% of the global rice cultivated
area (Fig. 1.2b), is non-irrigated but lack of water control hence suffer from both
2
flood and drought, occasionally. The rainfed lowland rice ecosystem again can be
divided into four sub-ecosystems: (1) favorable rainfed lowland, (2) droughtprone, (3) submergence-prone, and (4) both drought and submergence-prone.
Both traditional and modern varieties are cultivated in these ecosystems
depending on risk prone nature of the respective areas (Maclean et al. 2002).
1.2.3 Upland rice ecosystem
Globally 13% of total world rice area with only 4% total world rice production is
from upland rice ecosystem (Fig. 1.1c). Since traditional cultivars are cultivated in
upland ecosystem hence overall productivity is very low (1 ton/hectare) (Maclean
et al. 2002). Several common features such as fine and large root systems, quick
recovery after stress, prompt stomata closure are associated with drought
tolerance, frequently found in in upland rice; hence considered as source of
drought tolerant novel genes.
1.2.4 Flood-prone ecosystem
Finally, the flood-prone ecosystem is the complex environment for rice
production for being variation of nature, depth and timing of flooding. This
ecosystem consists of several subtypes: 1) deepwater - flooding exceeding 100 cm
for 10 days to several months, 2) flash flood (more than 10 days), 3) costal tidal
areas, 4) problem soils due to excess water (Maclean et al. 2002). The main
production areas of deepwater rices are the deltas of the Ganges-Bramaputra river
of India and Bangladesh, the Mekong river of Vietnam and Cambodia, the
Irrawady River in Myanmar and the Chao Phraya river of Thailand (Fig. 1.1d)
(Maclean et al. 2002). Over 100 million people in South and Southeast Asia
largely depends on this ecosystem for their livelihood (Bhuiyan et al 2004).
Deepwater rices are exclusively local varieties or landraces. Generally, before the
monsoon, deepwater rice fields are broadcasted with traditional varieties. This rice
ecosystem represents about 8% of the total rice cultivation area. However, in
Bangladesh, almost 12 % of rice cultivation area under flood-prone ecosystem,
highest among rice producing countries (Fig. 1.1d and 1.2) (Maclean et al. 2002).
Bangladesh is rich in rice biodiversity due to its wide variation of land,
topography, and seasons. Almost 700 deepwater rice genotypes have been
3
collected from Bangladesh and stored in the BRRI and IRRI gene banks (Bashar
et al. 2004). Among them, Rayada rice is a specialized ecotype of deepwater rice,
completely endemic to certain area of Bangladesh (Perez and Nasiruddin 1974;
Catling 1992; Bashar et al. 2004).
Fig. 1.2 Total cultivation area of rice in different ecosystems in top five rice
producing countries in mid 1990s (Data adopted from Huke and Huke (1997).
1.2.4.1 Rayada ecotype
Genetic variation is the raw materials of evolution; define the genetic basis of
phenotypes. Ecotype is a population of a species developed with distinct
morphological or physiological characteristics due to specific environment and
persists even after changed to different environments (Lowry 2012). Ecotypes of
extreme environment or habitat are good source of novel genes because of natural
selection of adaptive mechanisms for survival in such extreme conditions whereas
artificial breeding activity has directed selection towards increasing economic
yield of cultivated species (Alonso-Blanco et al. 2009). So crop domestication and
subsequent selection or breeding narrowed the genetic diversity of most cultivated
varieties, hence ecotypes with endemic nature could still be good source of
genetic variation. Rayada is such an exceptional ecotype of deepwater rice,
completely endemic to only specific areas of Bangladesh (Perez and Nasiruddin
4
1974; Catling 1992; Bashar et al. 2004). Multiple distinct physiological features
of Rayadas are different than typical deepwater rice varieties. In addition, still it
shares some features of wild rices (Khush 1997). Tolerances to prolonged flood,
submergence and cold are special features along with strong photosensitivity and
lack of dormancy (Perez and Nasiruddin 1974; Catling 1992; Bashar et al. 2004).
Moreover, longer root system (Gowda et al. 2012) and prompt recovery make it as
an elite resource of stress tolerances. However, it has long been neglected because
of its yearlong life cycle and poor yield. Rayada type varieties might be
eliminated due to these two undesired traits (Vergara and Chang 1985). In this
thesis, we focus on Rayada specialty discussed in Chapter 2 and following three
chapters for specific traits with detailed studies.
1.3 Molecular mechanisms of adaptation to flood-prone area
Based on water depth, duration and geological pattern, flooding of rice fields can
be classified into two types: 1) flash flood, shallow depth with weeks duration and
2) deepwater or prolong flood of several months. Interestingly, some rice ecotypes
or land races posess efficient mechanisms of complete withstand both partial and
complete submergence.
1.3.1 Prolonged flood with partial submergence
All deepwater rices possess the special capacity of internode elongation after
flooding and efficiently adapted to prolong flooding of several months. Wild rice,
O. rufipogon is also able to withstand prolong flood by faster internode
elongation. Three hormones, ethylene, ABA and GA play key role to internode
elongation or adaptation to partial submergence. Hattori et al. (2009) identified the
Snorkel1 (sk1) and Snorkel2 (sk2) QTLs from deepwater rice with strong effect of
internode elongation. Over-expression of SK1 and SK2, driven by the rice actin
promoter, in non-deepwater rice result internode elongation, even in air. Snorkel
(SK) genes encoding ERF transcription factors, allow rice to adapt in deepwater
condition by enhancing GA responsiveness by an unknown manner (Fig. 1.3a)
5
(Hattori et al. 2009). However, the GA content increase in the deepwater rice after
flooding is slight (Hoffmann-Benning and Kende 1992; Hattori et al. 2009).
Moreover, still, how the snorkel genes enhance GA responsiveness is unknown.
Fig. 1.3 Two different strategies of survival of rice after flooding. a) deepwater
rices escape flooding stress by elongation of internodes mediated by ethylene and
snorkel genes that improves GA responsiveness , b) flash flood tolerant rice
overcome stress by quiescence strategy using SUB1A that restricts GA
responsiveness through GA repressors SLR1 and SLRL1 (adopted from Voesenek
and Bailey-Serres 2009)
1.3.2 Flash flood of complete submergence
Unfortunately, most modern varieties are highly susceptible to flash flood; die
within 7 days after complete submergence. However, some land races can tolerate
complete submergence up to 2 weeks using complete opposite mechanism of
deepwater rice; restrain elongation after submergence. FR13A is most tolerant
genotypes; 100% survival after 7 days submergence of 10 days seedlings. Several
physiological features are associated with complete submergence tolerance. These
are keeping high carbohydrate concentration with least elongation and optimized
alcoholic fermentation, up-regulation of antioxidant systems after desubmergence
and low synthesis or sensitivity to ethylene.
6
The QTL studies after cross between submergence tolerant line (IR 40931-26)
derived from FR13A with sensitive japonica line (PI543851) successfully
identified Sub1 QTL located on chromosome 9 that confer the submergence
tolerance (Bailey-Serres et al. 2010). This QTL defined 70% of the phenotypic
variance of submergence tolerance where FR13A was the donor of the phenotype.
In this locus, there are three similar genes, Sub1A, Sub1B and Sub1C. Recent
studies identified that submergence tolerant is governed by submergenceinducible Sub1A gene encodes an ethylene response factor (ERF) -type
transcription factor. However, other 2 genes (Sub1B and Sub1C) are also present
in some submergence intolerant varieties, not involved in submergence tolerance.
Sub1A decreases ABA content and significantly restricts ethylene stimulated GA
responsiveness by increased the accumulation of the GA signaling repressors,
Slender Rice-1 (SLR1) and SLR1 Like-1 (SLRL1) (Fig. 1.3b) (Xu et al. 2006;
Bailey-Serres et al. 2010). Interestingly, submergence tolerance capacity was
observed in 1950s, systematically screened in 1970s, finally Sub1A introgressed
into high yielding varieties (Swarna, Samba Mahsuri, IR64, Thadokkam 1,
CR1009, and BR11) and released recently in several countries including
Bangladesh (Bailey-Serres et al. 2010). So it takes 60 years to successful varietal
development journey of submergence tolerance from tolerant landraces.
So the tolerance to complete and partial submergence use complete opposite
strategy to overcome such stresses. Remarkably, similar type ERF transcription
factors (group VII of ERF subfamily) regulate these features where SKs increase
GA responsiveness, oppositely Sub1A restrict GA responsiveness. Interestingly,
in both cases reduction of ABA is a general phenomenon (Fig. 1.3a,b).
1.4 Seed dormancy and germination: two interrelated complex
processes
Seed dormancy and germination are two complex interrelated processes of plant
development. Seed germination is defined as physiological process culminating in
the emergence of the embryo after imbibition of dry quiescent seed and
subsequently become active metabolically and initiates the embryonic radicle and
7
or coleoptile growth (Bewley et al. 2013). Oppositely, seed dormancy is defined
as inherent inability of germination under favorable condition of germination.
Most plants seed at maturity are usually dormant. Seed dormancy could be several
consequences such as physiological, morphological, morpho-physiological,
physical and combinational (Finch-Savage and Leubner-Metzger 2006). In wild
plants, seeds dormancy is a common phenomenon. It ensures wild plants to
survive in unfavorable conditions. However, most cultivated species either loss or
alleviate the seed dormancy period to some extent for synchronous germination
along with rapid seedling establishment (Finch-Savage and Leubner-Metzger
2006). Lack of seed dormancy is a trait of crop domestication.
Since in earlier days rice was grown once a year (single crop) in most of tropical
and subtropical Asia hence, strong dormancy was not a problem. However, after
availability of short-duration, photoperiod insensitive varieties and the
development of irrigation facilities, double cropping of rice became a widespread
practice in Asia. So strong and prolong seed dormancy are not suitable with
double cropping system (Khush and Virk 2005).
The acquisition of germination capacity during seed development or complete
lack of dormancy can cause preharvest sprouting (PHS) or vivipary. It means the
germination occurs in humid conditions while seed is still attached to mother
plants, before the seed dispersal. Preharvest sprouting causes a great problem in
some cereals (e.g. rice, wheat, barley, sorghum) (Fig. 1.4a-d). However, vivipary
also can be equally an adaptive feature, for instance mangrove plant Rhizophora
mangle (Bewley et al. 2013). ABA biosynthesis or signaling mutants usually
result vivipary phenotypes. Key ABA biosynthesis gene, NCED mutant of maize
(vp14) shows vivipary phenotype (Fig. 1.4a). Similarly, ABA signaling mutant
vp1 or abi3 also shows vivipary. Recently, Sdr4, a QTL locus has been identified
in rice determining seed dormancy through the global regulator of seed maturation
player VP1. Wild rice O. rufipogon possesses Sdr4-k allele whereas japonica type
(Sdr4-n) shows at least two mutations (Fig. 1.4d-f) (Sugimoto et al. 2010).
Most seed dormancy is acquired during seed development and maturation when
the seed is still attached with mother plants. Maternally supplied ABA contributes
to seed maturation and desiccation. Dormancy is started early maturation stage
8
and continues to increase till fully mature seed (Fig. 1.5) (Raz et al. 2001). At
maturity both desiccation tolerance and primary dormancy establish. Several
hormones, most importantly, ABA plays important roles in seed development and
maturation. It includes a) promotion of accumulation of seed storage proteins, b)
acquisition of desiccation tolerance, c) induction and maintenance of dormancy
(Bewley et al. 2013).
Fig. 1.4 Vivipary or preharvest sprouting of different crops. (a) vp14 of maize, (b)
wheat, (c) rin tomato, (d) vivipary-susceptible japonca cv. Nipponbare, (e)
vivipary-resistant indica cv. Kasalath and (f) the near isogenic Nipponbare line
carrying dormancy QTL (Sdr4-k) from Kasalath. Figures adopted from Bewley et
al. (2013).
Generally, mutants of ABA biosynthesis or deficiency of ABA during seed
development lead to lack of primary seed dormancy. Oppositely, over-expressing
ABA biosynthesis genes result higher ABA accumulation in seeds, thus enhance
seed dormancy as well as delay seed germination. Moreover, regulation of ABA
catabolism also plays equal importance of acquisition and maintenance of seed
dormancy through regulating ABA content (Bewley et al. 2013). However, strong
and prolong dormancy is also regulated by the native capacity of ABA
9
biosynthesis of seed itself, not the maternal ABA source only, during
development and maturation (Holdsworth et al. 2008).
In most studied plants, ABA content increases during initial seed development
and decrease at maturity. However, seeds of arabidopsis, rapeseed, cotton, and
barley show two ABA peaks, one around mid-maturity another one at late
maturation (Bewley et al. 2013). ABA synthesis of both maternal and zygotic
tissue contributes first peak whereas last peak is due to ABA synthesized by from
zygotic tissues that regulates the induction and maintenance of dormancy. Apart
ABA content, responsiveness to ABA also play important role in dormancy.
ABA-insensitive mutants (abi1, abi2, and abi3) also show varying degree of
reduced dormancy. Oppositely, hypersensitivity of ABA (era1) enhances seed
dormancy. Recently, a major QTL for dormancy in arabidopsis reveals the
accumulation of DOG1 protein during seed maturation and remain stable
throughout seed storage and imbibition (Fig. 1.5) (Nakabayashi et al. 2012). Low
temperature enhances the DOG1 expression (Kendall et al. 2011).
Fig. 1.5 Generalized model of mechanism of seed dormancy induction and
release. Seed dormancy trends to increase during seed maturation with active
involvement of ABA whereas decrease during seed storage or after-ripening
period. GA and ABA act antagonistically, GA enhances germination whereas
10
ABA restricts. ROS accumulation decreases the dormant period (adopted from
Graeber et al. 2012).
1.5 ABA 8’-hydroxylases: key player after imbibition
ABA content depends on the balance among ABA biosynthesis, catabolism and
conjugation (Fig. 1.6). ABA catabolism is abundantly reported on regulation of
ABA homeostasis in many plants such as barley (Chono et al. 2006; Millar et al.
2006), Arabidopsis (Millar et al. 2006; Okamoto et al. 2006; Umezawa et al.
2006; Okamoto et al. 2010), bean (Yang and Zeevaart 2006), maize (Ren et al.
2007) and rice (Yang and Choi 2006; Saika et al. 2007; Zhu et al. 2009; Ye et al.
2012a). However, after imbibition no significant up-expression of ABA
biosynthesis occurs, rather ABA catabolic genes up-regulate before radicle
emergence, even after exogenous ABA application during imbibition (Kushiro et
al. 2004; Liu et al. 2010; Ye et al. 2012a). CYP707A2 is responsible for rapid
decrease of ABA during imbibition in Arabidopsis, and expectedly, cyp707a2
mutant shows hyperdormancy phenotype, accumulates 6 fold higher ABA than
normal (Kushiro et al. 2004). Moreover, triple mutant of ABA catabolic genes
cyp707a1a2a3 accumulates 70 fold higher ABA thus shows deep seed dormancy
(Okamoto et al. 2010). ABA catabolic pathway is rather simple than biosynthesis
(Ye et al. 2012b). Among the hydroxylated products of C-7’, C-8’, and C-9’, only
the 8’-hydroxyABA can be spontaneously isomerized to phaseic acid (PA) (Fig.
1.6) then further reduced to dihydrophaseic acid (DPA) (Nambara and MarionPoll, 2005). DPA does not have any biological activity of ABA. In rice, there are
three ABA 8’-hydroxylases (Saika et al. 2007; Yang and Choi 2006). Among
them, OsABA8ox3 is suppressed by glucose and delay glucose induced delay in
seed germination (Zhu et al. 2009). OsABA8ox1 higher up-regulates after reentering of water stressed plants (Ye et al. 2011). Moreover, up-regulation of
ABA8ox2 and 3 is also reported earlier in rice seed germination. Apart ABA
oxidation, ABA can be conjugated with sugar to form ABA-glucose ester (ABAGE) catalyzed by ABA glucosyltransferase (Fig. 1.6). Role of ABA catabolic
genes in dormancy regulation is already established, however, no clear indication
of ABA conjugation in dormancy regulation yet been established through
functional analysis of mutants or overexpressing lines. Neither atbg1 (Lee et al.
11
2006) nor bg2 (Xu et al. 2012) shows dormancy phenotype hence the role of ABA
conjugation in seed dormancy is more unlikely.
Fig. 1.6 Simplified ABA biosynthetic and catabolic pathways in plants. The
collective effect of biosynthesis, inactivation through 8’ hydroxylation and
conjugation defines the ABA content and physiological effect (adopted from Seki
et al. 2007).
1.6 ABA signaling pathway
Significant progress has been achieved in the last couple of years in understanding
ABA perception and signaling pathway, especially after identification of its
receptors in Arabidopsis. Generalized ABA signaling pathway is illustrated in Fig.
1.7. Two key regulators of ABA signaling are protein phosphatase 2C (group A
PP2C) and SNF1-related protein kinase 2 (subclass III SnRK2). SnRK2 is positive
regulator of the signaling pathway whereas PP2C acts negatively (Umezawa et al.
2010). Recent reports suggest that ABA signaling starts with binding of ABA to
the ABA receptors RCARs/PYR1/PYLs leads to inactivation of type 2C protein
phosphatases. The inactivation of protein phosphatases results the activation of
12
SnRK2 that targets ABA-dependent gene expression and ion channels
(Raghavendra et al. 2010).
So under normal conditions, PP2C constantly suppress kinase activity of SnRK2
through dephosphorylation, thus repress ABA signaling (Fig. 1.7). But when the
soluble ABA receptor recognizes the ABA molecule, it binds PP2C and inhibits
its phosphatase activity. Then SnRK2 is activated and phosphorylates its
downstream substrates, including bZIP transcription factors (AREB/ABFs) etc., to
activate ABA-responsive gene expression or other responses (Fig. 1.7) (Umezawa
et al. 2010). Kobayashi et al. (2004) have identified 10 SnRK2 protein kinases in
the rice genome and all family members are activated by hyperosmotic stress but
only three (SAPK 8, SAPK 9 and SAPK 10) are activated by ABA.
Fig. 1.7 Model on the major ABA signaling pathway. Detail description in the text
(Adopted from Umezawa et al. 2010)
13
1.7 ABA responsive transcription factors
Transcription factors (TFs) are any protein that takes part in DNA transcription
due to its ability to bind to DNA sequences but not the part of DNA polymerases.
Transcriptional control of gene expression is one of the key regulatory processes
of genes expression involved in many biological processes of plant growth and
development. Transcription regulators are thought to be the evolutionary switches
or dominant class of genes changed during the course of domestication (Doebley
and Lukens 1998; Doebley et al. 2006).
In rice, a total of 1611 transcription factor encoding genes comprises around 2.6%
in rice genome (Xiong et al. 2005). Plenty of experiments have identified several
transcription factors family that are upregulated in ABA upregulated situations
such water and salinity stress. It includes bZIP, zinc finger proteins, bHLH, NAC,
MYB, MYC, WRKY etc. (Rabbani et al. 2003; Shinozaki and YamaguchiShinozaki 2007 ; Chen et al. 2002; Seki et al. 2003; Oh et al. 2009). Among these
different transcription factor families, most responsive to ABA signaling as well
as water stress are bZIP, NAC, and MYB (Ashraf 2010). Moreover, some ciselements, bound by these transcription factors, have been identified. ABAresponsive element (ABRE, PyACGTGGC), an important cis-element, is
associated with the transcriptional regulation of ABA- and/or stress-responsive
genes. In plants, ABRE binding factors (ABFs)/ABRE binding proteins (AREBs)
are basic region leucine zipper (bZIP) class TFs (Jakoby et al. 2002) . In our
study, we selected bZIP as candidate transcription factor family.
1.7.1 bZIP transcription factors
The bZIP proteins compose a large family of transcription factors having bZIP
domain composed of a basic region and a leucine zipper (Jakoby et al. 2002). The
more conserved basic region is responsible for sequence specific DNA binding,
whereas the less conserved leucine zipper region confers dimerization specificity.
In plants, bZIP transcription factors regulate different cellular processes including
seed maturation, flower development, pathogen defense, light and stress signaling
(Jakoby et al. 2002, Nijhawan et al. 2008). bZIPs preferentially bind to DNA
14
sequences with an ACGT core. Binding specificity is also regulated by flanking
nucleotides. Plant bZIPs preferentially bind to the A-box (TACGTA), C-box
(GACGTC) and G-box (CACGTG) although there are also examples of
nonpalindromic binding sites (Jakoby et al. 2002). By analyzing the promoters of
ABA-inducible genes, it was found that ABA-responsive gene expression requires
multiple cis-elements, designated as ABA-responsive elements (ABREs) or the
combination of an ABRE with a coupling element (Jakoby et al. 2002).
1.7.2 bZIPs in rice
There are 89 bZIP transcription factor-encoding genes in rice genome (Nijhawan
et al. 2008). However, Plant Transcription Factor Database version 2 (Zhang et al.
2011) indicates 99 in indica spp. and 140 in japonica whereas Lu et al. (2009)
reports 84. To date, several bZIP transcription factors have been identified or
functionally characterized from rice. Among these, TRAB1 (bZIP66) (Hobo et al.
1999), OsABF2 (bZIP46) (Hossain et al. 2010a), OsbZIP23 (Xiang et al. 2008),
OsABF1 (bZIP12) (Hossain et al. 2010b), OSBZ8 (bZIP05) (Nakagawa et al.
1996; Lee et al. 2003), OsbZIP72 (Lu et al. 2009), OsbZIP16 (Chen et al. 2012),
OsbZIP71 (Liu et al. 2013) are positive regulators of ABA signaling, enhances
abiotic stress tolerance. OsbZIP50 (named OsbZIP74) is associated with heat
stress and salicylic acid mediated systemic acquired resistance (Lu et al. 2012).
Moreover, a bZIP transcription factor, OsABI5, is involved in rice fertility and
stress tolerance (Zou et al. 2008). Two bZIPs, LIP19 (bZIP38) (Shimizu et al.
2005) and OsOBF1 (bZIP87) (Aguan et al. 1993) are involved in cold signaling.
OsZIP-1a has a putative role in induction of the Em gene promoter by ABA
(Nantel and Quatrano, 1996). OsbZIP58 regulates starch biosynthesis (Wang et al.
2013). RISBZ1 (Onodera et al. 2001) and RITA-1 (Izawa et al. 1994), involves in
the regulation of rice genes expressed during seed development (Yamamoto et al.
2006) and REB is a transcriptional activator in rice grains (Yang et al. 2001).
RF2a and RF2b function in vascular development and also play a role in symptom
development of rice tungro disease. OsbZIP52/RISBZ5 could function as a
negative regulator in cold and drought stress environments (Liu et al. 2012).
OsbZIP39 is involved in the regulation of many ER stress-responsive genes
15
(Takahashi et al. 2012). Other rice bZIP proteins, RISBZ4, RISBZ5, OsZIP-2a
and OsZIP-2b functions are not clear (Nantel and Quatrano 1996; Dai et al. 2003,
2004; Nijhawan et al. 2008). Rest others still to functionally characterize.
1.8 Crosstalk between ROS and ABA signaling
The atomic structure and spin restriction of impaired electrons of O2 molecules
give rise to reactive oxygen species if partially reduced. Reactive oxygen species
(ROS), including superoxide (.O2-), hydrogen peroxide (H2O2) and hydroxyl
radicals (•OH) are reactive molecules of oxygen resulting from the incomplete
reduction of molecular oxygen. Being potential damaging capacity, high ROS
leads the ‘oxidative stress’ concept, however, recent studies clearly identified
ROS as more ‘oxidative signaling’ components, rather ‘oxidative stress’
molecules (Foyer and Noctor 2005). Now it is widely accepted that ROS are key
regulators of plant metabolism, growth, development and certainly pathogen
defense (Rio and Puppo 2009). Chloroplasts, mitochondria and peroxisomes are
the major source of ROS production in plant cells. Among different ROS, being
the most stable and ability to cross plant membranes and hydrogen peroxide is the
well-studied molecule for cell to-cell signaling.
ROS accumulation and seed germination appear to be linked together (Fig. 1.5).
Progressive ROS accumulation after imbibition of after ripened seed has already
been evident (Leymarie et al. 2012). Incubation of dormant sunflower seeds in the
presence of ROS inducing compounds such as hydrogen cyanide or methyl
viologen also alleviate seed dormancy (Oracz et al. 2007). Moreover more ROS
accumulation is also evident in arabidopsis non-dormant seeds than that of
dormant seeds whereas NADPH oxidase mutant (rbohD) shows deep dormancy
(Leymarie et al. 2012). After ABA treatment, suppression of hydrogen peroxide
(H2O2) occurs in barley aleurone cells whereas induced by GA (Fig. 1.5).
Exogenous (H2O2) both enhances seed germination as well as alleviates seed
dormancy in many plants along with enhanced seedling establishment.
Oppositely, exogenous ABA application restricts ROS accumulation (Ye et al.
2012a)
16
Reactive oxygen species are also essential for leaf extension in the elongation
zone of maize leaves (Rodriguez et al. 2002), root hairs and pollen tube growth
(Foreman et al. 2003, Potocky et al. 2007), auxin signaling and gravitropism (Joo
et al. 2001). Root hair defective 2 (rhd2) mutant of arabidopsis cannot accumulate
ROS at the hair tip and fail to develop afterwards the initiation stage. The role of
ROS in programmed cell death (PCD) has become an important topic in recent
years (Breusegum et al. 2008). In deepwater rice, both aerenchyma formation and
adventitious root initiation require PCD mediated by H2O2 (Steffens and Sauter
2009; Steffens et al. 2011). Moreover, in several systems, it has been shown that
ROS can modulate the activity of specific transcription factors, thereby directly
affecting gene expression. Moreover, DELLA proteins can regulate plant growth
and defense processes by modulating the levels of ROS (Achard et al. 2008).
ABA can interact with both the production and signaling functions of ROS. ABA
induced H2O2 production is involved in stomatal closure in in V. faba guard cells
(Zhang et al. 2001). ABA is the key inducer of H2O2 production in leaves of
maize plants under water stress (Hu et al. 2006).
1.9 Seed germination under submergence
Seed germination under submergence is much more complex than that of aerobic
condition as complete submergence always leads to oxygen deficiency where
oxygen is one of the prerequisites of seed germination. Most of the cereals are
highly susceptible to submerged seed germination. However, among them, only
rice is exceptional, possesses efficient capacity to germinate under submergence
or complete anoxic condition (Ismail et al. 2012). However, the germination
pattern is typically different than that of aerobic condition as completely lack of
development of root under submergence, only the coleoptile develops. However,
inability of subsequent shoot development results failure of seedling
establishment thus causes significant loss of rice in direct seeded fields if sallow
flooding or waterlogging occurs after direct seeding. However, direct seeding is
popular method in irrigated and rainfed along with flood-prone ecosystems
(Ismail et al. 2012).
17
Submergence tolerance during seed germination is a rare phenomenon in cereals,
even among angiosperms. Only a few species can successfully germinate under
water. It includes Trapa natans, Erithrina caffra, Nuphar luteum, Scripus
mucronatus, Echinochloa spp. Except Trapa natans, all others germinate only
with shoot, and no root develops. But, germination with radicle emergence
happens only to Trapa natans (Jackson et al. 1996).
In rice, after large scale screening of over 8000 germplasms, only a few varieties
(19) are found capable of efficient seedling establishment after complete
submergence (Angaji et al. 2010; Ismail et al. 2012). Subsequent studies identify
only a few (5 to 6) tolerant genotypes, (Khao Hlan On, Khaiyan, Kalonchi, Nanhi,
Ma-Zhan Red and Cody (Fig.1.8a) (Angaji et al. 2010; Ismail et al. 2009; Miro
and Ismail 2013). Phenotypic comparison of tolerant and intolerant genotypes is
shown in Figure 1.8b.
Interestingly, initial screening also identified a Bangladeshi deepwater rice
variety, Dholamon 64-3 as a tolerant variety with higher survival percentage
(80%) (Fig. 1.8a) (Angaji et al. 2010). Moreover, Yamauchi et al. (1993) also
identified germplasms of Bangladesh that are adapted to deepwater condition
showed superior performance among tested genotypes. Since Rayadas are more
primitive than typical deepwater rice, completely endemic to Bangladesh, well
adapted to flooding condition along with practice of direct seeding, so the
capacity of submergence tolerance during seed germination in Rayada varieties
demands exploration.
18
Fig.1.8 Submergence tolerant cultivars during seed germination (a) and phenotype
of comparative tolerance (b). list of submergence tolerance cultivars was adopted
from Angaji et al. (2010). Image of phenotypic tolerance was downloaded from
IRRI Flickr account: IRRI images’ photo stream (publicly available at
http://www.flickr.com/photos/ricephotos/2199544108/in/photostream/,
and
labeled according). IR64 and IR42 are submergence sensitive varieties; oppositely
Khao Hlan On and Khaiyan are tolerant genotypes.
Only few physiological differences have been identified comparing tolerant
genotypes with intolerant one. It includes keeping high soluble sugar, as well as
high expression of Ramy3D whereas the progressive decline of starch content
intolerant genotypes (Ismail et al. 2009; Ismail et al. 2012; Miro and Ismail 2013).
Two QTL studies using crossing tolerant genotypes (Khao Hlan On, Ma-Zhan
Red) with intolerant (IR64, IR42), respectively , identified several QTLs but they
only share limited regions (Angaji et al. 2010, Septiningsih et al. 2013) . The
specific genetic basis of submergence tolerance is still in an enigma.
1.10 Anthocyanin biosynthesis and trichome development: linked
processes
One of the most intensively studied metabolic systems in plants is flavonoid
biosynthesis pathways. One of the specific branches of flavonoid biosynthesis
pathways develops anthocyanin. Anthocyanin is one of the major pigments of
plants defining red to blue colors in vegetative, reproductive as well as storage
organs. The exact role of anthocyanins in plant growth and development is a
matter of debate although classically explains the functions with photoprotection
of chloroplasts; attenuation of UV-B radiation and free radical scavenging or
antioxidant activity. However, recent studies suggest modulating role of
anthocyanins in reactive oxygen signaling cascades involved in plant growth and
development, as well as responses to stress (Hatier et al. 2009).
19
Similarly, leaf trichomes also play important role in biotic and even abiotic stress
tolerances. Moreover, trichome development is an excellent model system for
studying different aspect of cell differentiation apart biological significances (An
et al. 2011). Recent studies confirm the intimately connected process involved in
both anthocyanin biosynthesis and trichome development. A ternary activator
complex (MYB-bHLH-WDR) comprising of R2R3 family MYB transcription
factor (TF), a basic helix-loop-helix (bHLH) TF and a WD40 protein (Fig. 1.9a),
regulate the spatiotemporal expression of structural genes involved in anthocyanin
biosynthesis and trichome development (Patra et al. 2013). In Arabidopsis,
GLABROUS 1(GL1- an R2R3-MYB TF), GLABROUS 3 (GL3) and
ENHANCER OF GLABROUS 3 (EGL3) (both are bHLH transcription factors)
together with TRANSPARENT TESTA GLABRA 1 (TTG1, a WD40 protein)
regulate the structural genes of anthocyanin biosynthesis and trichome
development (Fig. 1.9a) (Patra et al. 2013).
Based on bHLHs structural features, it seems bHLHs act as docking protein
between MYB and WD 40 proteins (Fig. 1.9b). In Arabidopsis, anthocyanin and
trichome regulating bHLHs belonged to subgroup IIIF (Heim et al. 2003). The
basic region of the bHLH domain consisting of 15-17 amino acids interacts with
“CANNTG” consensus sequences of DNA. N-terminal acidic regions (MIR-MYB
interacting region, 200 amino acids) interact with MYB transcription factors (Fig.
1.9b). The next negatively charged region (about 200 amino acids) might be
necessary for interaction with WD40 proteins and/or the RNA polymerase III
complexes (Fig. 1.9b) (Hichri et al. 2011). Finally, the C-terminal HLH region is
responsible for either homo (such as GL3) or heterodimerization (such as
GL3/EGL3) (Hichri et al. 2011) (Fig. 1.9b).
A recent study on maize Lc (bHLH) by Tominaga-Wada et al. (2012) identifies
regulation trichome development by N-terminal region whereas full length is
necessary for anthocyanin synthesis (Fig. 1.9c). Ectopic expression of Lc in
different plants like petunia (Fig. 1.9d) (Bradley et al. 1998), alfalfa (Ray et
al.2003), tomato (Bovy et al.2002), and Arabidopsis (Lloyd et al. 1992) develops
pigmented organs.
20
Fig. 1.9 Simplified anthocyanin biosynthesis and trichome development
regulation. a) ternary activator complex comprising R2R3 family MYB
transcription factor (TF), a basic helix-loop-helix (bHLH) TF and a WD40
protein, b) general structure of the bHLH transcription factors regulating
flavonoid biosynthesis and trichome development, c) diagrammatic representation
of R type bHLH parts required for both trichome and anthocyanin synthesis, d)
ectopic expression of maize Lc (bHLH) in petunia under high-light conditions.
Diagrams and figures adopted from (a) Koes et al. 2005, (b) Hichri et al. 2011, (c)
Tominaga-Wada et al. 2012, and (d) Albert et al. 2009).
21
1.11 Objectives of this study
The generalized aim of the study was to reveal the special traits of Rayada rice.
Hence for the first time, we comprehensively reviewed and reexamined the
special features of Rayadas (described in chapter 2). In addition, we studied in
details, one of the notable physiological traits of Rayada rice, the lack of
dormancy that is distinctly different from typical deepwater rice. We identified
both physiological and molecular bases of the lack of seed dormancy (described in
chapter 3). Furthermore, we characterized submergence tolerance capacity during
seed germination of Rayada rice varieties that are rare in rice, even among cereals
(described in chapter 4). Finally, we identified a novel mutant in Rayada rice
background having multiple interesting phenotypes with practical implications,
especially in hybrid rice technology (described in chapter 5). So specifically our
studies will answer several key questions of Rayada rice and these are:
1.
What are the special features of Rayada rice? And how they are
different from typical deepwater rice?
2.
What is the molecular and physiological basis of lack of dormancy
in Rayada rice?
3.
Are H2O2 and riboflavin the key signaling molecules of shoot
development under submergence?
4.
What are the factors that negatively regulate submergence
tolerance?
5.
How red or purple pigmentation of stigma can lead to sterility?
22
Chapter 2 Rayada specialty: the forgotten resource of
elite features of rice
2.1 Introduction
Flood and rice are two indispensable features of Bangladesh landscape, one of the
most flood-prone countries in the world. Most areas of this country are less than 5
meters above sea level and hence almost every year, more than 20% areas become
inundated with an additional 42 % with risk of inundation of varied intensity (Fig.
2.1) (Ahmed and Mirza 2000; Dasgupta et al. 2011).
Rice is the lifeline of Bangladesh as it accounts for 76% of the daily calorie intake
and 66% of protein needs for more than 94% of the population. Moreover, rice
production contributes to 18% of national GDP and 55% of labor employment
(Nasiruddin and Hassan 2009). Rice grows all the seasons round the year in
Bangladesh. Beyond as staple food, rice is the culture and heritage of Bangladesh.
Huge genetic diversity of rice exists in Bangladesh; among over 113,000 IRRI
genebank accessions, 14,931 accessions are from Bangladesh (Wang et al. 2013).
Still now more than 1,000 local varieties/landraces are cultivated in Bangladesh
(Hossain and Jaim 2012).
Fig. 2.1 Flood-affected areas of Bangladesh.
23
2.2 Deepwater rice in Bangladesh
Deepwater rice is one of the special rices cultivated in Bangladesh since time
immemorial. Deepwater rice, locally regarded as Broadcast aman, is defined as
rice cultivated in flood plain deeper than 50 cm for one month or longer during
the growing season (Catling et al. 1988; Catling 1992). In 2005-06, deepwater rice
(Broadcast aman) was cultivated in 505.46 thousand hectare area, i.e. 4.08% of
total rice cultivation area (Fig. 2.2a). In comparison, deepwater rice cultivation
area was 18.14 % in 1971-72 (Fig. 2.2a). The gradual decreasing trends of
deepwater rice cultivation over the past 34 years was due to the increasing
cultivation of high yielding modern varieties with irrigation facilities in boro
season since the yield of deepwater rice is generally low. The yield of deepwater
rice over this period has always been around 1 ton/hectare (Fig. 2.2b), implying
the absence of varietal development, whereas yields of other rice types have
increased gradually due to both improved modern varieties and agricultural
practices.
Fig. 2.2 Status of deepwater rice cultivation in Bangladesh. Comparative scenario
of cultivation area (a) and average yield (b) of deepwater (DWR) and total rice
cultivation in Bangladesh from 1971-72 to 2005-06. Data were collected from
Bangladesh
Agricultural
Research
http://www.barc.gov.bd)
24
Council
website,
available
at
2.3 Types of deepwater rice in Bangladesh
There are three major types of deepwater rice cultivated in Bangladesh. They are:
1) Typical deepwater, 2) Bhadoia/Ashwina and 3) Rayada (Table 1) (Catling
1992; Bashar et al. 2004). All of them are collectively considered as deepwater
rice having similarity in elongation capacity after rising flood water level, kernel
color and yield, although there are some distinct differences among them,
especially to Rayada rice. Ashwina/Bhadoia are almost similar to typical
deepwater rice except less or no sensitivity to photoperiods (Bashar et al. 2004)
and they usually flower in Bengali calendar months of Bhadra/Ashwin
(August/September), hence coined the term Bhadoia / Ashwina (Haque 1974).
Among these three types, Rayadas are most primitive, still sharing some features
of wild rices (Khush 1997).
2.3.1 Rayada rice
Rayadas are unique rice ecotypes, distinctive group of deepwater rice, totally
endemic to Bangladesh, grown only in certain areas of Madhumati river tracts and
have multiple physiological features different from typical deepwater rice (Table
1) (Perez and Nasiruddin 1974; Catling 1992; Bashar et al. 2004). They are
photoperiod insensitive in early vegetative stage but strongly sensitive for
flowering in late vegetative stage (Vergara and Chang 1985). Moreover, they
completely lack seed dormancy, typically different to other deepwater rices along
with longer life cycle. However, there are two types of Rayada rice based on
duration of their life cycle i.e. (1) 12 months Rayada and (2) 6-8 months Rayada
(Table 1) (Perez and Nasiruddin 1974; Bashar et al. 2004). Rayada rice was
described as distinct group in very early literature (Watt 1891). Some biochemical
studies also identified and supported its separate status to deepwater rice
(Glaszmann 1987). Rayada rice was ranked separate group (Group-IV) from
typical deepwater rice varieties (Group-III) based on fifteen polymorphic loci
coding for 8 enzymes on 1688 traditional Asian varieties. In our study, we focuses
on specialty of Rayada rice; elaborated their physiological and other features that
are distinctly different from typical deepwater rice.
25
Table 1 Comparative features of different types of deepwater and wild rice (O. rufipogon) of Bangladesh.
Wild rice
Features
Typical deepwater rice
Ashwina / Bhadoia
Rayada rice
(O. rufipogon)
Elongation ability after
flooding
yes
yes
yes (faster)
yes (faster)
Life cycle (months)
6-8
6-8
12 and 6-8
perennial
Cold tolerance
no
no
yes
varying degree of
tolerance
varying degree of
sensitivity
less or no
strongly sensitive
sensitive
Seed dormancy
high
high
no
high
Responsiveness of short day
in early vegetative stage
yes
yes
no
(not known)
South and Southeast
Asia
Bangladesh and
India
Bangladesh
South and Southeast
Asia, Latin America,
Australia, West- Africa
Habigonj Aman I -VIII
Ashwina
Kaladigha, Beto
Jhoradhan
Photoperiod sensitivity
Distribution
Examples
26
2.4 Distribution of Rayada
The Rayada rice is only cultivated in certain areas of natural lowland (locally
called beel) beside the Madhumati river. The Rayada growing area is estimated at
5,180 hectares bordered by Sreepur, Magura (North) to Mollahat , Bagerhat
(South), Magura and Narial (West) to Gopalgonj (East) (Fig. 2.3, R marked area)
(Perez and Nasiruddin 1974). However, the 12-month Rayada is only cultivated at
Kalia in Narail, Mollahat in Bagerhat, and Gopalganj (Perez and Nasiruddin 1974;
Bashar et al. 2004) whereas, typical deepwater rice is cultivated throughout the
country except three hill tract districts. Deepwater rice cultivation areas can be
divided into mainly two zones. Zone-1 includes greater Faridpur, Jessore, Kushtia,
Rajshahi and Pabna districts whereas zone-2 encompasses greater Sylhet,
Comilla, Tangail, Dhaka, Noakhali and Mymensingh districts (Ahmed 1974). Soil
properties of these two zones are generally different i.e. zone-1 characteristically
natural to alkaline, rich in calcium and phosphorus but deficient of nitrogen and
potassium. Oppositely, soil of another group is distinctly acidic, poor in calcium
and phosphorus and comparatively higher in nitrogen and potassium (Ahmed
1974). Interestingly, Rayadas are only available in zone-1, shown in Fig. 2.3.
Long term (1948-2008) climatic features (month-wise average rainfall, humidity,
temperature and bright sunshine) of Rayada growing area are illustrated in Fig.
2.6.
27
Fig. 2.3 Distribution of Rayada rice in Bangladesh. Only the R (Rayada) marked
areas (approximate) have Rayada rice cultivation.
2.5 Yearlong life cycle
Numerous morphological and physiological differences exist among rice varieties
(Chang and Bardenas 1965). For instance, some varieties mature within 80 days
whereas Rayada needs a year to complete its life cycle (Khush 1997). Rayadas are
cultivated rice of longest life cycle in Bangladesh. It is traditionally cultivated as
mixed crop with boro in November/December. Boro is harvested in April/May
before onset of flood while Rayada keeps growing and is harvested in the next
28
November/December (Perez and Nasiruddin 1974; Bashar et al. 2004). So from
seedling to harvest is around 12 months or a year. Water level increases in around
June, peaks in early August and recedes by the end of September or early October.
Rayada usually flowers after flood water recedes in late September
(Hasanuzzaman 1974), at that time day length already becomes shortened to
induce flowering. Rayada type varieties might be eliminated because of very long
life cycle (Vergara and Chang 1985).
2.6 Elongation ability of Rayada
It is evident that deepwater rice elongates its internode after flooding as a survival
strategy (Keith et al. 1986). However, the pattern of Internode elongation of
Rayada is not clearly evident. In our experiments, interestingly, we observed all
internodes under water were significantly elongated after prolonged inundation
(Fig. 2.4a) and plants became more than 3 meters tall (Fig. 2.4d). Artificial
inundation induced internode elongation of 2-4 times longer than control (Fig.
2.4a, c). Notably, basal internode above soil was found equally elongated to
middle internodes and significantly different from control plants (Fig. 2.4a, c). We
also compared internode elongation pattern of Rayada variety, Kaladigha with
typical deepwater rices (Habigonj aman I-VIII) reported earlier (Hasanuzzaman
1974). Both air grown plants showed an almost similar pattern except much
elongated distal nodes in typical deepwater rice (Fig. 2.4a). However, the basal
Internode elongation pattern in Rayada was significantly different from that of
deepwater rice. Some middle internodes of typical deepwater rice became similar
to air grown plants (Fig. 2.4a). In addition, numbers of nodes were found
significantly increased after inundation in both types, deepwater varieties showed
more internodes than Rayada because of natural flood grown condition whereas
Rayada variety was grown in greenhouse in 2.5 meter water tube (Fig. 2.4a,b).
Internodes above the water level became same as control but developed both
primary and secondary nodal tillers. However, highest elongated internode was
the elongated uppermost internode (EUI) both in control and inundated plants
(Fig. 2.4a). The eui mutant was reported to accumulate exceptionally large
29
amounts of biologically active gibberellins (GAs) in the uppermost internode (Zhu
et al. 2006).
Fig. 2.4 Internode elongation pattern of Rayada after inundation. (a) internode
elongation pattern of Rayada and typical deepwater rice (Habigonj amam I-VIII
after Hasanuzzaman (1974), (b) number of nodes per plants, (c) phenotypic
comparison of basal internodes (above soil) of Rayada rice between control and
inundated condition (bar = 5cm), (d) comparative phenotypes BRRI52,
Kaladigha, and inundated Kaladigha (left to right, respectively) at plants maturity.
Rayada variety, Kaladigha plants (4.5 months old) were grown in water tube with
increasing water level keeping top leaves above water for 45 days reaching 2.5
meter. Then the plants were kept under around 2.5 meter inundation (water
renewal fortnightly) for rest of months (around 7 months) till seed mature. Basal
30
internodes/nodes (3-4) beneath the soil were excluded in estimation and
comparison.
2.7 Submergence tolerance
Tolerance or resistance to complete submergence and partial submergence are
regulated by similar type ERF (ethylene response factor) transcription factors by
opposite mechanism. Under complete submergence, SUB1 restricts GA
responsiveness by enhanced SLR1 expression (Xu et al. 2006; Bailey-Serres et al.
2010) whereas in partial submergence, SK genes enhance GA responsiveness by
some unknown mechanisms (Hattori et al. 2009). Some aus ecotypes such as
FR13A has SUB1A gene whereas deepwater even wild rice species possess SK
genes for internode elongation (Hattori et al. 2009). Rayada rice is efficiently able
to elongate its internodes after partial submergence. Similarly, in our experiments
we imposed 2.5 meter submergence of equal sized plants and found equal
capacity to withstand complete submergence of 2 weeks with similar performance
to Sub1A introgressed rice (BRRI 52) (Fig. 2.5abc). But chlorosis or senescence
of older leaves was more prominent in Rayada rice (Fig. 2.5 b, e). However,
significant reduced senescence was observed in Sub1A introgressed variety,
almost one third to Rayada variety (Fig. 2.5c,e). However, senescence of older
leaves is common in deepwater rice varieties even under partial submergence.
Despite older leaves senescence, survival performance showed no significant
difference (Fig. 2.5 d). Similar observation of complete submergence tolerance
was also previously reported in Rayada rice (Perez and Nasiruddin 1974).
Complete submergence tolerance of Rayada rice might be regulated by SUB1A or
some other means. However, two Sub1A like alleles (OrSub1A-1, OrSub1A-2)
have already been reported in wild rice O. rufipogon (Li et al. 2011). So it is more
likely that Sub1A type submergence tolerance regulates complete submergence in
Rayada rice.
31
Fig. 2.5 Comparative submergence tolerance of Sub1A introgressed variety, BRRI
52 with Rayada variety, Kaladigha. a) before submergence, b) 14 days after
submergence, c) 2 days after de-submergence, d) survival performance , e) leaf
senescence . Plants of equal height (Kaladigha and BRRI 52 of 3 , 4.5 months ,
respectively) were completely submerged under 2.5 meter water for 14 days in
water tube in greenhouse condition of 14/10 hrs. day-night cycle. Submergence
tolerance
performance
was
calculated
2
days
after
de-submergence.
Representative image and figure were from two independent biological replicates.
2.8 Seed dormancy
Prolonged seed dormancy is one of the distinctive features of the deepwater rices
(Beachell 1975). Deepwater rice cultivars have a dormancy of 25-56 days (Catling
1992). Moreover, most wild rices also have strong seed dormancy (Cai and
Morishima 2000). Dormancy is essential for deepwater rice to prevent inadvertent
germination prior to harvesting of mature seeds while still on plant under high
32
humid or wet even inundated conditions. Among deepwater rices, Rayada is the
only exception, having no seed dormancy. Since yearlong life cycle, Rayada seeds
are sown within weeks or even days after harvest (Catling 1992). We also
reexamined this feature and found efficient seed germination after freshly
harvested (data shown in chapter 3, Fig 3.1). Lack of seed dormancy seems an
adaptive feature of Rayada rice because of year long life cycle, highly
photosensitive nature and flowering after flood water recedes. Moreover, during
seed maturation period (late October-November), the rainfall, humidity and
temperature, drop to lower extent to avoid unexpected germination (Fig. 2.6abc).
Fig. 2.6 Climatic features of Rayada rice growing areas. a) average rainfall, b)
humidity and c) lowest and highest temperature and d) bright sunshine hour. Long
term (1948-2008) (a-c) average climatic status of Rayada rice growing areas were
calculated based on data of two nearby weather stations (Faridpur and Jessore).
Database of bright sunshine hours is only limited to 1967-2008 (Jessore) and
1985-2008 (Faridpur). Metrological data were collected from Bangladesh
Agricultural Research Council website (http://www.barc.gov.bd/data_stat.php).
33
2.9 Cold tolerance
Generally japonica rice is considered more cold tolerant than the indica (Andaya
and Mackill 2003). Among indicas, cold tolerance is another important feature of
Rayada rice and distinctive feature from typical deepwater rice (Catling 1992).
Rayadas are tolerant to chilling temperature of 10°C. In the winter months the
lowest temperature drops to around 10°C in the Rayada growing areas (Fig. 2.6c)
and the plants across whole winter months during its initial vegetative growth
stages. Typical deepwater rice is usually planted in April-May after the
temperature rises (Fig. 2.6c) whereas Rayadas in November-December (Perez and
Nasiruddin 1974; Bashar et al. 2004). We also re-examined the cold tolerance of
Rayada by incubating plants in chilling temperature of 10°C for 4 days which
resulted aus cultivars to cold injury whereas Rayada varieties showed no effect at
all (Fig. 2.7).
Fig. 2.7 Comparative phenotype of cold tolerance of (a) Rayada variety,
Kaladigha with (b) upland rice, Manikmodhu. Three months old plants were
incubated chilling temperature of 10°C for 4 days. Similar phenotypes were
observed in 2 biological replicates.
34
2.10 Longer root system of Rayada
Longer root system is unanimously considered as the feature of drought
adaptation or tolerance (Blum 2011). Upland rice usually has longer root system
and is hence adapted to drought prone area. Single nucleotide polymorphisms
(SNPs) among 20 diverse rice varieties and landraces (OryzaSNP panel) including
Rayada have been identified for deep exploration of rice diversity and gene-trait
relationships and eventually for future rice improvement (McNally et al. 2009).
Henry et al. (2011) evaluated variation in root system architecture and drought
response among these 20 diverse rice genotypes of OryzaSNP panel and identified
the aus isozyme group, particularly Dular genotype having highest drought
resistance by deeper root growth with highest drought response index. Similarly,
Gowda et al. (2012) examined root growth, water uptake and shoot growth among
these 20 OryzaSNP panel under both well-watered and water-stressed conditions.
We compared root growth pattern of Rayada to Dular genotype from their
(Gowda et al. 2012) results. After analyzing their data, we identified longer root
system of Rayada, even better than Dular both in well-watered and water-stressed
condition (Fig. 2.8a). In well-watered condition, Rayada showed root length
density (RLD) of 12.87 cmcm-3 in surface to 30 cm soil profile, more than 5 times
higher than Dular (2.50 cmcm-3) (Fig. 2.8a). Interestingly , in water-stressed
condition from surface to 100 cm depth , RLD of Rayada was always higher than
Dular, especially at 30-45 cm soil profile, more than doubled in Rayada (RLD
3.77 cmcm-3) than Dular (1.60 cmcm-3) (Fig. 2.8a). However, inappropriately,
Gowda et al. (2012) generalized Rayada as aus group although they are distinctly
different in all aspects of growth and development.
We have also re-examined root growth capacity at seedling establishment stage
among selected Rayada, typical deepwater rice, flood tolerant and aus varieties.
Although variation existed among ecotypes/ varieties but we observed that
Rayadas always displayed longer root systems (Fig. 2.8b,c). Some upland
varieties (eg. Dudsor and Boupagol) also showed elevated root growth initially
but Rayada varieties superseded that due to higher growth rate (data not shown).
Flash flood tolerant Sub1A varieties (BRRI51and 52) showed least growth for
35
root and shoot (Fig. 2.8bc). Month old seedlings showed distinct differences in
phenotypes, especially in root length in Rayada variety, Kaladigha (Fig. 2.8b).
Fig. 2.8 Comparative root growth of Rayadas with other varieties in different
conditions. a) comparative root length density between Rayada and Dular both
well-watered and water-stressed conditions, figure generated from data of Gowda
et al. (2012), b) phenotypes of months old seedlings of selected varieties of
Rayada, flood tolerant and upland rice , c) comparative root length at seedling
establishment stage. Seeds were germinated on wet filter paper at 28°C in dark.
2.11 Photoperiod sensitivity
Life cycle of rice consists of three phases: 1) vegetative growth stage, from
germination to panicle initiation , 2) reproductive stage, from panicle initiation to
flowering (generally 35 days) , and 3) the ripening stage, from flowering to ripen
grain (usually 30-35 days , could be even 2 months depend on some factors such
as water , nutrient richness) (Vergara and Chang 1985) . So the duration of the life
36
cycle of rice varieties mainly depends on the vegetative growth phase. Based on
photosensitivity, the vegetative growth phase can be again divided into two
phases: a) basic vegetative phase (BVP) -juvenile growth stage, independent to
photoperiod and b) photoperiod sensitive phase (PSP). Rice varieties are classified
into four types based on photoperiodic sensitivity: 1) Type A- both BVP and PSP
are short, such as most modern varieties, 2) Type B - long BVP but short PSP,
such as Habigonj Boro 5, BVP and PSP are 57 and 5 days, respectively , 3) Type
C- short BVP and long PSP, such as typical deepwater rice varieties and 4) Type
D- both long BVP and PSP. Rayadas are the only group of rice categorized type D
(Vergara and Chang 1985).
Most of the previous literatures reported BVP range from 10 to 63 (Gomosta and
Vergara 1983). In typical deepwater rice varieties, BVP range from 3 to 43 days
whereas that of Rayadas is 70 to 74 days, longest among all rice varieties reported
earlier (Vergara and Chang 1985). Longest BVP is the characteristic feature of
Rayada making it non-responsive in early growing stage to short photoperiod in
February and early March (Vergara and Chang 1985). Possibly it is because of
low temperature in winter months (Nov to Jan) that extended BVP (Gomosta and
Vergara 1983). The range of PSP in photoperiod insensitive varieties is 0 to 30
days whereas PSP of photoperiod sensitive cultivars are above 31 days to years
(Vergara and Chang 1985). Continuous long photoperiods resulted some cultivars
to keep in vegetative stage more than 12 years (Kondo et al. 1942). So
experimental duration for PSP determination was usually concluded after 200
days. All of the Rayada varieties tested earlier showed the highest limit of PSP,
same as typical deepwater rice varieties (Vergara and Chang 1985). Critical
photoperiod of Rayadas is around 12 hrs. Moreover, photoinductive cycle is also
prolonged in Rayadas, more than 2 weeks (Vergara and Chang 1985).
Interestingly, most of the wild rices also showed strong photosensitivity (Oka and
Chang 1960).
37
2.12 Quick recovery after water stress
Water stress recovery is crucial for Rayadas as it may be totally lost or damaged if
it fails to recover from drought stress before onset of flood. Previous screening of
IRRI in the 1981 identified 4 Bangladeshi varieties (Sarsari, Bhabani, Hijaldigha
and Tilbazal) as promising deepwater varieties for drought tolerance (Datta et al.
1982). Interestingly, Sarsari showed similar recovery score as that of two drought
tolerant check, Salumpikit and IR442-2-58 (Datta et al. 1982). In our study, we
used Rayada variety, Kaladigha with aus variety Dudsor. Kaladigha showed leaf
rolling in just minutes after transferring high humidity (90%) growing plants to
low humidity (60%) condition (data not shown). High humidity induces ABA 8'hydroxylase to regulate local and systemic ABA responses in Arabidopsis
(Okamoto et al. 2009). So we compared how quickly Rayada and Dudsor respond
to recovery after watering. Leaf rolling is a useful indicator of leaf water potential
in rice (O'Toole and Cruz 1980). Hence we compared water stress recovery rate
by measuring the leaf drilling rate after watering. After analyzing the time course
photographs, it revealed that Rayada variety sensed watering in just minutes and
50% derolled leaves (mostly young leaf) in 4-5 minutes (Fig. 2.9) whereas Dudsor
sensed and recovered significantly slower than Rayada variety. Excellent
performance of recovery of Rayada rice here suggests as it could be used as
promising materials for future studies of water stress recovery and stress
tolerance.
38
Fig. 2.9 Comparative time course leaf derolling after rewatering of water stressed
Rayada rice variety, Kaladigha and aus genotype, Dudsor. Three months old
plants were water stressed by water withdrawal for 5 days then rewatered. Time
course image was derived by Sony Vegas Pro software from HD video taken
during rewatering and image analysis was carried out in Adobe Photoshop 7.
From enlarged photographs, fastest five derolled leaves breadth were measured
and averaged on three position of each derolled leaf. Data representation was
based on two independent biological replicates. Bar represents the standard
deviation.
2.13 Origin and evolution of Rayada
The origin and evolution of rice is little bit of a puzzle with considerable debate
mainly on single or multiple ancestries with domestication place (Londo et al.
2006; Molina et al. 2011; Huang et al. 2012; Sang and Ge 2013). Most of the
scientists believe O. rufipogon as progenitor of deepwater rice because it has still
deepwater types, adapted to deepwater habitat and having photoperiod sensitivity
too (Glaszmann 1987; Catling 1992; Bashar et al. 2004). As elongation ability
after flooding is the main feature of both Rayada and typical deepwater rice,
hence evolutionary study of key genes responsible for internode elongation after
flooding is also relevant to Rayada. Snorkel genes (SK1 and SK2) allow rice to
adapt in deepwater condition by enhancing GA responsiveness (Hattori et al.
2009). Phylogenetic analysis of snorkel protein sequences among deepwater and
wild rices were shown in Fig. 2.10. Both of the wild species (O. rufipogon and O.
nivara) possess complete SK1, but SK2 of O. nivara is truncated due to insertion
of transposon. However, O. glumaepatula, in another wild rice species, have SK2
and SK2-like genes, but deficient of SK1 (Fig. 2.10). Phenotypic effect of SK2 is
more prominent and wild rice species (O rufipogon and O. glumaepatula) possess
the SK2 genes, suggesting these genes may have been evolved before or during
wild rice speciation (Hattori et al. 2009).
39
Fig. 2.10 Phylogenetic analysis of snorkel protein sequences among deepwater
and wild rices. Phylogenetic tree was derived using the Neighbor-Joining method
by MEGA5 (Tamura et al. 2011). DDBJ accession numbers of SNORKEL1 and
SNORKEL2 are as follows (name, accession numbers): O. sativa DWR Bhadua,
(AB510480 and AB510481), O. rufipogon (AB510482 and AB510483); and O.
nivara (AB510484 and AB510485). AB510486 and AB510487 are SNORKEL2
and SNORKEL2-like genes in O. glumaepatula.
Interestingly, Bangladeshi deepwater rice varieties (all three types) were found to
possess special isozyme alleles, Est10-4 and Amp5-4 which are frequently found
in Asian common wild rice O. rufipogon but rare in other cultivars (Cai and
Morishima 2000). This finding suggests Bangladesh deepwater rice has inherited
these alleles from its wild progenitor. Generally, it has been considered that
deepwater rice varieties belong to indica spp. only , although a very few reports
on isozyme analysis showed some of floating rice of Bangladesh including
Rayada displayed japonica relevance (Cai and Morishima 2000, Wang et al.
2013). However, none of the 188 deepwater rice varieties tested from Thailand,
Vietnam and Cambodia showed japonica pattern (Catling, 1992). Analyzing the
polymorphism of nuclear, mitochondria and chloroplast DNA of 193 genotypes,
Sun et al. (2002) identified japonica type nuclear and chloroplast DNA but indica
40
type mitochondria DNA in some Bangladeshi deepwater landraces including
Rayadas. Since some of Bangladeshi deepwater rice varieties including Rayada
showed japonica relevance with presence of Est10-4 allele and japonica type
nuclear and chloroplast DNA, so considering other features of Rayadas altogether
(such as yearlong life cycle, strong photosensitivity, multiple stress tolerances and
elongation ability after flooding that are resemble to wild rice), collectively might
deduce
Rayadas
as
a
possible
missing
link
between
indica-japonica
differentiation. However, most of the large scale molecular (GWAS etc.) or
evolutionary studies of rice omitted Bangladeshi unique varieties such as Rayadas
as experiment material hence the enigma lingers.
2.14 Rayada: the forgotten resource of elite features of rice
Being sessile organisms, plants have evolved with special capacity to sense,
respond, and adapt to unfavorable environmental conditions. Water stresses, either
excess (flooding) or shortage (drought) of water, significantly limit plant growth
and development and obviously crop production. The natural capacity of these
stress tolerance mainly depends on plants genome specialty and efficiency of
activation of adaptive mechanisms (Chinnusamy et al. 2004). However, crop
domestication and thereafter gradual selection or directional breeding have
narrowed the genetic diversity of elite varieties, even promoted gathering of
deleterious mutations in their stress response mechanisms (Tang et al. 2010),
whereas local ecotypes, landraces and wild relatives growing on native
environment and preferences still keep genetic diversities for features like stress
tolerance, disease resistance etc. (Suslow et al. 2002)
Rayadas are resources of desirable features like flood, cold and drought tolerance
and still share some features of wild rice (Perez and Nasiruddin 1974; Glaszmann
1987; Khush 1997; Bashar et al. 2004). In addition, we have found features like
longer root system (Fig. 2.8), quicker recovery (Fig. 2.9), and faster stomatal
responses (data not shown) etc. in Rayada rice that are associated with drought
tolerance. However, mainly because of two undesired features like yearlong life
cycle and poor yield diminished the focus on it although development of
41
deepwater rice had initiated since 1917 (Zaman 1977). Despite the limitations,
deepwater rice was considered as a model plant to study stem elongation and
basic aspects of plant growth (Kende et al. 1998).
Functional role of snorkel genes in deepwater rice has been already revealed
although how SK genes regulate GA responsiveness is still unknown (Hattori et
al. 2009). Moreover, several other minor QTLs (qTIL2 and qTIL4) identified in
deepwater rice (Nagai et al. 2012) need to be characterized. Moreover, focused
study on Rayada or deepwater rice would enrich our understanding on GA/ABA
antagonism which is important to know how plants cope with changing
environments. In addition, Rayada rice seems to be an excellent material for
natural stress memory phenomenon study (Chinnusamy and Zhu 2009) as it
always passes through multiple stresses (flooding, cold, sometimes drought)
before completion of life cycle.
In summary, Rayada is such a primitive deepwater rice ecotype that can offer
many traits that are badly needed in rice breeding , especially for stress tolerance.
We expect Rayada rice will become a new focus of rice germplasm research with
the rapid advances in genome research weaponry.
42
Chapter 3 OsbZIP84 is involved in seed dormancy
regulation of Rayada rice through ABA catabolism
3.1 Introduction
Seed dormancy and germination are two of the complex interrelated processes of
plant development. Myriad of regulators of both endogenous hormonal signaling
and exogenous factors are involved in these processes. However, abscisic acid
(ABA) is the key regulator of both of the processes (Nambara et al. 2010). Despite
extensive research, still seed dormancy is being considered as a least understood
phenomenon in seed biology (Finkelstein et al. 2008).
Seed dormancy, a temporary quiescent state of seed, is one of the natural ways of
preventing seed germination. Complete lack of dormancy can cause pre-harvest
sprouting or vivipary in wet or high humid environment, thus might cause
significant economic loss of crops due to reduction of yield as well as seed quality
(Gubler et al. 2005). Moreover, it can also increase the risk of seedling mortality
in unfavorable conditions. Oppositely, strong and prolong seed dormancy
significantly hamper synchronous germination, hence not desired in agriculture.
Therefore, well-balanced seed dormancy is necessary for crop plants (Graeber et
al. 2012).
Most of the wild rice accessions possess strong seed dormancy (Vaughan 1994;
Veasey et al. 2004). Generally seed dormancy is considered as an adaptive trait of
wild species. However, reduction or loss of seed dormancy is one of the traits of
the domestication syndrome (McCouch et al. 2012). All deepwater rice varieties
except Rayadas possess extended period of seed dormancy (Catling 1992).
However, among deepwater rices, Rayadas is considered most primitive based on
yearlong life cycle, multiple stress tolerance capacity, strong photosensitivity and
endemic nature (Catling 1992). Moreover, it still shares some features of wild
rices (Khush 1997). Interestingly, Rayada varieties completely lack seed
dormancy; Rayada seeds are sown within weeks or even days after harvest
(Catling 1992). Therefore, Rayadas are good example of natural variation of seed
dormancy among deepwater rices. Physiological features along with endemic
nature suggest lack of dormancy may be also an adaptive feature of Rayadas. The
43
genetic basis of such adaptive feature is the key question of both fundamental and
evolutionary biology. But both physiological and molecular bases of this trait of
Rayadas are completely unknown. In this study we, for the first time, examined
Rayadas as a natural variant of deepwater rice to reveal both physiological and
molecular bases of their lack of dormancy.
Numerous studies with both ABA and GA biosynthesis and signaling mutants in
different plants enriched our understanding of antagonistic role of the two
phytohormones in seed dormancy and germination (Nambara et al. 2010; Graeber
et al. 2012). ABA biosynthesis mutants show reduced dormancy in freshly
harvested seeds whereas ABA catabolic mutants act oppositely, enhances seed
dormancy. After imbibition of seeds, catabolic activities of ABA8’hydroxylases
rapidly decrease ABA content in non-dormant seeds whereas remain high in
dormant seeds (Graeber et al. 2012). Key ABA catabolic gene of barley
(HvABA8’OH-1) is highly expressed in non-dormant seeds and surprisingly,
localized onto coleorhiza (Millar et al. 2006). Apart these, some individual genes
such as DOG1 (Bentsink et al. 2006), SDR4 (Sugimoto et al. 2010) also regulate
seed dormancy by some unknown means.
Moreover, some other signaling molecules such as NO, H2O2 also modulate the
sensitivity of ABA and consequently regulate seed dormancy and germination.
H2O2 interact with ABA signaling, up-regulate ABA catabolic genes hence
decrease ABA content during seed germination (Liu et al 2010; Ye et al. 2012a).
Among ROS, H2O2 received special attention due to more stability and long lived
feature (half-life 1 ms). It is well evident that plants use ROS as signaling
molecules or second messenger in different growth and development as well as
biotic and abiotic stresses (Rodriguez et al. 2004; Zhang et al 2001) including
dormancy alleviation, after-ripening and germination (Oracz et al. 2007; ElMaarouf-Bouteau and Bailly 2008; Ye et al. 2012a). Inhibition of ROS production
by diphenylene iodonium (DPI) delays endosperm weakening and seed
germination. Similarly, NADPH oxidase mutant (atrbohB) fails to after ripen due
to reduced ROS accumulation (Műller et al. 2009). Therefore, we paid our special
attention to observe ROS accumulation in freshly harvested seeds of Rayada
whether they have any involvement in the feature of lack of dormancy.
44
During the course of domestication, transcription regulators are assumed to be the
evolutionary switches or dominant class of genes that have changed (Doebley and
Lukens 1998; Doebley et al. 2006). bZIPs are very ancient and evolutionally
conserved family of eukaryotic transcription factors and some of their DNAbinding specificities evolved before the divergence of the metazoa and fungi
(Amoutzias et al. 2007). In plants, some bZIP transcription factors are directly
linked with ABA signaling pathways and regulate different cellular processes
including seed maturation, flower development, pathogen defense, light and stress
signaling (Jakoby et al. 2002, Nijhawan et al. 2008). A bZIP TF, ABI5 is one of
the key transcription factors that confer ABA responsiveness (Nambara et al.
2010). Stored mRNA profiling in dry seed of Arabipsis revealed enrichment of
genes with ABREs in promoter (Nakabayashi et al. 2005). Recently, Tsugama et
al. (2012) claimed a bZIP transcription factor, VIP1 enhance the promoter
activities of ABA 8'-hydroxylase thus regulate ABA catabolism , although VIP1
is classically explained as VirE2 interacting protein and required for nuclear
import and Agrobacterium tumorigenicity (Tzfira et al. 2001).
We first examined the physiological basis of lack of dormancy in Rayada rice by
determining ABA content as well as ROS accumulation in freshly harvested seeds
after imbibition. Then after analyzing stepwise gene expression of 32 bZIPs in
three ecotypes, we selected OsbZIP84 as our gene of interest (GOI), possibly
involved in ABA catabolism regulation. We hypothesized the role of OsbZIP84 in
seed dormancy, after analyzing gene expression of GOI and ABA8oxs in 4
different growth and developmental situations in Rayada rice together was ABA
content and sequence homology of reported genes. Finally we ascertain our
hypothesis with phenotyping of osbzip84 in japonica background representing
dormancy phenotype along with similar phenotypes of pharmacological studies of
ABA catabolic inhibitor.
45
3.2 Materials and methods
3.2.1 Plant materials
Eight different varieties of rice variety (O. sativa L.) were used in this study. It
included Rayada (Kaladigha, Sarsari), typical deepwater rice (Habigonj aman
VIII), flash flood tolerant (BRRI51, BRRI52), Aus (Dudsor, Boupagol) and
Japonica type (Donjing) rice. Except Donjing, all other varietal seeds were
collected from Bangladesh Rice Research Institute (BRRI), Bangladesh. Mutant
of OsbZIP84 was collected from POSTECH, Korea (Jeon et al. 2000). The
homozygous mutant was identified by PCR using T-DNA and gene specific
primers listed in Table 2.
3.2.2 Growth conditions and stress treatments
Intact seeds (with hull) were used for germination performance of freshly
harvested seeds of Rayadas and deepwater rice. However, dehulled seeds were
used in other experiments with downstream ABA or RNA extraction. Seeds were
sterilized with diluted chlorex and germinated on sterile moist filter paper at 28°C
in dark. Germinated seedlings were grown on Kimura B nutrient solution (renewal
cycle 3 day) in greenhouse at 25-30°C with 14 /10h photoperiod shift. Different
treatments were performed mentioned in respective figure legends. Samples of
leaves, seeds, nodes, internodes under different treatments were collected in liquid
nitrogen and stored at -80°C (if necessary) for ABA determination and RNA
isolation. For each treatment, 10-30 seeds were used and triplicate experiment sets
were used unless otherwise mentioned.
46
Table 2 List of primer sequences used in this study.
SL no
Name
MSU ID
RAP ID
Forward primer (5’-3’)
1
bZIP04
LOC_Os01g36220 Os01g0542700 GGCGTTGTGTGTACTACTGT
TAGTAGTAGTAGTTGCAGTGCA
2
bZIP05
LOC_Os01g46970 Os01g0658900 GGAAATTGATGGTGCGGCTATGT
GTTGGCACTTCAGTTACTGGGG
3
bZIP13
LOC_Os02g03580 Os02g0128200 ATGGCAAAGCATCGTCTGGTTC
GTGCCATTGGTGTCGTTCTGTT
4
bZIP14
LOC_Os02g03960 Os02g0132500 AAGAGGATGCTGTCGAACAGGGA
GGGGAGGATCTGAAGAGGTCGTC
5
bZIP16
LOC_Os02g09830 Os02g0191600 AGCATCACCATGATTCCAGTGACT
GGCTACTTCAGCATCTTCCATTTCC
6
bZIP18
LOC_Os02g10860 Os02g0203000 ACAGAATGAGAACCAGATGCTCAGA GTGCTGTTGGGCATCCTGTGG
7
bZIP24
LOC_Os02g58670 Os02g0833600 AGCTCCTTCCTTTCCATCTCCAG
ATGAGCTTCTTCGGTGGGAACT
8
bZIP26
LOC_Os03g13614 Os03g0239400 CATCGGCGACACAGAATGAACA
GTGATTGCCCGGGATAGGGATT
9
bZIP29
LOC_Os03g20650 Os03g0322700 ATGACGCTCGAGGACTTCCTGTC
AGCTGATTCTTTGGCTCCTGTTG
10
bZIP34
LOC_Os03g59460 Os03g0809200 ATGCTGACGAGAAGGGTTTGT
GTGCTTATTTAGCTGGCTACTGC
47
Reverse Primer (5’-3’)
SL no
Name
MSU ID
RAP ID
Forward primer (5’-3’)
11
bZIP37
LOC_Os04g54474 Os04g0637000 TGTGGAGTCACGAGCAGTTCAA
ATTTGCATACACAGCCTGCTGC
12
bZIP39
LOC_Os05g34050 Os05g0411300 TCGCGGACCGCTGTGGATT
TGGGAAATGCATGCCGGGAAT
13
bZIP40
LOC_Os05g36160 Os05g0437700 CTAATGTAACGGAGGGTGTGGGT
CCTTATGACAACTGCAACGGCTT
14
bZIP42
LOC_Os05g41070 Os05g0489700 CTGGTACGTCTGATTTGAACGCTG
TTGACCTGGCAGCTGATTCCCT
15
bZIP44
LOC_Os05g41540 Os05g0495200 ACATCAAGGAGGACCTGACGAA
GCCATTGAAGCACATACCTGGA
16
bZIP45
LOC_Os05g49420 Os05g0569300 TGGCAGGAAACGGAGATTGGAT
CAGATCCTCTGTTTCAGCCTGC
17
bZIP48
LOC_Os06g39960 Os06g0601500 GATAGCGACGACGAGGAGATAGT
TGTTCTTCAGCACCTGCCTAAGC
18
bZIP51
LOC_Os06g42690 Os06g0633400 ATGGCGTACCAATCGTTC
TTAATCCATTGGCGCCA
19
bZIP53
LOC_Os06g50310 Os06g0716800 CTGTGCATGACCTCTCACACAC
CACCACCAAGATAACTTCCCTGG
20
bZIP57
LOC_Os07g03220 Os07g0124300 CGGATACGATGGTGTTGCCTC
TAGGAGGCGGGACAGCCCTA
21
bZIP59
LOC_Os07g10890 Os07g0209800 GACCACAAGGATTCGTCTGCAC
ATCCAGGTGAGCAACACCATCA
48
Reverse Primer (5’-3’)
SL no
Name
MSU ID
RAP ID
Forward primer (5’-3’)
22
bZIP63
LOC_Os07g48820 Os07g0687700 TGTTGATGGCATAATGGCGCAT
CAGAAGACCCTGATGAAGCGAG
23
bZIP67
LOC_Os08g38020 Os08g0487100 AGCTGGAGCGCATCCTGGAAGAA
AGCAGCGGTAGTCGTAGTGCTGT
24
bZIP68
LOC_Os08g43090 Os08g0543900 TGGGGAGTTCACTGAAGCTGAG
TGAGGACTAATGCTGATGAGGGT
25
bZIP69
LOC_Os08g43600 Os08g0549600 GTCGTTTCAGGACGGGCTTCCGTC
GCCTTCAGCTGGTGGCACTGG
26
bZIP70
LOC_Os09g10840 Os09g0280500 GCAACTACGACATGGCCGATTT
CTTCCTTCCTTCTGCAAGCCAC
27
bZIP71
LOC_Os09g13570 Os09g0306400 TCCAGGCCCAGATGGAGAAGAA
AGTGGTGGCTGAAATTGTAGGAGT
28
bZIP77
LOC_Os09g36910 Os09g0540800 GTGCTCTCCGCGCCATTCTGA
GCACTGCCACAGCTAAGCTTCCT
29
bZIP78
LOC_Os10g38820 Os10g0531900 ACCCTCTCCGCTCAGCTGACTC
CGTGCCATTCTGCTGCTCTGGCTG
30
bZIP81
LOC_Os11g06170 Os11g0160500 CTGCTCCAGGCGTACTGGGATG
TGGCCGCTCATCGATTGGCCT
31
bZIP84
LOC_Os12g06520 Os12g0162500 AAGAGAATTCTGGCGAACAGGC
GTGGCCGCCTAAATAAGGCA
32
bZIP85
LOC_Os12g09270 Os12g06334500 TGGGATTCGAGACTGATGCTCC
CGAGACCTCTGAGCATACTGCA
49
Reverse Primer (5’-3’)
SL no
Name
MSU ID
RAP ID
Forward primer (5’-3’)
33
bZIP89
LOC_Os12g43790 Os12g06334500 CTTCCTCGCCGACATTGGCTTC
CTACGCGATCAACGAGGCGAG
34
LEA3
LOC_Os05g46480 Os05g0542500 TAGGATCAATGGCTTCCCACCAG
GATGGCAGAGTCCTTGGTGTACT
35
SAPK8
LOC_Os03g55600 Os03g0764800 ACCGTGATTTGAAGTTGGAG
CCGTATTTCTGGGATTGTTA
36
SAPK9
LOC_Os12g39630 Os12g0586100 GATTGCCGATGTTTGGTC
TGTTGCTTCTGCCAGTATCT
37
SAPK10
LOC_Os03g41460 Os03g0610900 ATGCCGATAATGCACGACG
TGGTTGCGAATGAAGAACAGAC
38
PP2C4
LOC_Os01g36080 Os01g0541900 GTCACCATTGCCACTGATCTAG
TTGCTGCTGTAAGTTGTTGTTCG
39
PP2C9
LOC_Os01g62760 Os01g0846300 TCGCACTATCCGTTGACCACA
GCCAACTTCGTCAGCAGCAT
40
qbZIP13
LOC_Os02g03580 Os02g0128200 GGCCTACTCGGCAATTCCACCG
CGTAAGGTGGCACCATGGGCTG
41
qbZIP40
LOC_Os05g36160 Os05g0437700 CCTCGGGAGGGCTATCTGCTCC
AGCCAGGAAATCCTCCAGCGTCA
42
qbZIP42
LOC_Os05g41070 Os05g0489700 CCCAGGTTAGGTCAGCCTCGCT
ATCAGCCCCCGAGGATTCCACC
43
qbZIP44
LOC_Os05g41540 Os05g0495200 TTCTCCCATCCGGAGGTGCCTG
GGATTGCAGGTGTGGGTGTGGG
50
Reverse Primer (5’-3’)
SL no
Name
MSU ID
RAP ID
Forward primer (5’-3’)
Reverse Primer (5’-3’)
44
qbZIP53
LOC_Os06g50310 Os06g0716800 CACCTGCGTCCATGTCCACACC
GGCCGCTTCTTGGAGGCATTGT
45
qbZIP59
LOC_Os07g10890 Os07g0209800 GGGCGGCACTTCCTAATGCCAC
ACCCAGGACTTGCTTCCCCCTG
46
qbZIP63
LOC_Os07g48820 Os07g0687700 GTGAGTCTGTGCCGTTTCCCCG
GTGGCGGTTGGGGGAAATCTCG
47
qbZIP68
LOC_Os08g43090 Os08g0543900 CGAGTCACCGAAGCTGCCACTG
GCACCAAACAGAGATGCAGCGC
48
qbZIP71
LOC_Os09g13570 Os09g0306400 CACCTCGCAGGTGAACCAGCTG
TGTGCCTGCACTGCCACAAGG
49
qbZIP84
LOC_Os12g06520 Os12g0162500 GGTGGGCTACCGGACTACGC
TCTCTTTGCGCGCTTGGGGTC
50
qOsABA8ox1 LOC_Os02g47470 Os02g0703600 CCTGCCCGGAAAAGTTCGACCC
CGCACCGGGAAAGGAAAGGGAG
51
qOsABA8ox2 LOC_Os08g36860 Os08g0472800 ACAGCAGCAGGTGCTTGACACG
CATTGCATCCACACACACGGCG
52
qOsABA8ox3 LOC_Os09g28390 Os09g0457100 GCTACGGCCATGAGAAAGCCGTC
AGTAGAGCTGAAGGGTCTCGCCG
53
qGA20ox1 LOC_Os03g63970 Os03g0856700 TTCCTCTGCCCGGAGATGGACAC
ACGTGAAGTCCGGGTACACCCTC
54
qNCED1
LOC_Os02g47510 Os02g0704000 ATCATGCACTCGGTGAACGCGTG
51
CGTGCTCGATGGAGAGGACGTTG
SL no
Name
MSU ID
RAP ID
Forward primer (5’-3’)
Reverse Primer (5’-3’)
55
qNCED2
LOC_Os12g24800 Os12g0435200 GTTGATGAGCTGCCCCCGACAAG
GGTGCTGTGGGTTGGGACCATTG
56
qNCED3
LOC_Os03g44380 Os03g0645900 AGCTCACCACCCAGGCCTGATC
CAGGCTCCCTCTGGTCACTTCC
57
qNCED4
LOC_Os07g05940 Os07g0154100 CCGTCACCGAGAACTATGCCGTC
CGACGCCTTCTCCCTGTCGTATAC
58
qNCED5
LOC_Os12g42280 Os12g0617400 CGCCAACTCCAGCTCTCACCTC
GGCATGGCTGTCCTACAAGAGC
59
qActin1
LOC_Os03g50890 Os03g0718100 AGAGGAGCTGTTATCGCCGTCCTC
GCCGGTTGAAAACTTTGTCCACGC
60
Tubulin α
LOC_Os03g51600 Os03g0726100 TGTGCATGATCTCCAACTCCAC
AATCAGGCCTTGACACACAGAA
LOC_Os12g06520 Os12g0162500 ACATTGTGAAACGGAGGGAG
GAAGGTGTAATCTCCCCGTG
PFG_ 2A61
50025.R
(Mutant)
62
Middle primer 1 (T-DNA)
CATCACTTCCTGATTATTGACC
63
Middle primer 2 (T-DNA)
AACGCTGATCAATTCCACAG
52
3.2.3 Microarray data analysis
To identify the OsbZIP family members, first all the OsbZIPs mentioned in Plant
Transcription Factor Database (http://plntfdb.bio.uni-potsdam.de) was manually
checked using BLAST. To avoided confusion, Nijhawan et al. (2008)
nomenclature was followed. The gene expression was manually checked from
RiceGE: Gene Expression Atlas and NCBI GEO Profiles. For RAP and MSU rice
gene
id
conversion,
RAP-DB
ID
converter
was
used
(http://rapdb.dna.affrc.go.jp/tools/converter/run).
3.2.4 RNA extraction and quantitative real-time (qRT)-PCR
RNA was extracted from respective samples using the Agilent Plant RNA
isolation Mini Kit and then digested with RNase-free DNase I to eliminate
genomic DNA contamination. First-strand cDNA was synthesized with oligo (dT)
primers using a Promega cDNA kit accordingly. Transcript levels of each gene
were measured by qRT-PCR using Mx3000p QPCR System with iQ SYBR Green
Supermix. The data were normalized to the amplification of a rice α-tubulin or
actin 1 gene. Primer sequences of genes used for RT and qRT-PCR expression
analysis and mutant screening were listed Table 2.
3.2.5 Extraction and measurement of ABA
Measurement of endogenous ABA content was carried out using the
radioimmunoassay (RIA) method as described by Jia et al. (2012). Respective
samples of 0.2 g (or 10 seeds) were ground in liquid nitrogen and homogenized in
1 ml of distilled water and shaken overnight at 4°C. The homogenates were
centrifuged at 12000g for 20 min at 4°C and the supernatant were directly used
for ABA assay. The 450 µl reaction mixture comprised of 200 µl of phosphate
buffer (pH 6.0), 100 µl of diluted antibody (Mac 252) solution, 100 µl of [3H]
ABA (@ 8000 cpm) solution, and 50 µl of crude extract. The mixture was then
incubated for 45 min at 4°C and the bound radioactivity was measured in pellets
precipitated with 50% saturated (NH4)2SO4 with a liquid scintillation counter.
53
3.2.6 ROS staining and confocal laser scanning microscopy
Total
ROS
staining
was
dichlorodihydrofluorescein
determined
diacetate
using
(H2DCF-DA)
fluorescent
dye
(Invitrogen).
2',7'Freshly
harvested seeds were washed gently with Hanks’ balanced salt solution (HBSS)
buffer and stained with H2DCF-DA at 37 °C in the dark for 30 min, then washed
briefly with same buffer and observed under Olympus Fluoview FV1000 confocal
laser scanning microscope with the following settings: excitation=488 nm,
emission=535 nm, frame 1024×1024. To compare ROS staining between seeds of
Rayadas and typical deepwater rice, identical exposure conditions were used for
all samples. Representative images of 10 seeds were used for comparison.
3.2.7 Statistical analyses
ANOVA and Duncan’s multiple range test were done using Excel Add-ins
develop by Onofri 2007. The values are the means and SD of at least three
biological replicates from for each experiment unless otherwise mentioned. The
lowercase a, b or c etc. in figures represents ranking test and different letters
indicate significant differences at the P<0.05 level. For other simple experiments,
the student t-test was used and significance level was mentioned in respective
figure.
54
3.3 Results
3.3.1 Lack of dormancy of freshly harvested Rayada seeds
We examined the feature of lack of dormancy of freshly harvested seeds of
Rayada variety, Kaladigha. Seeds of different time course after harvest (0, 7 and
180 days after harvest (DAH), were used to compare seed germination
performance of freshly harvested Kaladigha seeds with that of typical deepwater
rice variety, Habigonj Aman VIII seeds (Fig. 3.1 a). Germination performance of
freshly harvested seeds of Rayada variety clearly demonstrated non-dormant
nature (Fig. 3.1a,c). However, absolute freshly harvested seeds of Kaladigha, i.e.
0 DAH showed delayed and reduced percentage of germination whereas seeds of
7 DAH showed high germination percentage comparing that of typical deepwater
rice (Fig. 3.1a).
As ABA is the master regulator of seed dormancy, hence we compared the ABA
content of seeds of freshly harvested Rayada variety, Kaladigha with that of
typical deepwater rice variety, Habigonj Aman VIII. Remarkably, freshly
harvested seeds of Habigonj Aman VIII possessed significantly higher ABA than
that of Rayada variety (Fig. 3.1b). Although we examined ABA content of only
one variety of each type, but we assume other varieties of Rayada might show
similar trends.
Phenotypes of seedlings of 7 days after imbibition of Kaladigha variety were
shown in Fig. 3.1c. Except reduced root growth, seeds of 7 DAH showed virtually
no difference with that of 180 DAH (Fig. 3.1c). Interestingly, moisture content
was found significantly different between complete freshly harvested seeds (0
DAH) with that of 180 DAH. Freshly harvested seeds usually contained around
25% moisture whereas it was only 13.38% in dry seeds of 180 DAH. Seeds of 7
DAH showed intermediary moisture content (Fig. 3.1d).
55
Fig. 3.1 Lack of dormancy of freshly harvested seeds of Rayada. a) comparative
germination performance of seeds of typical deepwater rice variety Habigonj
Aman VIII (Hbj VIII) with Rayada variety, Kaladigha (KD) of 0, 7 and 180 days
after harvest, b) ABA content of freshly harvested seeds (0 DAH) , c) seedlings of
Rayada variety Kaladigha developed 7 days after imbibition of different DAHs. d)
moisture content of seeds of different DAHs. 10 seeds of different DAH were
used for triplicate experiments. ABA content was measured using the RIA method
as described in materials and methods. Values are means with ±SD (n=3). The
symbol (*) indicates the significance level at * P<0.05, ** P<0.01
3.3.2 ROS accumulation in freshly harvested Rayada seeds after
imbibition
Previous reports suggested involvement of ABA content on ROS accumulation in
seed germination (Oracz et al. 2007; Ye et al. 2012a). Since Rayada showed
reduced ABA content and we observed partial overriding of dormancy of freshly
56
harvested Habigonj Aman VIII after H2O2 treatment (data not shown), hence we
attempted to compare ROS accumulation status of seeds after 24 hrs imbibition in
freshly harvested (7 DAH) Rayada seeds (Kaladigha) with that of typical
deepwater rice (Habigonj Aman VIII). After fluorescent staining with H2DCFDA, significant difference was observed between them. Huge ROS accumulation
was observed in embryonic axis of Kaladigha seeds (Fig. 3.2, upper panel)
whereas noteworthy reduction of ROS accumulation appeared in Habigonj Aman
VIII (Fig. 3.2, lower panel). Moreover, both exogenous ABA and DPI (NADPH
oxidase inhibitor) also reduced germination in freshly harvested Rayada seeds
(data not shown). All these clearly represented the ROS accumulation after
imbibition in freshly harvested Rayada seeds might be a decisive consequence of
reduced ABA content thus promoted seed germination.
Fluorescent
Bright field
Merged
Fig. 3.2 Comparative ROS accumulation of freshly harvested seeds of Rayada
variety, Kaladigha (upper panel) and typical deepwater rice variety, Habigonj
aman VIII (lower panel). 24 hrs imbibed freshly harvested (7DAH) dehulled seeds
were stained with fluorescent dye H2DCF-DA and observed under confocal laser
scanning microscope with similar image acquisition settings. Representative
image of 10 seeds was shown here.
57
3.3.3 Differential expressions of selected OsbZIPs in seed
germination
Although previous studies already functionally characterized several OsbZIPs
involved in ABA signaling as well as abiotic stress tolerance in rice (Hobo et al.
1999; Xiang et al. 2008; Nakagawa et al. 1996; Lee et al. 2003; Lu et al. 2009;
Hossain et al. 2010ab; Chen et al. 2012; Liu et al. 2013) but majority of them are
still to characterize. After searching publicly available microarray databases in
details, 32 putative bZIPs were selected (Table 2) based on (a) either having high
expression profile in ABA mediated stress tolerance situations (drought and/or
salinity), (b) high sequences difference between indica and japonica spp. and even
(c) the genes that do not have expression data . Both upstream and downstream
marker genes of ABA signaling pathways were also monitored along with bZIPs.
Out of 10 SnRK2s in rice genome, only three of them (SAPK8, SAPK9 and
SAPK10) were activated by ABA (Kobayashi et al. 2004), therefore we used them
as SnRK2 marker genes. Moreover, expression of two phosphatase (2C) genes
(PP2C04, PP2C09) and widely used downstream marker gene (LEA3) expression
was also monitored. Moreover, we also checked expression of bZIP05 as bZIP
control since rapidly induced by ABA in rice, reported earlier (Nakagawa et al.
1996).
As previous report, we observed significant up-expression of bZIP05 after ABA
treatment in both Rayada varieties as well as salinity in Sarsari (Fig. 3.3). Among
other marker genes, SAPK8 was expressed in all treatment in Rayada rice
including anoxia (Fig. 3.3) However, ABA and saline treatments showed highest
expression in Rayada variety, Sarsari. Interestingly, it was neither expressed in
any treatment of Sub1A rice nor in other upland rices. SAPK9 was mainly
expressed in ABA treatment of both Rayada varieties including saline treatment in
Sarsari (Fig. 3.3). Slight expression of SAPK10 was observed in Rayada rice in
ABA (Kaladigha) and saline treatment (Sarsari). Similarly, expression of PP2C04
was also limited to Rayada rice ABA treatment whereas PP2C09 was different i.e.
Kaladigha showed slight expression in both ABA and saline treatments whereas
Sarsari showed high expression in saline but not in ABA treatment (Fig. 3.3).
LEA3 showed very high ABA, saline treated seed germination of Rayada rice.
58
Fig.3.3 Expression analyses of selected OsbZIPs among three ecotypes/varieties
during seed germination. Treatments were germination in presence of i) 10µm
ABA, ii) 50mM Nacl, iii) anoxia (ano). For anoxic germination, seed were placed
in 50ml tube and filled with degassed then nitrogen humidified (for 15 min) water
and capped carefully underwater as no air bubble was trapped inside. RNA was
isolated 48 hrs after imbibition and DNase treated RNA from respective samples
were used for cDNA synthesis. Equal amount of cDNA were used for PCR
amplification of fixed 30 cycles. Names of bZIPs are shown on the right panel.
Tubulin was used as internal control whereas bZIP05 as bZIP control as rapidly
induced by ABA in rice (Nakagawa et al. 1996)
59
Among 32 bZIP family members, 10 bZIPs (14, 18, 48, 51, 57, 67, 69, 70, 81, and
85) showed no expression among these ecotypes hence omitted in the figure.
Twelve bZIPs (13, 40, 42, 44, 45, 53, 59, 63, 68, 71, 77 and 84) were expressed in
Rayada varieties either ABA or Nacl or both treatments (Fig. 3.3). Rice seed
germinated on Nacl or ABA showed highest number (18) bZIP expression
(bZIP05, 13, 24, 26, 37, 39, 40, 42, 44, 45, 53, 59, 63, 68, 71, 77, 78, and 84)
mainly in Rayadas. In anoxic germination, slight expression was observed in
seven bZIP family members (bZIP05, 13, 45, 63, 71, 77, and 84) also limited to
Rayadas. Generally, bZIP expression was either weak or not expressed in Sub1A
rice (BRRI51) and other two upland varieties (Fig. 3.3). However, in both Rayada
varieties, expression of bZIP84 was huge in both ABA and Nacl treatments. In
addition, slight expression was also observed in anoxic germination, highest
among all 33 bZIPs including bZIP05 (Fig. 3.3).
However, gene expression determination using semi-quantitative RT PCR at seed
germination might not reflect the exact expression profile, hence 10 bZIPs
(bZIP13,40,42,44,53,59,63,68,71,and 84) were selected for another round of
screening using real-time quantitative RT-PCR . Here we used in 3 months old
mature plants of three ecotypes/varieties in two experiment sets for both mild and
severe water stresses along with exogenous ABA application and recovery status
after watering assuming highly expressed genes of either ABA or Nacl treatment
in seed germination (bZIP13,40,42,44,53,59,63,68,71,and 84) might reflect clear
ABA induce ability.
3.3.4 Expression pattern of OsbZIP84 in mild and severe water
stresses
After analyzing selected 10 bishops genes quantitative expression patterns (QRTPCR), expression of OsbZIP84 was found pretty interesting (others expression
data not shown). In mild water stress in BR52-BP-KD set, OsbZIP84 showed
opposite trends among ecotypes, i.e. up-regulated in both upland and Rayada rice
varieties in all treatment conditions but down-regulated in flash flood tolerant
variety, BRRI52 (Fig. 3.4a). Highest expression (12 fold) was observed in
exogenous ABA in upland variety, Boupagol. However, in Rayada rice maximum
60
expression was observed in the recovery stage although both drought and
exogenous ABA showed up-regulation too. After severe water stress in another
set (BR51-DS-SS), consistent up-regulation of OsbZIP84 was observed with
significantly elevated fold in both upland and Rayada rice (Fig. 3.4b). However,
in Sub1A rice, (BRRI51) expression was also consistently down-regulated.
Fig. 3.4 Expression profile of OsbZIP84 after mild, severe water stresses and
recovery in three extreme ecotypes/varieties. Three months old plants were
imposed gradual water stress (mild and severe for 8 and 10 days respectively)
along with recovery status 30min after watering. Each experiment set consists of
one variety of flood tolerant Sub1A (BR51, 52), one upland (BP, DS) and one
Rayada rice (KD, SS) and grown in the same pot to reduce environmental
interactions. 10µM ABA was sprayed at midday (12.00PM) each day from
withholding the water only on designed experiment set. Control plants were
61
sprayed equal amount of ddH2O. DNase treated RNA from respective samples
were used for cDNA synthesis. Transcript levels were quantified by qRT-PCR, as
described in Materials and Methods. Values are means with ±SD (n=3).
3.3.5 Homology search and possible functional homolog
The opposite expression pattern of OsbZIP84 among ecotypes and huge upregulation at recovery stage in Rayada rice and contrasting phenotype of shoot
growth after inundation (Sub1a vs. Rayada) made us interested to search
homologous genes. We found two homolog members of OsbZIP84 already been
functionally characterized, i.e. one in tobacco as repression of shoot growth
(RSG) , having the function of GA regulation (Fukazawa et al. 2000) and another
in Arabidopsis as VirE2 Interacting Protein 1 (VIP1) (Tzfira et al. 2001). We
generated phylogenetic tree based on homologs protein (around 50% and over
similarity of different plants) sequences of cultivated and wild species (Fig. 3.5).
Among wild species, predicted proteins of Triticum uratu and Aegilops tauschii
showed highest similarity (85% and 75%, respectively) whereas other monocot
cultivated members (corn, sorghum, barley) showed more than 70% homology.
Unfortunately, none of them (either wild or cultivated) are functionally
characterized. A. tauschii is considered as predominant source of variation for
drought tolerance for cultivated wheat because of great adaptability in extreme
habitat (Sohail et al. 2011). However, both of the functionally characterized
proteins showed nearly 50% homology only. However, in the recent report of
Tsugama et al. (2012) showed that VIP1 might involve in osmosensory regulation
through regulating ABA catabolism and that made us more curious to follow gene
expression in other situations of Rayada rice.
62
Fig. 3.5 Phylogenetic tree of OsbZIP84 homolog among wild and cultivated
species. Phylogenetic tree was derived using the Neighbor-Joining method by
MEGA5 (Tamura et al. 2011). Genbank or NCBI accession numbers for the
sequences are as follows: Aegilops tauschii (EMT09464.1), Triticum urartu
(EMS64321.1) , Hordeum vulgare (BAK03813.1), Brachypodium distachyon
(XP_003578876.1), Oryza sativa spp. japonica (NP_001066224.1), Oryza sativa
spp.indica (EAY82358.1), Sorghum bicolor (XP_002441871.1), Zea mays
(NP_001151647.1), Arabidopsis thaliana (AAM63070.1), Nicotiana tabacum
(BAA97100.1)
3.3.6 Putative functions of VIP1 or RSG homolog of rice
As the reported two homolog members showed different functions so what might
be the function of VIP1 or RSG homolog of rice. There are four possibilities: (a)
GA regulation (as RSG) (b) ABA catabolism regulation as VIP1 (Tsugama et al.
2012) (c) both (regulating GA/ABA balance with both VIP1 and RSG functions
altogether) or (d) some new functions. Since based on previous reports both
drought stress and rehydration conditions, all ABA catabolic genes (CYP707A in
63
arabidopsis) were upregulated whereas after rehydration was significantly high
(Kushiro et al. 2004) and similar expression pattern of bZIP84 were observed in
Rayadas (Fig. 3.4), hence we conceived OsbZIP84 may have function in
regulation of ABA catabolism. To check whether bZIP84 play any such role
conceiving the idea of “overexpressed situations might lead to decreased ABA
content and subsequently GA/ABA balance will be in favor of GA”. Since GAABA balance still being considered as decisive theory for either loss or
maintenance of dormancy (Finkelstein et al. 2008), so to check our hypothesis, we
analyzed the expression of OsbZIP84 and ABA catabolic genes in Rayada rice,
Kaladigha together with determining ABA content in four different growth and
developmental situations where ABA trends to decrease as reported earlier.
3.3.6.1 Inundation
Although complete submergence tolerant genotypes such as FR13A and
deepwater rices overcome flooding stress by different strategies, but ABA
decrease is common to both after flooding (Fukao and Bailey-Serres; 2008 Yang
and Choi, 2006). Similarly, a rapid decrease of ABA content after inundation was
observed in Kaladigha (Fig 3.6a). Moreover, prolong inundation (45 days) also
kept ABA at lowest level (Fig. 3.6a). We also compared ABA between node and
internode and observed significant higher ABA in node than internode in both
control and inundated conditions (Fig. 3.6b). Internodes become mainly elongated
after flooding. Interestingly, GA20ox1, key gene of GA biosynthesis, was
strongly up-regulated, especially in 6 hrs. (Fig. 3.6c) when ABA already being
lower extents (Fig. 3.6a). However, key ABA catabolic gene, ABA8ox1 was upregulated for couple of hours and after prolong time (24hrs.) down-regulated (Fig.
3.6d). Interestingly, similar expression pattern of ABA8ox1 was observed in
OsbZIP84 (Fig. 3.6e) with higher fold level.
64
Fig. 3.6 Time course ABA content and selected genes expression after inundation
in Rayada variety, Kaladigha. (a) Time course ABA content in internode ,b)
comparative ABA content between node and internode, gene expression in
internodes of (c) GA20ox1, (d) ABA8ox1 and (e) OsbZIP84 after inundation.
Rayada variety, Kaladigha plants (3 months old) were inundated in water tube
with increasing water level keeping top leaves above water for 45 days. ABA and
gene transcript levels measured by RIA and qRT-PCR, respectively, as mentioned
in Materials and methods. Values are means with ±SD (n=3).
3.3.6.2 Seed maturation
On the progression of seed maturity, embryo growth ceases, accumulates storage
products and most importantly, develops the capacity of dormancy and
desiccation tolerance (Gutierrez et al. 2007). Moreover, in most studied plants,
ABA content increases during initial seed development and decreases at maturity
(Bewley et al. 2013). Similarly, in this study, we also observed higher ABA at
milk and dough stages and progressively declined to maturity (Fig. 3.7a).
Similarly, moisture content declined progressively whereas fresh weight increased
65
instead (Fig. 3.7f). All three ABA catabolic genes were down-regulated in milk
and dough stages (Fig. 3.7b,c,d), however, ABA8ox1 was significantly downregulated (more than 20 folds) suggesting its role on ABA content determination
or ABA homeostasis. But, in developing barley grains main regulator of ABA rise
was reported ABA biosynthesis (Sreenivasulu et al. 2010). In mature seeds,
ABA8ox1 expression was same as dry seed whereas other two ABA catabolic
genes (ABA8ox2, 3) were partially up-regulated instead. Interestingly, OsbZIP84
was also found significantly downregulated during all three stages (Fig. 3.7e)
comparing to dry seed but huge down-regulation showed in mature seeds. So gene
expression of ABA8ox1 and OsbZIP84 in mature seed suggested the decisive role
on keeping high ABA in mature seed.
Fig. 3.7 Time course ABA content and selected genes expression during seed
maturation in Rayada variety, Kaladigha. (a) time course ABA content and gene
expression of (b) ABA8ox1, (c) ABA8ox2 (d) ABA8ox3, (e) OsbZIP84 during
seed developmental stages , (f) changes of fresh weight and moisture content.
Milk, dough and mature stages were of 7, 14, 28 days after anthesis, respectively.
Dry seeds were used from the previous harvest (180 DAH) stored in desiccator.
ABA and gene transcript levels measured by RIA and qRT-PCR, respectively, as
mentioned in Materials and Methods. Values are means with ±SD (n=3).
66
3.3.6.3 Water stress recovery
Numerous experiments in Arabidopsis, barley and beans (Kushiro et al. 2004;
Saito et al. 2004; Millar et al. 2006; Yang and Zeevaart 2006) revealed that under
stress and recovery, ABA catabolism was mainly regulated at the transcriptional
level. Water stress increases the expression of ABA catabolic genes (Kushiro et
al. 2004). Alike to previous reports, we also observed very high ABA
accumulation after water stress (0 min of Fig.3.8a). But high ABA level was
sharply decreased after watering with time progression (Fig.3.8a). Interestingly,
50% of ABA decreased in just 2 hrs. ABA8ox1 was significantly up-regulated for
hour and pick expression was observed at 30 min of watering (Fig. 3.8b).
Apparently it viewed down-expression after two hours, but actually it was then
still up-regulated because we compared with water stressed condition. Similarly,
we observed up-expression of OsbZIP84 in both mild and severe water stresses
(in Fig. 3.4 a,b) in both upland and Rayada varieties. So apparently gene
expression of OsbZIP84 showed partial up-regulated initially in recovery stage,
down-regulated later on (Fig 3.8c); actually highly up-regulated if we compare
with unstressed normal plants.
Fig. 3.8 Time course (a) ABA content , (b) ABA8ox1 and (c) OsbZIP84
expression during water stress recovery in Rayada variety, Kaladigha . Rayada
variety, Kaladigha plants (3 months old) were water stressed by withholding
watering for 5 days, decreasing relative water content around 70%. Then plants
were rewatered and leaf samples (usually 2nd leaf) were collected. ABA and gene
transcript levels were measured by RIA and qRT-PCR, respectively, as mentioned
in Materials and Methods. Values are means with ±SD (n=3).
67
3.3.6.4 Seed Germination
Several hormone interact during seed dormancy release and germination, among
them GA promotes whereas ABA suppresses germination (Kucera et al. 2005).
Decrease of ABA level is prerequisite of germination (Weitbrecht et al. 2011). We
measured ABA content in imbibed seeds of Rayada variety, Kaladigha in time
course and observed sharp decrease in the initial hours of imbibition and later on
keeping low and steady (Fig. 3.9a). Oppositely, the water absorption pattern was
observed quick and sharp increase during the first few hours of imbibition,
gradual then steady afterwards (Fig. 3.9d). Exogenous ABA showed a dose
dependent effect, 0.5 µM ABA delayed the germination and growth whereas
10µM ABA completely restricted shoot development and growth but root growth
was suppressed but still developed (Fig. 3.9e). ABA8ox1 was increasingly upregulated till 4 hrs (Fig. 3.9b), later on up-regulated but lesser extent whereas
ABA8ox 2 and 3 was decreased instead (data not shown). Remarkably, OsbZIP84
was significantly up-regulated during first 8 hrs of imbibition (Fig. 3.9c).
Fig. 3.9 Time course (a) ABA content and gene expression of (b) ABA8ox1, (c)
OsbZIP84 and (d) water absorption pattern during imbibition and (e) dose
dependent inhibitory effect of ABA on seed germination in Rayada variety,
Kaladigha.
We also examined time course gene expression level of all 5 NCED genes after
imbibition. Interestingly, none of them were found to up-regulated after
68
immibition rather decreased instead (Fig. 3.10). As none of the NCED is upregulated, then certainly main regulator of ABA decrease after imbibition is ABA
8’-hydroxylases.
Fig. 3.10 Time course relative gene expression of NCEDs after imbibition. RNA
was isolated from imbibed seeds of different time point and compared with that of
dry seed (0hrs) . Values represent average of triplicate samples.
3.3.7 Dormancy phenotype of osbzip84
Among tested four different stages of growth and development stages, OsbZIP84
and ABA8ox1 showed almost similar expression pattern except mature seeds
during seed maturation (Fig. 3.7b, e). All these results clearly suggested
involvement of OsbZIP84 in regulation of ABA catabolism. To confirm the
function of OsbZIP84, we collected, screened and identified T-DNA insertional
homozygous mutant of OsbZIP84. Mutant osbzip84 clearly showed dormancy
phenotype in seed germination (Fig. 3.11a). Seed germination was significantly
delayed than wild type (Fig. 3.11b). Almost 90 percent of control seeds
germinated within 36 hrs of imbibition, however a few mutant seeds germinated,
mostly rupture appeared (Fig. 3.11b). To reach 100% mutant seed germination, it
69
required 3-4 days. Seedling establishment and growth was significantly retarded
in mutant. We measured root (Fig. 3.11 c, d) and shoot length (Fig. 3.11e, f) in 6
and 10 days after imbibition and always found significant reduction than control.
To reconfirm the phenotypic explanation, pharmacological approach was used.
Wild type seeds were germinated in presence of ABA catabolic inhibitor,
diniconazole and found almost similar phenotype (Fig. 3.11a inset). Diniconazole
is a potent inhibitor of ABA 8'-hydroxylase regarded as ABA catabolic inhibitor
(Kitahata et al. 2005). These similar phenotypes of mutant and ABA catabolic
inhibitors strongly supported our hypothesis of involvement of OsbZIP84 in ABA
catabolic regulation.
Fig 3.11 Germination and seedling growth performance of osbzip84. (a)
comparative phenotype of osbzip84 with wild type and in presence of ABA
catabolic inhibitor, diniconazole in control seeds (inset), (b) germination
percentage and comparative root (c, d) and shoot length(e, f) after 6 and 10 days,
respectively. Seeds of 30 DAH were used for germination test in both wild and
70
mutants. Each batch contained 10 seeds with three replicates. The symbol (*)
indicates the significance level, * for P<0.05, *** for P<0.001.
3.3.8 Elevated ABA in osbzip84 seeds but reversed in water stress
Apart dormancy phenotype, osbzip84 also showed another feature; significantly
reduced grain weight (Fig. 3.12b) and grain size (Fig. 3.12c) in two successive
generations of homozygous mutant. Although dormancy phenotype of osbzip84
confirmed our hypothesis of ABA catabolism regulation, but reduced grain weight
and size lead us to check the other possibilities. Several factors can regulate grain
filling, thus grain weight and size such as carbon assimilation rate , remobilize of
pre-stored in vegetative tissue (Yang and Zhang 2006) , shorter grain filling
period (Kobata and Uemuki 2004), high temperature (Yamakawa et al. 2007) as
well as drought. However, to ascertain our hypothesis, we measured ABA content
in both wild type and mutant seed. Interestingly, mutant seeds showed
significantly elevated ABA content (nearly double) (Fig. 3.12a) despite its
reduced grain weight (Fig. 3.12b). So certainly delayed seed germination was due
to elevated ABA content despite reduced size and weight.
Although osbzip84 showed elevated ABA in seed but significant reduced ABA
content was observed in leaves in normal (Fig. 3.12d), dehydrated (Fig. 3.12e)
conditions (detached leaf). So it seems OsbZIP84 might have played other
important role in ABA homeostasis, not only seed dormancy; need further
investigation.
71
Fig. 3.12 Change of ABA content, grain size and weight of osbzip84 (a) elevated
ABA content in mutant seeds, (b) reduced grain weight (c) grain size and
comparative change of ABA content in (d) normal (e) dehydrate leaves of
osbzip84. ABA was determined using RIA methods described in materials and
methods. Random seed samples were used to compare grain weight and size.
ABA content of detached leaf was determined after air drying for 30 min. All
ABA samples were replicated thrice. The symbol (**) represented significance
level at P<0.01
72
3.4 Discussion
In this study, we first examined and compared the physiological basis of
dormancy in deep water and Rayada rice then searched for the plausible gene of
interest that regulate ABA catabolism through expression analysis of 32 OsbZIPs
in three extreme ecotypes/varieties during seed germination . After analyzing the
expression and functional homologs, we selected OsbZIP84 and examined ABA
content and expression analysis of ABA catabolic genes in four growth and
developmental stages. Our results clearly demonstrate that OsbZIP84 play an
important role in ABA homeostasis.
3.4.1 Natural variation of seed dormancy
Natural variations among accessions are useful to study the molecular mechanism
of seed dormancy. Variation of seed dormancy among Arabidopsis accessions
exists, some accession such as Cape Verde Islands (Cvi) possess strong seed
dormancy whereas the laboratory strain Landsberg erecta (Ler) and Columbia
(Col) possess low dormancy. Similarly, after ripening requirement also
significantly different between them , dry storage of 74-185 days are required to
achieve 50% germination for Cvi while Ler only requires 12-17 days (AlonsoBlanco et al. 2003). Through QTL analysis of recombinant inbred line derived
from Cvi and Ler identified major QTL of seed dormancy, DOG1 (delay of
germination), common in dormant accessions. Recent studies identified DOG1 as
one of the key regulator as dog1 shows completely lack of seed dormancy without
any other pleiotropic phenotypes except reduced seed dormancy (Nakabayashi et
al. 2012). DOG1 regulate seed dormancy through enhanced ABA and sugar
responsiveness through enhanced ABI4 (Teng et al. 2008).
Wide variation of dormancy was observed in both cultivated rice species O. sativa
and O. glaberrima. But generally both of them possess less intense seed dormancy
comparing to wild species. Mean dormancy period among 137 varieties of O.
sativa found ranged from 0 to 110 days (Roberts 1961) whereas that of 35
cultivars of O. glaberrima showed 85-155 days (Misra and Misro, 1970).
However, among wild species O. glumaepatula and O. rufipogon, showed the
73
strongest dormancy (180 days) (Veasey et al. 2004). However, the degree of
dormancy significantly varies on harvesting stage ripeness as well as storing
temperature. Cooler temperature prolongs dormancy whereas higher temperature
alleviate dormant period (Veasey et al. 2004). Numerous studies were performed
to identify QTLs of rice seed dormancy but successful identification of relevant
gene is scarce. To date , only successful dormancy regulatory gene has been
characterized in rice from QTLs , sdr4 through backcross inbred line derived from
the japonica cultivar Nipponbare and the indica cultivar Kasalath (Sugimoto et al.
2010).
Since Rayadas possess yearlong life cycle, hence lack of seed dormancy seems an
adaptive feature of Rayada rice. Interestingly, as mentioned in the preceding
chapter, the climatic features such as the rainfall, humidity and temperature drop
to the lower extent during the seed maturation period to reduce inadvertent
germination.
3.4.2 ABA, ROS and seed dormancy: linked altogether
Recently, plenty of research has identified reactive oxygen species (ROS) as
signal molecules regulating growth and development as well as biotic and abiotic
stresses (Rodriguez et al. 2004; Jones et al. 2007; Zhang et al. 2010; Zhang et al
2001), programmed cell death (Bethke and Jones 2001) including dormancy
alleviation, after-ripening, and germination (Oracz et al. 2007; El-MaaroufBouteau and Bailly 2008; Ye et al. 2012a). Several cellular organelle such as
chloroplasts, mitochondria, peroxisomes (Neill et al. 2002, Shigeoka et al, 2002)
as well as some enzyme complexes such as class III peroxidases, oxalate oxidases,
amine oxidases, lipoxygenases, quinone reductases and plant NADPH oxidases
(NOXs or rboh), can generate ROS in cells. .
Production of H2O2 after imbibition was observed in several plants, i.e. barley
(Ishibashi et al. 2012), soybean (Puntarulo et al. 1988), maize (Hite et al. 1999),
wheat (Caliskan and Cuming 1998), and Zinnia elegans (Ogawa and Iwabuchi,
2010), rice (Ye et al 2012), Arabidopsis (Liu et al. 2010). Oppositely, exogenous
application of ROS scavenger significantly suppressed seed germination
74
(Ishibashi et al 2012, Ye et al. 2012a). Here we observed freshly harvested
Rayada seeds accumulated excessive ROS in embryonic axis whereas freshly
harvested seeds of typical deepwater rice accumulated sparingly low amount (Fig.
3.2). Moreover, exogenous ABA suppressed ROS accumulation as well as seed
germination of freshly harvested Rayada seeds (data not shown). Moreover, ABA
content was significantly reduced than typical deepwater rice (Fig. 3.1b). So it
was clear huge ROS accumulation was due to reduced ABA content. Similarly,
ROS accumulation of non-dormant seeds in Arabidopsis was evident than that of
dormant seeds (Leymarie et al. 2012). Moreover, NADPH oxidase mutant
(rbohD) showed deep dormancy due to less H2O2 production capacity. So ROS
accumulation after imbibition presumably played key role in defining seed
germination of freshly harvested seeds of Rayada variety.
3.4.3 Regulation of ABA catabolism: function of OsbZIP84 in
Rayada rice
The balance between ABA biosynthesis and catabolism are determinants of ABA
content. NCEDs are the main regulatory genes of biosynthesis whereas ABA8oxs
are that of catabolism (Qin and Zeevaart 1999; Nambara and Marion-Poll 2005).
Five NCED and three ABA8ox genes have been reported in rice (Saika et al.
2007; Zhu et al. 2009). Numerous experiments reported the importance of ABA
catabolism regulating ABA levels and homeostasis in barley (Chono et al. 2006;
Millar et al. 2006), Arabidopsis (Millar et al. 2006; Okamoto et al. 2006;
Umezawa et al. 2006; Okamoto et al. 2010), bean (Yang and Zeevaart 2006),
maize (Ren et al. 2007) and rice (Yang and Choi 2006; Saika et al. 2007; Zhu et
al. 2009; Ye et al. 2011). The significance of ABA catabolism after submergence
or flooding induced petiole or internode elongation was reported earlier in
flooding-tolerant Rumex palustris (Benschop and Jackson 2005) and rice (Yang
and Choi 2006), respectively. Decreased ABA content is a prerequisite for
increased GA responsiveness and that leads to the enhanced elongation as
exogenous ABA can completely demolish internode elongation capacity
(Hoffmann-Benning and Kende 1992; Kende et al. 1998). Decreasing ABA and
increasing phaseic acid (PA) level were reported in rice after flooding despite the
75
rice types whether Sub1A (Fukao and Bailey-Serres 2008) or deepwater (Yang
and Choi 2006) even in japonica rice (Saika et al. 2007). Among three
OsABA8oxs, only the expression of OsABA8ox1 was significantly increased and
the induction was controlled partially by ethylene (Saika et al. 2007). We also
observed similar pattern of ABA decrease (Fig. 3.6a) and ABA8ox1 expression
increase (Fig. 3.6d) after inundation in Rayada rice. In addition, OsbZIP84 was
also showed similar pattern of expression both after inundation (Fig. 3.68e) and
imbibition of seeds (Fig. 3.9c) suggesting the possible connection between the
genes in ABA homeostasis.
In water stress recovery stage, we observed significant up-expression of
OsABA8ox1 in 30 min after rehydration (Fig. 3.8b). Similarly, up-expression of
OsABA8ox1 was also observed earlier in rice (Ye et al. 2012a). Both upland and
Rayada rice showed huge up-expression of OsbZIP84 in water stress and recovery
stages (Fig. 3.4a,b). However, expression of OsbZIP84 was consistently downregulated in two Sub1A rice both in mild and severe stresses (Fig. 3.4) made the
explanation difficult. Perhaps either Sub1A or semi-dwarf nature might have
interactions or some other factors involved herein; it certainly demands further
study. However, Sub1A showed cross talk with drought tolerance (Fukao et al.
2011) and ubiquitous expression of Sub1A (Ubi:Sub1A) delayed both seed
maturation and germination (Fukao and Bailey-Serres 2008) suggesting Sub1A
might interfere the process.
3.4.4 Elevated ABA in osbzip84 seed results in dormancy
phenotype
ABA plays central roles in the induction and maintenance of seed dormancy.
Although exogenous ABA restricts the germination potential and delay
endosperm rupture in rice, Arabidopsis and barley (Muller et al. 2006) but high
endogenous ABA accumulating mutant (cyp707a1a2a3) in Arabidopsis showed
deep seed dormancy (Okamoto et al. 2010) suggesting ABA catabolism is one of
the key factors that regulate seed dormancy and germination. ABA catabolic triple
mutant (cyp707a1a2a3) accumulated 70-fold higher ABA than wild type in
76
Arabidopsis and remained at high levels after seed imbibition (Okamoto et al.
2010) whereas cyp707a2 mutants accumulated 6 fold higher ABA (Kushiro et al.
2004). Similarly, high accumulation of ABA was also observed in osbzip84 (Fig.
3.12a) connecting the dormancy phenotype (Fig. 3.11a). Lack of seed dormancy is
one of the main features of Rayadas (Table 2). Moreover, Rayadas showed high
expression of OsbZIP84 after imbibition (Fig. 3.9c) suggested the faster catabolic
activity reduced the ABA thus lack seed dormancy. Tsugama et al. (2012) clearly
demonstrated using both in gel shift and chromatin immunoprecipitation analyses
that VIP1 (OsbZIP84 homolog in Arabidopsis) directly bound to DNA fragments
of the CYP707A1/3 promoters. All these results clearly suggest the importance
ABA 8-hydroxylases for regulating seed dormancy by the regulation of
OsbZIP84.
However, OsbZIP84 might play dual regulatory role in ABA homeostasis.
Because after water stress, OsbZIP84 showed up-expression in both Rayada and
upland rice (Fig 3.4ab and 3.8c), consequently osbzip84 accumulated significantly
less ABA after water stress imposed by air drying of detached leaves (Fig.3.12e),
even possessed less ABA in normal leaves (Fig.3.12d) . These decreased ABA
content signified the increased expression of OsbZIP84 in water stress conditions.
Moreover, osbzip84 displayed increased water loss and slower recovery after
water stress and recovery (data not shown). Certainly, further experiments are
essential to confirm the dual regulatory role of OsbZIP84 in ABA homeostasis.
In summary, lack of dormancy of Rayada might be an adaptive trait and several
concerted features; for instance, less ABA content in freshly harvested seeds;
faster ABA catabolism and enhanced ROS accumulation after imbibition,
collectively might involved in the regulation of dormancy. Gene expression
analysis of OsbZIP84 and OsABA8ox1 together with ABA content in four growth
and developmental stages suggest the function of OsbZIP84 in ABA catabolism.
Dormancy phenotype of
osbzip84 along with similar phenotype after ABA
catabolic inhibitor , diniconazole conclude it’s function in ABA catabolism.
77
78
Chapter 4 Shoot development under submergence is
regulated by ROS and riboflavin in Rayada rice
4.1 Introduction
Rainfed and irrigated lowland including flood-prone ecosystems consist of over
90% of total rice cultivation area; account around 95% of global rice production
(Maclean et al. 2002). Direct seeding of rice is the popular method of seeding in
these ecosystems because of its operational simplicity, low labor cost along with
week’s earlier maturation (Balasubramanian and Hill 2002). However, sudden
sallow flooding due to heavy rain fall or waterlogging limit the seedling
establishment in direct seeded fields since rice is sensitive to submergence during
seed germination (Ismail et al. 2012).
All other cereals (wheat, maize, barley, oat and sorghum) are much more sensitive
to submergence during seed germination, even cannot germinate (Ismail et al.
2012). In comparison with them, rice is more tolerant to submergence; efficiently
able to germinate under submergence. However, the tolerance is only limited to
coleoptile development but unable to develop subsequent shoot and root or fails to
establish seedling. Complete submergence always leads to oxygen deficiency
where lack or limited oxygen (anoxia or hypoxia) limit the energy budget as O2 is
the ultimate electron acceptor. Moreover, anoxia or hypoxia also restricts the
function of some enzymes that restrict the mobilization of stored carbohydrate
(Ismail et al. 2012).
Molecular mechanism of flash and prolong flood tolerance at vegetative stage of
rice has been already revealed. Flash flood or complete submergence tolerance,
governed by a single gene SUB1A restricting GA responsiveness, identified from
landrace, FR13A (Xu et al. 2006; Bailey-Serres et al. 2010). However, SUB1A
regulating submergence tolerance is limited to vegetative stage, not involved in
seed germination stage (Magneschi and Perata 2009). Oppositely, prolonged
either stagnant or rising flood tolerance of deepwater or floating rice is regulated
by snorkel genes (SK1, SK2), enhancing GA responsiveness by unknown manner
(Hattori et al. 2009). However, flooding tolerance during seed germination and
early seedling growth and establishment is still in obscure.
79
4.1.1 Submergence tolerance during seed germination: a rare trait
Submergence tolerance in seed germination of rice or the feature of shoot and root
development under submergence is a rare trait. Attempts were made in past to
identify submergence tolerance capacity and integrate in breeding program but
resulted limited success, mainly lack of tolerant genotypes and inadequacy of
comprehensive knowledge of physiological basis of tolerance (Ismail et al. 2009).
Recently, after large scale screening of over 8000 germplasms, only few varieties
(19 only) were identified that can successfully establish seedlings under
submergence (Angaji et al. 2010). However, subsequent replicated trails limited
the tolerant capacity to only 5-6 genotypes i.e. Khao Hlan On, Khaiyan,
Kalongchi, Nanhi, Ma-Zhan Red and Cody (Angaji et al. 2010; Ismail et al. 2009;
Miro and Ismail 2013). Interestingly, out of these six, two of them, Khaiyan,
Kalongchi are traditional varieties of Bangladesh. In addition, Khao Hlan On and
Nanhi are traditional varieties of Myanmar and India, respectively (Angaji et al.
2010). Interestingly, only these two countries share border with Bangladesh along
with cultural and agricultural practices. So it might not be unlikely that tolerant
varieties might have developed or originated in similar region, even in same
territory. Remarkably, preliminary screening of IRRI identified another
Bangladeshi deepwater rice variety Dholamon 64-3 as a tolerant genotype with
high survival percentage (80%) (Fig. 1.8a) (Angaji et al. 2010). Interestingly,
some germplasms adapted to deepwater conditions of Bangladesh were also
reported superior performance of seedling establishment after submergence
(Yamauchi et al. 1993). Since Rayadas are more primitive among deepwater rices
having multiple stress tolerance capacity and also endemic to certain deepwater
area of Bangladesh, so the capacity of submergence tolerance during seed
germination in Rayada rice certainly demands exploration.
4.1.2 Physiological features of tolerant genotypes
Some physiological differences between tolerant and intolerant genotypes have
already been revealed (Ismail et al. 2009; Ismail et al. 2012; Miro and Ismail
2013). Sugar metabolism through the glycolytic pathway plays the key role in
80
energy production; hence regulation of this process under submergence is very
critical for seedling establishment. After submergence starch concentration is
progressively declined in tolerant lines but remained high in intolerant genotypes
suggesting the importance of carbohydrate mobilization after submergence (Ismail
et al. 2009). Moreover, amylases play key role in breakdown of starch of rice
during seed germination; so total amylase activity expectedly is observed keeping
significantly high in tolerant genotypes than intolerant one. Notably, high amylase
activity is positively correlated with shoot and root growth along with seeding
survival (Ismail et al. 2009; Ismail et al. 2012; Miro and Ismail 2013). Similarly,
submergence tolerant genotypes also keep higher soluble sugars during seed
germination and seedling establishment stage. Among α-amylases, only RAmy3D
is reported having differential expression between tolerant to intolerant genotypes,
others showed almost same with no remarkable difference (Ismail et al. 2009;
Ismail et al. 2012).
4.1.3 Alternative strategy to reveal regulatory factors of shoot
development under submergence
As submergence tolerance is a rare phenomenon in rice and no specific indication
of tolerance mechanism, especially in context of molecular signaling, hence we
have attempted with an unconventional strategy to develop shoot in intolerant
varieties first in artificial induced condition under submergence. Then we have
tried to hinder or augment shoot development by interfering plausible interacting
pathways with known interacting chemicals to reveal the factors that interact with
the submergence tolerance. We, for the first time have successful developed a
condition inducting Rayada rice phenomenon and identified several positive and
negative regulators that either induce or hinder the shoot development process
under submergence.
81
4.2 Materials and methods
4.2.1 Plant materials and growth conditions
Rice seeds of diverse origin and type were used in these studies. It included
Rayada (Kaladigha, Beto), typical deepwater rice (Habigonj aman VIII), flash
flood tolerant SUB1A rice (BRRI51, BRRI52) with BRRI52 background variety
BR 11, indica variety (YD6) and japonica type (Nipponbare, Donjing). YD6 is
popular Chinese varieties whereas Nipponbare, Donjing are varieties of Japanese
and Korean origin, respectively; rest others are Bangladeshi origin. Intact seeds
(with hull) were used to ascertain the natural condition and ability whereas
dehulled seeds were used in some experiments for downstream RNA and ABA
extraction, mentioned in respective figures. Normally 50-100 seeds of YD6 were
used in all treatments with three biological replicates whereas 10-20 seeds for
other varieties including Rayada. Control (air) seeds were germinated on moist
filter papers in dark at 28ºC. Submerged germination was setup with degased
deionized distilled water (ddH2O) in DURAN laboratory bottle of 500ml with
height of 17 cm submergence. Special precautions were taken to avoid air bubble
trapped inside bottle.
4.2.2 Different treatments
Different treatments were used with several known chemicals of specific
pathways .Most of the chemicals used in these studies were of reagent grade,
mostly from Sigma-Aldrich.
a)
H2O2: Freshly prepared 10 mM H2O2 was used for supplementation.
b)
Vitamin B complexes: Different vitamin B complexes (B1, B2, B3, B6,
B9) were used in the experiments of fixed 200 µM concentration. However,
different concentration of riboflavin (B2) were used in later experiments and
dissolved only in ddH2O (within in the limit of solubility in water) although
riboflavin is slightly soluble in water. Despite high solubility in alkalies, we
avoided due to instability of riboflavin in alkaline solution. Since riboflavin is
highly photolabile in solution, hence we warped the germination setup with
82
aluminum foils to protect light for first four days (product information sheet Sigma-Aldrich). Then the setup was unwrapped and placed under light in green
house conditions with 14/10 hrs day-night cycle.
c)
ABA: A concentration 1µM ABA was used in submergence; the
concentration is not completely inhibitory for seed germination in aerobic
condition. High concentration of ABA (10 µM) was used to follow the inhibition
pattern on root and shoot growth in Rayada rice varieties, Kaladigha and Sarsari.
d)
NaN3: Sodium azide is a potent inhibitor of mitochondrial complex IV. A
concentration of 1 mM of NaN3 was supplemented in submergence either singly
or with riboflavin and H2O2.
e)
Nacl: Mild salinity stress was imposed with 50 mM Nacl (equivalent to
3.1 dSm-1 EC and 0.25 MPa of osmotic pressure).
f)
PEG mediated water stress: 15% PEG 6000 based on Kimura B nutrient
solution were used to induce artificial water stress for months old seedlings of
different varieties. Water stress experiments were carried out in phytotron at
28°C, 60% relative humidity with 16/8hrs day night cycle.
4.2.3 Uncoating of Rayada seeds
Seeds of Rayada variety Kaladigha were uncoated manually using single edge
razor blade. Special attention was paid to embryo region to avoid injury.
4.2.4 Electric conductivity (EC) measurement
Orion 105 basic handheld conductivity meter was used for EC measurement.
Intact and uncoated 100 seeds of YD6 variety were imbibed in ddH2O or 10mM
H2O2 and the change of EC was observed in time course among control, coatless
and H2O2 treatment. All experiments were done at least of three biological
replicates.
83
4.2.5 RNA extraction and quantitative real-time (qRT)-PCR
RNA was extracted from respective samples (only coleoptile or caryopsis) using
the Agilent Plant RNA isolation Mini Kit (Qiagen, Hilden, Germany) and then
digested with RNase-free DNase I (Amersham, USA) to eliminate genomic DNA
contamination. First-strand cDNA was synthesized with oligo (dT) primers using
a Promega cDNA kit as according to the manufacturer’s instructions (Promega,
USA). Transcript levels of each gene were measured by qRT-PCR using a
Mx3000p QPCR System (Agilent, USA) with iQ SYBR Green Supermix (BioRad, USA). The data were normalized to the amplification of a rice actin-1 gene.
Primer sequences of genes used for qRT-PCR expression analysis are as follows:
RAmy1AF-5’CTACGCATACATCCTCACCCAC3’,
RAmy1AR-5’CTGCCGGTTTCTGATTGACAC3’,
RAmy3DF-5’TAGCAGCAACTCACTATCGAACA3’,
RAmy3DR-5’CAGTTGAAACCCTGGAAGAGGAC3’,
RAmy3EF-5’TGGAGAAGAAGCAGAGTTGAGAC3’,
RAmy3ER-5’TAAACCCCTGGAAGAGAACTTGG3’,
Actin1F-5’AGAGGAGCTGTTATCGCCGTCCTC3’ and
Actin1R-5’GCCGGTTGAAAACTTTGTCCACGC 3’.
4.2.6 Extraction and measurement of ABA
Measurement of endogenous ABA content was carried out using the
radioimmunoassay (RIA) method as described by Jia et al. (2012). 200 mg
seedlings of 5 days after imbibition was ground in liquid nitrogen and
homogenized in 1 ml of distilled water and shaken overnight at 4°C. The
homogenates were centrifuged at 12000g for 20 min at 4°C and the supernatant
were directly used for ABA assay. The 450 μl reaction mixture comprised of 200
μl of phosphate buffer (pH 6.0), 100 μl of diluted antibody (Mac 252) solution,
100 μl of [3H] ABA (@ 8000 cpm) solution, and 50 μl of crude extract. The
84
mixture was then incubated for 45 min at 4°C and the bound radioactivity was
measured in pellets precipitated with 50% saturated (NH4)2SO4 with a liquid
scintillation counter.
85
4.3 Results
4.3.1 High ABA restricts shoot development, not root
Multiple stress tolerances are one of the unique features of Rayada rice varieties
(discussed in Chapter 2). A 5 µM ABA concentration was reported as completely
inhibitory to rice seed germination (Ye et al. 2012a; Kim et. al. 2012). However,
we germinated Rayada seed on as much as twice of the inhibitory concentration.
Exogenous 10 µM ABA is very high concentration during seed germination; rice
seeds never reach such a high level of ABA concentration, even in deep dormant
seed. Most others varieties we tested showed complete inhibition of seed
germination on such high concentration of ABA. However, suppression of
germination in Rayada varieties was also observed, but not at inhibitory level.
Inhibitory effect of high concentration ABA was observed mainly on shoot
development (Fig. 4.1) in two Rayada varieties. Although reduced but remarkable
root growth was still observed in both of the Rayada varieties we tested (Fig, 4.1,
inset zoom in figures). These data clearly indicated that high ABA tolerance of
Rayada seeds during seed germination. Moreover, root development was less
sensitive to ABA but shoot development was opposite to root. Similar results of
preferential shoot suppression of ABA were reported earlier in water stresses
condition (Sharp and Davies 1989).
Mild salinity stress imposed by 50 mM Nacl during seed germination, however,
did not restrict either root or shoot development but growth in two Rayada rice
varieties (Fig. 4.1). Lin and Kao (1995) reported that GA3 counteracted Naclinhibited shoot growth, but not root growth suggesting differential behavior of
root and shoot growth and development after stress during seed germination as we
observed after high exogenous ABA. Since Rayada rice possess high elongation
ability after flooding (Fig. 2.4c,d) or high GA responsiveness (due to SK genes)
and GA counteracts salinity induced shoot growth inhibition(Lin and Kao 1995),
and moreover, even freshly harvested Rayada seeds possess less ABA along with
both partial and complete submergence tolerant, so we hypothesized Rayada rice
might be more tolerant to submergence tolerance during seed germination,
especially to shoot growth.
86
Fig. 4.1 Effect of high ABA and mild salinity on seed germination of Rayadas.
Upper panel (Kaladigha), Lower panel (Sarsari) 5 days after imbibition. Salinity
and ABA stress was imposed by 50 mM Nacl and 10 µM ABA, respectively.
Representative image taken 5 days after imbibition from three replicates. Zoom in
image of a seed showing growth inhibition pattern on shoot and root (top right
(Kaladigha), bottom right (Sarsari).
4.3.2 Rayada seedlings: more tolerant to composite stress
Some of the natural stress situations are with pattern of composite stress i.e.
multiple stresses together. For instance, in drought the main stress imposed due to
soil water deficit, however, some other stress also occasionally developed along
with such as high daytime temperature, reduced nutrient availability as well as
sometimes increased salinity (Oliver et al. 2011). Similarly, salinity also imposes
two types of stresses i.e. ionic along with oxidative stress. Hence we attempted to
examine the composite stress tolerance capacity of Rayada rice to modern rice
varieties imposing successive stress. Month’s old seedlings were pretreated with
10mM H2O2 for 24 hrs then imposed water stress using 15% PEG 6000 on
Kimura B nutrient solution. Within 12 hrs after imposing water stress, H2O2
87
pretreated plants of both modern varieties (BR 11 and BRRI 52) showed water
stress symptoms (leaf rolling and flaccid leaves) (Fig. 4.2 a) and relative water
content (RWC) decreased to 68.23 and 63.57 % respectively. However, no
significant difference was observed between BR11 and BRRI 52. BR11 is the
background variety of SUB1A introgressed BRRI 52. So it reflected noninvolvement of SUB1A in these composite stress tolerances. After 4 days water
stress, most of the plants of modern varieties (either BR 11or BRRI 52) died in
H2O2 pretreated set (Fig.4.2b) whereas Rayada varieties showed water stress
symptom only (Fig.4.2c), still possess significant capacity to recover from water
stress (Fig.4.2c). Around 15% plants of these modern varieties were recovered
after stress withdrawal whereas most of the plants of Rayada varieties recovered
successfully (Fig.4.2d). These results clearly represented the composite stress
tolerance of Rayada rice, especially after oxidative stress.
Fig. 4.2 Composite stress tolerance capacity of Rayadas to modern rice varieties.
a) oxidative following water stress phenotype of modern varieties 12 hrs after
water stress impose, b) that of 4 days , c) comparative phenotypes between
88
Rayadas and modern varieties after 4 days , d) recovery performance 2 days after
withdrawing water stress. Month’s old seedlings were pretreated with 10mM
H2O2 for 24 hrs then imposed water stress using 15% PEG 6000 based on Kimura
B nutrient solution. Composite stress experiment was carried out in phytotron at
28°C , 60% relative humidity with 16/8hrs day night cycle. Representative images
of five replicates were shown here.
4.3.3 Augmentation of seed germination by hydrogen peroxide
We examined effect of hydrogen peroxide on seed germination both in aerobic
and submerged conditions of diverse varieties and it clearly represented that H2O2
speeded up the germination and the phenomenon of speedup by H2O2 was global
i.e. irrespective of varieties (Fig.4.3a). Generally, seed germination under
submergence was delayed than aerobic control, almost a day. Interestingly, all the
varieties showed elevated germination performance after H2O2 treatment in both
aerobic (after 30 hrs. of imbibition) and submerged conditions (48 hrs.) and it was
almost doubled although variation observed among varieties (Fig.4.3a).
Differential effects of gradient H2O2 on root and shoot growth were observed in
both aerobic and submerged conditions. In aerobic condition, increasing H2O2
concentration trended to decrease root development and growth whereas shoot
growth and development was much more tolerant to oxidative stress (up to
50mM), keeping no change , even promoted shoot growth. (Fig. 4.3b upper
panel). Likewise, in submerged condition lower concentration of H2O2 increased
the coleoptile length, however, 5mM or above concentration trended to decrease
coleoptile length (Fig. 4.3b, lower panel). No root development was observed in
submerged condition, even after H2O2 supplementation.
We also examined change of ABA content after 10mM H2O2 during seed
germination and seedling establishment stage in Rayada rice variety, Kaladigha. It
clearly showed H2O2 treatment significantly reduced ABA of seeding
establishment stage (Fig. 4.3c).
89
Fig. 4.3 Effect of H2O2 on seed germination, coleoptile growth and ABA content.
(a) effect of H2O2 in seed germination in aerobic and submerged conditions (b)
effect of gradient H2O2 concentration on root and shoot growth in aerobic (upper
panel) and submerged conditions (lower panel) , (c) change of ABA content after
H2O2 treatment in Rayada rice variety, Kaladigha seedlings, 4 days after
imbibition in aerobic condition. Germination rate was observed after 30 hrs
imbibition in aerobic condition whereas submerged after 48 hrs.
4.3.4
Shoot
development
of
Rayadas
under
composite
submergence stress
Since we observed excellent performance of composite stress tolerance (oxidative
followed water stress) of Rayada rice varieties (Fig. 4.2c, d) and tolerance of
shoot or coleoptile development after oxidative stress in aerobic and submerged
condition, respectively (Fig. 4.3b) hence we imposed Rayada seeds with another
90
type composite stress during seed germination (submergence together with
oxidative stress). Surprisingly, we observed the unique feature of shoot
development under such stress condition in Rayada variety, Kaladigha (Fig. 4.4).
Then we tested diverse varieties from indica to japonica, Rayada to deepwater but
observed merely Rayada varieties to develop shoot under such composite
submerged stress. The interesting phenotypes of shoot development of Kaladigha
in such composite submerged stress made us interested to check in other Rayada
variety. Similar result was observed in another Rayada variety, Beto (Fig. 4.4). In
addition to shoot development, Beto developed distinct and longer mesocotyl and
coleoptile. Two other indica varieties including a Chinese variety YD6, showed
partial shoot initiation capacity but cannot precede further develop further
(Fig.4.7).
Fig. 4.4 Exceptional submergence tolerance capacity of Rayada varieties under
composite submerged stress. Representative image of several replicates taken 7
days after submergence. Composite stress (submergence plus oxidative stress)
was imposed with 17 cm 10 mM H2O2 submergence. Details are in Materials and
methods.
91
4.3.5 Coatless Rayada seeds unable to develop shoot under
submergence
As only Rayada varieties developed shoot after oxidative submerged stress, then
we tried to identify how Rayada seeds were different than others. The only visible
difference was seed coat color. Generally Rayada varieties have red seed coat or
kernels whereas most others type varieties were white; however, some traditional
varieties have also red kernel color. So we attempted to check whether the seed
coat or pericarp color had any involvement on shoot development under such
submergence as pigmentation is confined to the pericarp (Juliano and Bechtel
1985). We removed the seed coat manually and germinated under same condition
where Rayada seeds developed shoot. Interestingly, coatless Rayada seeds were
completely unable to develop shoot (Fig. 4.5a).
To inquest the inability of shoot development of coatless seeds of Rayadas, we
compared electric conductivity (EC) of intact to coatless seeds together with H2O2
treatment and observed a sharp and highly significant increase of electric
conductivity in coatless seeds than control or H2O2 treatment (Fig. 4.5b) . H2O2
treatment also increased the electric conductivity but not significantly different
from control seeds. We also compared the germination percentage of coatless
seeds; coatless seed germinated faster than intact seed, even ABA inhibition was
also observed significantly overruled (Fig. 4.5c), however, significant decreased
of shoot growth was observed in coatless seed in aerobic condition.
92
Fig. 4.5 Effect of seed coat on germination and electric conductivity. a)
suppression of shoot development under composite submerged stress of
Kaladigha. b) electric conductivity of coatless seed with H2O2 treatment c)
germination performance of coatless and intact seeds. Representative image of
three replicates taken 5 days after submergence.
93
4.3.6 Riboflavin induces shoot development under submergence
Vitamin B complexes are most abundant vitamin present in rice seed. Moreover,
wild or red rice had been reported to have elevated vitamin B complexes in seed
coat or bran. So we supplemented different vitamin B complexes along with H2O2
in submerged seed germination in YD6 (indica) variety that showed partial shoot
initiation. Among different B complexes, surprisingly only vitamin B2 or
riboflavin promoted shoot development under oxidative submergence (Fig. 4.6a).
Apart vitamin B complexes, we also supplemented cytokinine, BAP that was
widely used in shoot development in rice callus culture. However, BAP showed
no augmenting effect on shoot development comparing to riboflavin effect (Fig.
4.6a). Supplementation of riboflavin and H2O2 successfully developed shoot in all
varieties especially intolerant japonica type variety, Donjing (Fig. 4.8b) and
Nipponbare. Both of the varieties were completely unable to develop shoot in
submergence, even after 10 mM H2O2. We also checked whether lower
combinational concentration or singly riboflavin can induce the shoot. We found
neither high concentration of riboflavin (200 µM) singly nor in combination with
lower concentration of H2O2 (100 µM) with high concentration of riboflavin (200
µM) able to induce shoot under submergence (Fig, 4.6b). So riboflavin and H2O2
acted synergistically with a concentration dependent manner in all varieties we
tested whereas in Rayadas only H2O2 singly can efficiently develop shoot under
submergence.
94
Fig. 4.6 Effect of vitamin-B complexes supplementation in shoot development
under submergence, b) concentration dependency and synergistic effect of B2 and
H2O2. Apart B complexes, a synthetic cytokinine, BAP was also supplemented
Representative images were taken 9 days after submergence from three replicates
of 100 seeds of YD6 varieties.
4.3.7 Nitric oxide: not involved in shoot development under
submergence
Nitric oxide is one of the signaling molecules, play important role in many
biological processes such as disease resistance, abiotic stress, different growth and
95
development processes, including seed germination and dormancy release (Liu et
al. 2010). NO has been reported as a germination enhancer in many plants.
Moreover, under hypoxic condition significant amount NO produced in plants
than normoxic condition, in addition nitrite can act as electron acceptor under O2
limiting environment. So we used NO donor, SNP either singly or in combination
with H2O2 whether it has any effect on shoot development or can replace
riboflavin instead. But we observed singly SNP did not show any promoting
effect, rather reduced coleoptile growth (Fig. 4.7) but along with H2O2 showed
weak synergistic effect, coleoptile rupture appeared, however no significant
difference in YD6 variety as it can partially initiate shoot development under
submergence under the same experimental conditions (Fig. 4.6a , only H2O2 ).
Fig. 4.7 Effect of SNP either singly or in combination with H2O2 under
submergence. Representative image of three replicates taken after 9 days after
submergence. Each set was replicated thrice with 100 seeds of YD6.
4.3.8 Both exogenous ABA and glucose restrict shoot development
under submergence
Shoot growth is much more susceptible to ABA than that of root (Fig. 4.1) (Sharp
and Davies 1989). Since glucose play important role in ABA signaling during
seed germination, hence we examined the involvement of glucose signaling in
96
shoot development during seed germination by supplementing 3% glucose
together with both riboflavin and H2O2 that efficiently induce shoot develop under
submergence. Interestingly, complete inhibition of shoot development was
observed after glucose supplementation (Fig. 4.8a). Similarly, complete inhibition
of shoot development was also observed in ABA (1µM) (Fig. 4.8a). The
concentration of 1µM ABA is not completely inhibitory of seed germination in
aerobic condition during seed germination.
Since osbzip84 accumulates high ABA than normal seeds, hence we examined
whether it hiders shoot development after submergence in shoot inducing
condition. Interestingly, we observed osbzip84 was unable to restrict shoot
development in presence of both riboflavin and H2O2 (Fig 4.8b) under
submergence, despite the elevated ABA content. However, developed seedlings
were too weak to survive (data not shown), not as strong as normal seeds (Fig
4.8b).
Fig. 4.8 Effect of a) glucose and ABA b) osbzip84 on shoot development under
submergence. Control stands for shoot developing condition (10 mM H2O2+ 200
µM riboflavin) under submergence, Seeds of YD6 variety were used in glucose
and ABA signaling effect, shown in (a) whereas osbzip84 background was
Donjing seed, shown in (b). Representative image was 9 days after submergence.
97
4.3.9
Mitochondrial
complex
IV
inhibition:
restrict
seed
germination under submergence
Sodium azide (NaN3) is a potent inhibitor of mitochondrial complex IV. We
supplemented NaN3 (1mM) in shoot inducing condition (riboflavin and H2O2)
under submergence whether the role of electron transport chain under
submergence. Interestingly, we observed complete inhibition of seed germination
in presence of 1mM NaN3 under submergence. However, the same concentration
of sodium azide (NaN3) in aerobic condition neither inhibit seed germination nor
shoot and root development (Fig. 4.9) although germinating time and seedling
growth were significantly delayed (data not shown). Clearly, it means importance
of mitochondrial complex IV or electron transport system even after submergence
for germination as well as shoot development .
Figure 4.9 Effect of mitochondrial complex IV inhibition on shoot development
under submergence. A concentration of 1mM NaN3 was supplemented in aerobic
germination whereas riboflavin and H2O2 was also supplemented under
submergence. Representative image was taken 9 days after imbibition or
submergence from 100 seeds of YD6 varieties of three biological replicates.
98
4.3.10 H2O2 affects carbohydrate metabolism under submergence
As the sole source of energy of seed germination comes from stored material,
mainly carbohydrate in rice seed, hence H2O2 and riboflavin might affect
carbohydrate metabolism. So we analyzed the expression of several genes of αamylases in either coleoptile (or shoot) or caryopsis samples in Rayada variety,
Kaladigha. After comparing gene expression, it clearly represented that H2O2
treatment in Rayada varieties mimicked the almost aerobic pattern of gene
expression of Ramy1A and Ramy3D (Fig. 4.10). Ramy1A severely downregulated whereas Ramy3D up-regulated under submergence. But in H2O2
treatment, the only slight down expression was observed in Rmay1A whereas
Ramy3D unchanged. However, when we compared same gene expression in
samples excluding coleoptile or shoot, i.e. caryopsis only , then we observed
significant up-regulation of Ramy3E after H2O2 although similar result of up
expression was never been reported after submergence in rice.
Fig. 4.10 Gene expression patterns of selected amylases in either coleoptile or
caryopsis after submergence of Rayada. Dehulled seeds of Rayada (Kaladigha)
were germinated under submerged condition (according to experimental design).
RNA was isolated from either coleoptile or caryopsis samples 5 days after
submergence. DNase treated RNA from respective samples were used for cDNA
synthesis. Transcript levels were quantified by qRT-PCR, and compared with
those of air germinated seeds as described in Materials and Methods. Values were
means with ±SD (n=3).
99
4.4 Discussion
Submergence tolerance during seed germination is one of the rare traits in rice,
even among cereals. As regulator of submergence tolerance during seed
germination is still unknown, hence we attempted with an alternative strategy to
identify both positive and negative regulator(s). In this study, we for the first time,
identified and developed a condition for efficient development of shoot, inducting
the feature of Rayada rice. After successive experiments, we also identified
several regulators of shoot development under submergence.
4.4.1 Rayada rice: is elixir of stress tolerances?
Rayada is one of the special ecotypes with multiple stress tolerance capacity such
as flood, submergence and cold. We observed Rayada variety, Kaladigha showed
equal survival rate after 2 weeks of complete submergence comparing flash flood
tolerant Sub1A rice variety , BRRI 52 (Fig. 2.5c,d) (data shown in chapter 2) .
This unique feature of dual submergence (both partial and complete) tolerances
made the variety special although the mechanism of complete submergence
tolerance of Rayadas is still tentative. It is more likely that Sub1A type
submergence tolerance mechanism also regulates complete submergence in
Rayada rice too because of the presence of two Sub1A like alleles (OrSub1A-1,
OrSub1A-2) in wild rice O. rufipogon (Li et al.2011). Rayadas are most primitive
among deepwater rices and it still shares some feature of wild rice of O. rufipogon
(Khush 1997). We also observed high oxidative stress tolerance in Rayada
varieties (Fig. 4.2), mild salinity stress tolerance (Fig. 4.1, middle) and
germination ability even after high concentration of ABA (Fig. 4.1, right). All
these features lead us to be curious to check submergence tolerance during seed
germination. But, our hypothesis were partially turned down after the screening.
However, we observed successful shoot development in two Rayada varieties
(Fig. 4.5) after oxidative stress imposed by 10 mM H2O2 in 17 cm submergence
whereas similar condition did not induce shoot development in any other type rice
varieties. Rayada varieties either might be more oxidative stress tolerant or use
H2O2 as pronounced signaling molecules for growth and development
100
(pronounced oxidative signaling). Several features of deepwater rice or Rayadas
such as lysigenous aerenchyma (Steffens et al. 2011), adventitious root formation
(Steffens and Sauter 2009) are regulated by ROS signaling along with cell wall
loosening for elongation after flooding, so it is more likely H2O2/ROS trigger
shoot development under submergence.
4.4.2 Riboflavin richness of red rice
Since coatless Rayada seeds are completely unable to develop shoot (Fig. 4.5a)
after imposing oxidative stress during submergence but intact seed develop shoot
in similar condition (Fig. 4.4). It clearly argues of presence of some components
in seed coat that induce or essential for shoot development. After extensive data
mining of seed coat materials, especially in red rice varieties, we found richness
of vitamin-B complexes especially in red and wild rices; other vitamins are
relatively poor. Among the B complexes , thiamine (B1), riboflavin (B2), niacin
(B3), pantothenic acid (B5), and vitamin B6 are present in substantial amounts
(Chen et al. 2012). After supplementing all of them separately (Fig. 4.6), we
observed only riboflavin successfully induced shoot under submergence along
with oxidative stress in all varieties that were completely unable to develop unless
riboflavin supplement. Although we did not quantified the riboflavin content in
Rayada and other modern varieties due to inadequacy of seeds of Rayada
varieties, but, previous reports clearly mentioned significant richness of riboflavin
in red rice than white grained modern varieties (Villareal and Juliano 1989)
(http://ndb.nal.usda.gov/). We speculate all the tolerant varieties (Khao Hlan On,
Khaiyan, Kalonchi, Nanhi and Cody) might have elevated riboflavin and ROS
signaling along with red or black kernel color. At least two of them (Khao Hlan
On and Khaiyan) probably possess red or black kernel or seed coat as seen in Fig
1.8b. However, we tried to collect such information from IRRI but failed to get
their response.
101
4.4.3 Riboflavin: a signaling compound
Riboflavin (vitamin B2) plays important role in plant normal growth and
development as well as defense responses as flavin mononucleotide (FMN) and
flavin adenine dinucleotide (FAD) are part of numerous flavoproteins. Riboflavin
was reported as both biotic and abiotic signaling molecules activating stress
tolerance (Dong and Beer 2000; Taheri and Tarighi 2010; Deng and Jin 2013).
Systemic resistance against Peronospora parasitica and Pseudomonas syringae
pv. tomato was observed in Arabidopsis after exogenous application of riboflavin
(Dong and Beer 2000). Similarly, tomato plants showed systemic resistance to
tobacco mosaic virus (TMV) and Alternaria alternate (Dong and Beer 2000) after
riboflavin . Likewise, riboflavin acted as a defense activator in rice against
economically important sheath blight diseased caused by Rhizoctonia solani
(Taheri and Tarighi 2010). In a very recent report, Deng and Jin (2013) showed
delayed leaf senescence and extended survival time conferring increased
waterlogging tolerance after exogenous application of riboflavin in tobacco. Wild
or purple/red rice is rich in riboflavin and most of the riboflavin resides in the
seed coat (Villareal and Juliano 1989). So from all these previous reports along
with our results clearly represent riboflavin as important signaling molecule.
4.4.4 How might riboflavin induce shoot development under
submergence?
We identified riboflavin as an inducer of shoot development in diverse type of
varieties from indica to japonica under submergence in presence of 10mM H2O2.
The major limitation under submergence is poor energy efficiency being limited
O2 under submergence (hypoxia) or even absent (anoxia). Moreover, it is already
evident that riboflavin promotes assembly and activity of mitochondrial complex
IV (Grad and Lemire 2006). As oxygen binds to mitochondrial complex IV or
cytochrome c oxidase, hence we checked whether respiratory inhibitor of
mitochondrial complex IV (sodium azide) can inhibit the process of shoot
development under submergence (Fig. 4.9). In aerobic condition, sodium azide
delayed seed germination and seedling establishment but seeds successfully
102
developed shoot and root (Fig. 4.9) whereas completely restricted seed
germination under submergence. However, apart mitochondrial complex IV,
sodium azide can also inhibit mitochondrial ATPase, superoxide dismutase and
DNA synthesis (Wood et al. 2012). Whatever, since H2O2 supplementation
induced shoot development under submergence in Rayadas (Fig. 4.4), mimicked
aerobic gene expression pattern of α-amylases (Fig. 4.10) whereas mitochondrial
complex IV inhibition completely restricted seed germination (Fig. 4..9) , so it
reasonably argue the importance of enhanced respiration for shoot development.
In some way, H2O2 (in Rayadas) with riboflavin (in all other varieties) plausibly
enhanced respiration.
Lumichrome and lumiflavin are two derivative of the riboflavin formed under
light. Moreover, Pseudomonas can also degrade riboflavin into lumichrome
(Yanagita and Foster 1956). Lumichorome is already being reported as growth
promoting compound produced by soil bacteria Sinorhizobium meliloti.
Lumichrome enhanced 21% root respiration and increased net carbon assimilation
in alfalfa (Volpin and Phillips 1998; Phillips et al. 1999). Similarly, lumichrome
also enhanced root biomass in both Lotus japonicus and tomato. Apart legumes,
lumichrome also stimulated seedling development in other cereals (Matiru and
Dakora 2005; Gouws and Kossmann 2009). Surprisingly, exogenous application
of lumichrome in both root (3 nM) and seed (5 nM) in alfalfa showed significant
growth enhancement but it’s only in the shoot (Volpin and Phillips 1998; Phillips
et al. 1999). So shoot development or enhancement feature of riboflavin or
riboflavin derivative (lumichrome) is not only evident in rice but also in alfalfa.
4.4.5 Hidden player masked riboflavin
Among cereals, rice has the least riboflavin content (weight basis) than others.
The riboflavin content per 100g seeds of rice, wheat, maize, millet, sorghum, rye
and oats was reported as 0.04, 0.10, 0.10, 0.33, 0.13, 0.25 and 0.14 mg,
respectively (Juliano 1993). Then the question arises why not they develop shoot
under submergence, if riboflavin induce shoot development. We also examined
effect of riboflavin in other cereals (maize , wheat) but none of them developed
103
shoot under submergence (actually failed to germinate) even after riboflavin and
H2O2 supplementation (data not shown) suggesting some hidden player(s) that
might be triggered by riboflavin or riboflavin derivative lumichrome might be
missing in these cereals whereas present in rice and alfalfa at least . Sub1A gene
mainly responsible for submergence tolerance, similarly, mainly limited to some
aus type varieties, none other type rice even other cereals lack such genes, hence
submergence tolerance only limited to rice among cereals.
4.4.6 Involvement of ABA and glucose signaling
ABA is considered as the stress hormone. Myriad of reports are available on ABA
interacting functions in plants, mostly in water stress and seed dormancy
(Nakashima and Yamaguchi-Shinozaki 2013). However, role of ABA in
submerged seed germination is not evident. Generally ABA suppresses seed
germination, subsequent seedling development. Shoot growth is more susceptible
to ABA than root growth (Fig. 4.1) as previously reported (Sharp and Davies
1989). However, based on in silo analysis Mohanty et al. (2012) speculated ABA
as a positive regulator of rice seed germination under submergence (Miro and
Ismail 2013). Here we identified ABA as one of the regulators that inhibited shoot
development both in aerobic (Fig. 4.1) and submerged condition (Fig. 4.8a), so
undoubtedly ABA is the negative regulator of shoot development. Our results
completely ruled out the speculation of Mohanty et al. (2012).
We observed ABA content reduction after H2O2 treated seed in Rayada rice (Fig.
4.3c). Moreover, we also observed shoot development inhibition after exogenous
glucose addition (Fig. 4.8a) suggesting involvement of glucose signaling in this
process. Zhu et al. (2009) identified glucose induced delayed seed germination in
rice due to suppression of ABA catabolism. However, one of the upstream
regulatory mutant of ABA catabolism, osbzip84, (we identified using Rayada rice,
described in Chapter 3) did not suppress shoot development at all. Glucose
induced suppression of ABA8oxs was observed in OsABA8ox2 and OsABA8ox3,
not in OsABA8ox1 (Zhu et al. 2009) and hence osbzip84 might be unable to
restrict shoot development because osbzip84 acts as an upstream regulator of
104
OsABA8ox1. However, in osbzip84 developed shoot under submergence were too
weak to establish seedling and eventually died.
Crossing between tolerant line Khao Hlan On, with intolerant, IR64 and
subsequent QTL analysis identified five QTLs defining 18-34% phenotypic
variation in chromosomes 1, 3, 7, 9 (two QTL) (Angaji et al. 2010; Ismail et al.
2012). Similarly, another QTL study using population resulted from cross
between Ma-Zhan Red (tolerant landrace) with intolerant IR42 identified six
significant QTLs on chromosomes 2, 5, 6, and 7 (Septiningsih et al. 2013). These
two QTL analysis share only limited region; so still a long way to run to identify
the genetic basis of submergence tolerance.
In summary, we successfully developed a condition supplemented with riboflavin
and H2O2 where intolerant genotypes successfully developed shoot under
submergence. However, induced shoot development was completely inhibited by
glucose, ABA and mitochondrial complex IV inhibitor signifying ABA and
glucose as negative regulators, whereas ROS, riboflavin and mitochondrial
complex IV as positive regulators. Further research using our developed
conditions, along with results may open up a new window to identify more
regulators of submergence tolerance and enrich of our understanding of
submergence tolerance mechanisms.
105
106
Chapter 5 A novel natural mutant of Rayada rice,
plausibly in OsbHLH13, shows multiple phenotypes with
potential use in hybrid seed technology
5.1 Introduction
Extensive breeding efforts along with high-input agricultural practices doubled
the rice productivity since first green revolution in 1960s. The second jump in rice
productivity
was
observed
after
the
development
and
successful
commercialization of hybrid rice technology since it offers 15-20% yield
advantage over best traditional varieties (Li and Zhang 2013). However, to meet
up the demand of the increasing world population, global rice production needs to
be again doubled by 2030 (Li and Zhang 2013). Development of super inbred and
hybrid rice along with manipulation of inter-subspecific heterosis could offer the
third leap (Li and Zhang 2013) although some constrains such as many unfilled
grains, poor grain-filling, slow grain-filling rate etc. need to overcome first (Yang
and Zhang 2010).
5.1.1 Stigma exsertion
As rice is self-pollinated crop, hence the commercial production of hybrid seed
depends on forced cross pollination through male sterile female plants to pollen
donor male plants. However, asynchronous and differential timing of flowering
hinder many spiklets to cross pollination (Yan et al. 2009). The feature of stigma
exsertion in female lines, however, offers extended opportunity of cross
pollination (Kato and Namai 1987; Yan et al. 2009). Most of the wild rice
accessions of O. rufipogon possess high frequency of exserted stigma (Uga et al.
2003). Increasing frequency of stigma exsertion in female lines resulted increased
hybrid seed setting and production (Zetian and Yanrong 2009). So the trait of
stigma exsertion has received consistent attention from rice researchers as a
desired feature, essential for hybrid seed production (Yan et al. 2009). However,
the genetic basis of the trait is largely unknown. Most of the research identified
107
QTL markers, resides in all along 12 chromosomes of rice (Yamamoto et al.
2003; Uga et al. 2003, 2010; Miyata et al. 2007; Yan et al. 2009).
5.1.2 Morphological markers
Morphological traits such as leaf, sheath, kernel color, awn length etc. are visible
morphological markers are still being used by breeders for linkage map
construction and convenient selection along with molecular markers (Yue et al.
2006). Since purity of hybrid seed possesses a great importance , so introgression
of simple morphological markers into male sterile or restorer lines are very useful
in identifying seed purity and have also shown great potential (Shen et al. 2004;
Yue et al. 2006). Anthocyanins are pigments that are responsible for blue to red
coloration of plants. Genetic basis of such coloration has been characterized in
many plants including corn, petunia, and arabidopsis.
5.1.3 Trichome development
Trichomes are hair like specialized structure developed from epidermal cells of
leaf. Apart biological significances, trichomes are considered as an excellent
model system for studying different aspect of cell differentiation (An et al. 2011).
Trichomes have been reported with functions in both biotic and abiotic stress
tolerances although protection against damage from herbivores most noticeable
(Dalin et al. 2008). It can increase drought tolerance by reducing solar radiation
and modulating moisture onto the leaf surface. Moreover, protection from UV
radiation and cold temperature by profuse trichomes was also reported earlier
(Dalin et al. 2008).
108
5.1.4 Anthocyanin and trichome development: interrelated
processes
Both anthocyanin pigmentation and trichome development have been extensively
studied in Arabidopsis. Genetically, anthocyanin biosynthesis and trichome
development are intimately connected. Recent studies have identified a ternary
activator complex (MYB-bHLH-WDR) comprising of R2R3 family MYB
transcription factor (TF), a basic helix-loop-helix (bHLH) TF and a WD40 protein
, regulate the spatio-temporal expression of structural genes involved in
anthocyanin biosynthesis and trichome development (Patra et al. 2013). In
Arabidopsis, GLABROUS 1(GL1- an R2R3-MYB TF), GLABROUS 3 (GL3)
and ENHANCER OF GLABROUS 3 (EGL3) (both are bHLH transcription
factors) together with TRANSPARENT TESTA GLABRA 1 (TTG1, a WD40
protein) regulate the structural genes of anthocyanin biosynthesis and trichome
development (Patra et al. 2013).
We identified a novel natural mutant in Rayada variety, Kaladigha background
having phenotypes of purple pigmentation throughout the plants and profuse
trichomes in the leaves. Moreover, mutant plants showed high frequency of
stigma exsertion. But the most important feature of the natural purple mutant was
complete sterility. We first characterized the phenotypes and then attempted to
identify the physiological basis of sterility and successfully recovered partially
fertility. Based on phenotypic characterization, data mining, previous reports and
expression analysis, we selected OsbHLH13 as the plausible candidate gene for
these phenotypes.
109
5.2 Materials and methods
5.2.1 Plant materials and growth condition
Seeds were germinated on moist filter papers in dark at 28°C. The natural purple
mutant was identified after germination through distinct purple coleoptile and first
leaf. Seedling of mutant along with control plants were raised on Kimura B
nutrient solution (pH 5.6) in phytotron at 28°C, 60% relative humidity with
16/8hrs day-night cycle. Nutrient solution was renewed twice a week. After three
weeks, seedlings of both mutant and control plants were transferred to the same
soil pot and grown in greenhouse with 14/10 hrs day-night cycle.
5.2.2 Determination of total anthocyanin content
Total
anthocyanin
content
was
determined
using
quick
and
simple
spectrophotometric pH differential method (Rapisarda et al. 2000; Yuan et al.
2009). 100 mg of homogenized samples (young and mature leaf, leaf sheath and
internodes) were extracted in 2 ml of pH 1.0 buffer containing 50 mM KCl and
150 mM HCl. Another set of similar samples were extracted in pH 4.5 buffer
containing 400 mM sodium acetate and 240 mM HCl. Then the extracts were
centrifuged at 12,000g for 15 min at 4oC. Absorbance of collected supernatants
was measured at 510 nm. Total anthocyanin content was calculated using the
following formula:
Total anthocyanin content (mg g-1FW) = (Absorbance of pH 1.0 extractsabsorbance of pH 4.05 extracts) X 484.8/24 825 X dilution factor
Where, 484.8 and 24,825 were the molecular mass of cyanidin-3-glucoside
chloride and its molar absorptivity at 510 nm, respectively (Yuan et al. 2009).
Triplicate samples were analyzed for each type of samples.
110
5.2.3 RNA extraction and real-time PCR analysis
Total RNA was isolated from different sample (young leaves, leaf sheath and light
exposed internode) using the Agilent Plant RNA isolation Mini Kit and then
digested with RNase-free DNase I to eliminate genomic DNA contamination.
First-strand cDNA was synthesized with oligo (dT) primers using a Promega
cDNA kit accordingly. Transcript levels of each gene were measured by qRTPCR using Mx3000p QPCR System with iQ SYBR Green Supermix. PCR
amplification was performed using three-step cycling conditions of 95°C for 10 s,
followed by 40 cycles of 95°C for 10 s, 56°C for 30 s, and 72°C for 30 s. Actin1
was used as the internal standard. Primer sequences were listed below:
OsbHLH13 F -5’ACTGTTGGCGTACAGCTGCAAA3’
OsbHLH13 R-5’CGCAACCAGAGTGTCGTGCGT3’
Actin1 F -5’ AGAGGAGCTGTTATCGCCGTCCTC3’ and
Actin1 R -5’GCCGGTTGAAAACTTTGTCCACGC3’
5.2.4 Estimation of trichome density and distribution
Trichome density and distribution were examined under stereomicroscope with
ocular grid and micrometer. Fully open mature leaves (usually 4rd leaf) were used
for trichome distribution and density measurement. Trichomes were counted on
both abaxial and adaxial surfaces and trichome density was measured on 10 leaves
for both surfaces (three observations per leaf).
5.2.5 Determination of stigma exsertion
Since stigma color of purple mutant plants was completely purple, hence it was
easy to determine stigma exsertion percentage in purple mutant. A total 10
panicles of purple mutants were observed using magnifying glass to determine the
percentage of stigma exsertion. However, exserted stigmas of control plants were
observed under stereomicroscope as their stigmas were hyaline, difficult to
111
differentiate under light from lemma or palea color. The frequency of the double
or single exserted stigma was calculated as the percentage (%) of exserted stigmas
(either double or single) to the total spiklets of 10 panicles.
5.2.6 Pollen viability assay
Pollen viability was measured using Alexander staining method (Alexander
1969). Stamen collected after anthesis and placed on slide. A few drops of
Alexander stain buffer were used. Alexander stain buffer was made up with 95%
ethanol- 10 ml; Malachite green (1% in 95% ethanol)-1 ml; Fuchsin acid (1% in
water)-5 ml; Orange G (1% in water)-0.5 ml; phenol- 5 g; chloral hydrate-5 g;
glacial acetic acid- 2 ml; glycerol- 25 ml and distilled water- 50 ml. Stained pollen
grain was observed under stereomicroscope. Viable pollen stained red to redpurple whereas aborted pollen grain was green (Schoft et al. 2011).
5.2.7 Determination of stigma receptivity
Stigma receptivity was determined by simple hydrogen peroxide (H2O2) method
(Dafni and Maués 1998). A 6 % of hydrogen peroxide was placed on the stigma
and observed production of bubbles from stigmas under stereomicroscope. Bubble
production was compare under microscope where less bubble generation
represented reduced stigma receptivity.
5.2.8 Humidification of panicles
Since mutant plants were completely sterile, then we tried to recover fertility
using different approaches, including humidification of panicles. Panicles
including flag leaves were enclosed with transparent polybag. To ensure gas
exchange, several tiny holes were made at the bottom of polybag. Humidity was
measured using handheld hygrometer.
112
5.2.9 ROS staining and confocal laser scanning microscopy
Total
ROS
staining
was
determined
using
fluorescent
dye
2',7'-
dichlorodihydrofluorescein diacetate (H2DCF-DA) (Invitrogen). Freshly dissected
stigmas were washed gently with Hanks’ balanced salt solution (HBSS) buffer
and stained with H2DCF-DA at 37 °C in the dark for 30 min, then washed briefly
with the same buffer and observed under Olympus Fluoview FV1000 confocal
laser scanning microscope with the following settings: excitation=488 nm,
emission=535 nm, frame 1024×1024. To compare ROS staining between mutant
and control stigmas, identical exposure conditions were used for all samples.
Representative images of 10 stigmas were used for comparison.
113
5.3 Results
5.3.1 Phenotypic characterization of natural purple mutant
Phenotypically a very distinct plant with multiple interesting phenotypes was
isolated from Rayada variety, Kaladigha plants. Due to sharp and consistent
difference with normal plants, we paid special attention to the plant considering as
a natural mutant. The mutant plant was grown on same soil pot with control plants
to nullify the environmental interactions on mutant phenotypes. The mutant plants
were found completely sterile later on; hence tillers, nodal buds and branches
were used to amplify the number of plants to characterize their special features.
The four specific phenotypes were characterized in the mutant plants.
5.3.1.1 Purple pigmentation
Rayada rice variety, Kaladigha is typically a green variety with occasional purple
leaf sheath. Interestingly, main differential feature of the mutant plant was
observed in the coloration of the plants. Initially, at seedling stage, mutant plant
showed dense purple colored leaves (Fig. 5.1a), certainly distinct from normal
plants. On maturation of leaves, deep purple color trended to fade. However, in
abaxial side of mature leaves, it showed patches of purple pigmented spots,
especially in regions of mid ribs and veins (Fig. 5.1b). To check the stem color,
leaf sheath of old leaves were removed and observed pale purple color. However,
in few days after exposed to light, stem color turned into dense purple (almost
black) (Fig. 5.1c). Section of internodes also showed sharp difference in
pigmentation throughout the tissues (Fig. 5.1d). The color of the spiklets was also
changed. The color of the lemma and palea turned into light reddish, however,
deep red at the tip (Fig. 5.1e). Inside the spiklets, interestingly, the stigmas of
mutants plants were completely purple whereas in normal plants it was hyaline
(Fig. 5.1f). Remarkably, roots at crown zone that were exposed to air and light
also showed red pigmentation (Fig. 5.1g). In addition, lateral branches of these
roots also showed changed pigmentation (Fig. 5.1h). Section of these roots clearly
represented anthocyanin pigment accumulation only in the side of cortex that was
exposed to light (Fig. 5.1i). Apart these, the leaf sheath (Fig. 5.1j) and ligule (Fig.
114
5.1k) also showed red to purple pigmentation. So the complete change in
pigmentation throughout the plant organs (from root to stigma) was observed in
the mutant plant organs.
Fig. 5.1 Comparative pigmentation of purple mutant with control plants. a) young
leaf, b) purple pigment patch in abaxial surface of leaf, c) internode pigmentation
after light exposure, d) internode section , e) spiklets , f) stigmas , g) roots at
crown zone , h) lateral braches of roots , i) section of roots , j) leaf sheath and k)
ligule of purple mutant. In images with dual panels (a-f), first one represented
control plants feature and the next one that of purple mutant. Representative
images of at least 10 samples were shown here.
115
5.3.1.1.1 Anthocyanin content
Total anthocyanin content was measured using the pH differential method
(Rapisarda et al. 2000). Highly significant difference of anthocyanin content was
observed between samples of control and purple mutant plants (Fig. 5.2). Light
exposed internodes showed highest anthocyanin accumulation. Similarly, young
leaves of seedlings also showed highly elevated anthocyanin content but
significantly reduced in mature leaves, although still significantly higher than
normal plants. Among different types of samples of control plants, only leaf
sheath showed highest total anthocyanin content as Kaladigha variety
occasionally developed purple leaf sheaths (Fig. 5.2). Other control samples such
as young, mature leaves or internodes of normal or control plants showed low
total anthocyanin content, range from 0.012 to 0.03 mg/g fresh weight.
Fig. 5.2 Comparative total anthocyanin content in different parts of both control
and purple mutants. Each type of samples was analyzed in triplicate and
represented data were the mean of three replicates. Bars indicates the standard
deviation whereas star (*) symbol indicates significance level at P< 0.01.
116
5.3.1.2 Profuse and elongated trichomes
Development of profuse and elongated trichomes was observed as another altered
feature in purple mutant plants. Normally Kaladigha variety possesses tiny leaf
trichomes on its adaxial surface (Fig. 5.3a). However, in mutant plants profuse
and elongated trichomes were observed on adaxial surface of leaves (Fig. 5.3b).
Such elongated trichomes even could be seen in naked eyes against light (Fig. 5.3
c). Number of trichomes (per cm2) was significantly increased, mainly in adaxial
surface (Fig. 5.3d). Moreover, in abaxial surface of leaves, elongated trichomes
were also developed, but in lower extent. Length of the trichomes was around 700
µm in purple mutant plants, highly elongated than control plants (Fig. 5.3e, f).
Although number of trichomes in abaxial surface was reduced but length of that
was same as adaxial surface in purple mutant plants (Fig. 5.3e).
117
Fig. 5.3 Trichome density and distribution of control and purple mutant plants a)
control, b) purple mutant leaf, c) naked eye view of control and purple mutant
leaf, d) comparative trichome number, e) length of both adaxial and adaxial
surfaces of both control and mutant plants , f) close up image of adaxial surface of
leaf purple mutant plants . Representative images were from at least 10 different
samples and the symbol (*) indicated the significance level at P<0.001.
118
5.3.1.3 Stigma exsertion
Stigma exsertion was the third distinct phenotypes of the purple mutants (Fig.
5.4a). As the stigma color were changed to purple in mutant plants hence it was
easy to notice even in naked eyes. Moreover, styles of purple pistil became
bended and came out from lemma-palea (Fig. 5.4a-right panels). We observed
almost 65 % of spiklets of mutant plants showed exserted stigmas. Among the
exserted spiklets, double exserted stigmas were prominent in mutant, i.e. nearly
40%. However, the percentage of single exerted stigmas was also increased in
mutant plants but not significantly different from normal plants (Fig. 5.4b).
Fig. 5.4 Stigma exsertion of purple mutant. a) phenotype of exserted stigma, b)
frequency of stigma exsertion between control and purple mutant spiklets. The
symbol (*) indicated the significance level at P<0.001.
119
5.3.1.4 Sterility of purple mutant
The last but most important feature of mutant plants was the complete sterility. A
total of 24 individual plants was developed from a single mutant plant. All of
them flowered after yearlong life cycle. However, none of them produced a single
seed whereas almost 60% of the control plants spiklets produced seeds (Fig. 5.5).
However, complete sterility made us more interested to the mutant plants.
Fig. 5.5 Percentage of seed setting in a) control, b) purple and c) humidified
purple mutant plants. Seed setting was calculated based on 10, 19 and 5 panicles
of control, mutant, humidified purple mutant plants s. Bar represents the standard
deviation.
5.3.2 Stigma receptivity: plausible cause of sterility
As the mutant plants were found completely sterile, hence we attempted to reveal
the possible physiological causes of sterility. To check the probable involvement
of male or pollen based sterility, pollen viability was examined using Alexander
staining (Alexander 1969). Pollen staining pattern clearly demonstrated that
pollen were completely viable with normal shape and size, as control plants (Fig.
5.6b). Then we examined the ovary and observed no change in pigmentation.
Color of ovary along with shape and size was similar to control plants (Fig. 5.6a).
120
Interestingly, after analyzing over 100 spiklets under stereomicroscope, we
observed never a single pollen attached with stigmas of mutant plants (Fig. 5.6c),
whereas plenty of pollens usually were attached with normal stigmas (Fig. 5.6d,
arrows indicated the pollen grains). So we anticipated some problems might be
associated with stigmas as its color were changed in mutants. Then we analyzed
and compared receptivity of stigmas of mutant plants with control plants (Fig. 5.6
e, f). Surprisingly, we observed less receptivity of stigmas in mutant than control
plants through analyzing bubble production after 6% H2O2.
Fig. 5.6 Comparative reproductive features of mutant plants. a) ovary of mutant
plant , b) pollen of purple mutants stained with Alexander stain, c) no pollen
attachment in stigma of mutant plant, d) stigma with attached pollens in normal
plants (arrows indicates the pollen) e) stigma receptivity test of purple mutant
stigma and, f) of normal plants stigma . Representative image were of at least 10
replicates or samples.
5.3.3 Reduced ROS accumulation in mutant stigma
The receptivity of stigma surface to pollen grain is only limited to short period
and the timing for receptivity and pollination is critical for fertility or sterility.
Receptivity of stigma is characterized by high level of peroxidase activity
(McInnis et al. 2006) although the function of the enzymes in stigma is mostly
unknown. Oppositely, antioxidant activity of anthocyanins was excessively
reported. So we checked whether changed pigmentation in stigmas of mutant
121
plants had any involvement of ROS accumulation in stigmas. After ROS staining
with H2DCF-DA, we compared the florescence signal of stigmas of mutants with
that of control plants. It clearly demonstrated the significant reduction of ROS
accumulation in stigmas of mutant plants than that of control plants (Fig. 5.7a).
Similarly, in stigmatic papillae level, severe ROS reduction was observed in
purple mutant (Fig. 5.7b). So both H2O2 bubbling assay (Fig.5.6 e, f) and H2DCFDA staining pattern of stigmas (Fig. 5.7a, b) clearly demonstrated reduced ROS
accumulation in the mutant plants stigmas might be one of the reasons of sterility.
122
Fig. 5.7 ROS accumulation of a) whole stigma and b) stigmatic papillae level in
both control and purple mutant plants. Freshly dissected stigmas were loaded with
H2DCF-DA for 30 min in dark at 37 C and observed under confocal laser
scanning microscope with similar image acquisition settings. Representative
image of at least 10 stigmas were shown here.
123
5.3.4 Partial restoreation of fertility
Since most of the mutant plants flowered in less humid season (late winter),
stigmas of mutant plants were exserted (Fig. 5.4) and showed non-receptivity
(Fig. 5.6e,f and 5.7a,b) , hence we artificially increased humidity of the panicles
by wrapping the panicles with flag leaf by polybag as reduced humidity can
reduce the receptivity of exserted stigmas. After enhanced humidity of 5 panicles
we observed few seed setting occurred in each panicle but of very low percentage
(Fig. 5.8). A total 30 seeds were obtained from these 5 panicle reflected partial
restoration of fertility by increased humidity. Seed setting rate was increased to
over 10% of spiklets after humidification whereas 60% of control spiklets
developed into seed (Fig. 5.5). Although humidification partially restored fertility
but other factors might be involved in the sterility phenomenon of the mutant
plants as only limited percentage of spikelets overcome sterility after enhanced
humidity. Moreover, bagging may also help pollen stick to the exserted stigma
since wind or other physical interference on the pollen attachment is largely
reduced.
Fig. 5.8 Seed setting in purple mutant panicles after humidification. Untreated
purple mutant panicle with complete sterility (upper panel), some seeds were
developed (arrow marked) in humidified panicle bottom panel. Representative
image of 5 humidified panicles with some seed settings were shown here.
124
5.3.5 Phenotype of purple mutant progeny
We checked the progeny of the purple mutant seeds, developed from humidified
panicles. Surprisingly, we observed seeds of the purple mutants were neither red
(as normal) nor purple but it turned into completely black (Fig. 5.9a). Moreover,
mutant plant seeds showed significantly reduced grain weight than control plant
seeds (Fig. 5.9b). We germinated the seeds 7 days after harvest (DAH) and
observed efficient germination but showed segregating nature of purple phenotype
in a ratio of 3:1 although the number of seeds were very few to conclude.
Fig. 5.9 Phenotype of purple mutant progeny. a) color of control and purple seed,
b) seed weight , c) purple progeny.
5.3.6 Candidate gene of these phenotypes
We extensively searched plausible candidate genes based on these four
phenotypes and previous reported genes of similar phenotypes. No specific gene
was reported with function of exserted stigma development. Most of the studies of
exserted stigma are still in QTL level (Yamamoto et al. 2003; Uga et al. 2003,
2010; Miyata et al. 2007; Yan et al. 2009). Oppositely, plenty of genes
dysfunction develops sterility phenotype. As the mutant plants possessed other
two phenotypes (high anthocyanin and profuse and elongated trichome), hence we
125
focused on genes that control both of the feature. Interestingly, recent studies
identified a ternary activator complex comprising members of R2R3-MYB, bHLH
and WD40 proteins regulate both anthocyanin biosynthesis and trichome
development (Patra et al. 2013). So we searched any of these protein members
reported having involvement in sterility along with trichome and anthocyanin
regulation. Fortunately, among numerous possibilities, we found only a single
gene, Lc of maize that was reported earlier with all of these phenotypic features
except exserted stigma, i.e, anthocyanin pigmentation, elongated trichome
formation and sterility (Lloyd et al.1992; Tominaga-Wada et al. 2012; Li et al
2013).
5.3.7 Expression analysis of OsbHLH13
OsbHLH13 is the rice homolog of maize Lc gene. We analyzed the expression of
OsbHLH13 using qRT-PCR between control and purple mutants using different
types of samples. The expression analysis clearly showed exceptionally huge upexpression of OsbHLH13 in mutant plant samples (Fig. 5.10). In young leaves of
developing tillers, the expression was up-regulated almost 150 fold than that of
control plants. Similarly, significant up-expression of OsbHLH13 was observed in
both leaf sheath and internodes samples but a lower extent than young leaves (Fig.
5.10).
126
Fig. 5.10 Relative expression OsbHLH13 in leaf, leaf sheath and internode of both
control and mutant plants. DNase treated RNA from respective samples were used
for cDNA synthesis. Transcript levels were quantified by qRT-PCR, as described
in Materials and Methods. Values are means with ±SD (n=3). The symbol (*)
indicates the significance level at P<0.0001
127
5.4 Discussion
We identified a novel natural mutant of Rayada variety with Kaladigha
background having distinct four phenotypes of the practical implications in hybrid
seed technology. We also identified the receptivity of stigmas as probable reason
of sterility in mutant plants. Based on phenotypic characterization, data mining of
previous reports and expression analysis of putative gene, we selected OsbHLH13
as candidate gene for these mutant phenotypes.
5.4.1 Natural mutation, not seed contamination
The first question raised after the mutant plant identification whether it was a
natural mutant or seed contamination from purple variety since the probability of
natural mutation resulting dominant phenotype is low (Brooks et al. 2008). As the
seeds of the Kaladigha variety were collected from gene bank of Bangladesh Rice
Research Institute (BRRI) and generally gene bank collections are good at purity
and integrity, so the chance of contamination is very low or absent. However, to
ascertain the same varietal origin, the mutant plant was grown with normal
Kaladigha plants (as control) in same soil pot to compare the features of Rayada
variety, Kaladigha. Except four noticed phenotypes, all other features such as
shape and size of young (Fig. 5.1a) and mature leaves (Fig. 5.3a, b), stem (Fig.
5.1c, d), ligule, spiklets (Fig. 5.1e), and overall plant stature were same as control
plants of Kaladigha. We also examined the seed dormancy of the mutant seeds,
developed after enhanced humidity treatment and we observed the freshly
harvested seeds (7 DAH) germinated efficiently same as control plants (Fig. 5.9c).
Rayada varieties specially lack seed dormancy while all deepwater rice varieties
even wild rice (O rufipogon) possessed significantly prolonged seed dormancy.
The others features of Rayadas like yearlong life cycle, strong photosensitivity
were also present in the mutant plants. Moreover, seeds of the mutant plants
showed segregating phenotypes for purple pigmentation. All these features clearly
ruled out the possibility of seed contamination and signified the mutant as Rayada
variety, Kaladigha background. Brooks et al. (2008) identified a natural revert
mutation in RC from 56 tons of foundation seeds of rice.
128
5.4.2 Sterility and reduced ROS accumulation of stigmas: linked
together
Stigma is the one of specific regions of plant reproductive organs that directs the
success of the progeny development as pollen first attach to it, gets initial nutrient
and guidance for pollen germination and tube growth (Li et al. 2007). Cyanidin-3glucoside is the most common anthocyanin in purple pigmentation with high
antioxidant activity, especially superoxide and hydroxyl radical scavenging
activity (Ichikawa et al. 2001). Stigmatic ROS / H2O2 were shown to be involved
stigmatic receptivity, pollen germination and pollen tube growth (McInnis et al.
2006). Similarly, in kiwifruit ROS was found to involve in pollen tube initiation
(Speranza et al. 2012). Moreover, stigmatic ROS/H2O2 is also involved in biotic
resistance of stigma although how stigma differential pollen to pathogen,
especially fungal spore is still unknown.
Angiosperms possess large numbers of class III peroxidases; same in rice i.e. a
total 138 class III peroxidase genes (Passardi et al. 2004). Mature and receptive
stigmas of angiosperms also possess high level of peroxidase activity. McInnis et
al. (2006) identified a stigma specific peroxidase from Senecio squalidus.
Significantly, large amount of ROS, specifically H2O2 was detected in stigma
where stigma papillae specific peroxidases expressed in S. squalidus (McInnis et
al. 2006). However, exact function of these peroxidases is unknown. Although
membrane bound NADPH oxidases are major sources of H2O2 production,
however, some peroxides is also shown in the production of H2O2 (McInnis et al.
2006).
As the purple mutants possessed deep purple stigmas and showed complete
sterility, then we attempted to check whether the changed stigma pigmentation
had any involved in this sterility. We compared the H2O2 production level in the
stigmas both in control and purple mutant by ROS staining using fluorescent dye
H2DCF-DA. The ROS staining pattern clearly represented the severe reduced
ROS accumulation in stigma of purple mutant (Fig. 5.7a,b). Thus the reduced
ROS level in purple mutant stigmas might be due to the high anthocyanin level or
scavenging activity that might limit both receptivity of stigma and germination of
pollen.
129
5.4.3 Humidity and sterility
The impact of temperature and humidity on the sterility of rice was studied earlier
(Weerakoon et al. 2008). Desiccation of stigma, loss of pollen viability and
reduction of pollen germination on stigma might be the reason of increasing
sterility after low relative humidity as observed in rice whereas high humidity
significantly prolonged the stigma receptivity duration (Weerakoon et al. 2008).
Simultaneously, high humidity also reduced the pollen dehiscence capacity from
anther, might be another limiting factor of restoring complete fertility after
humidification of purple mutant. In Arabidopsis, mutation of a family 8
glycosyltransferase gene resulted humidity sensitive sterility that can be partially
rescued by high humidity (Lao et al. 2003) however, this gene was neither
involved in anthocyanin pigmentation nor in trichome development, even in
stigma exsertion
5.4.4 Black colored but reduced grain weight
Humidified panicles developed some seeds with complete changed (dark purple or
black) pigmentation (Fig.5.9a). Moreover, it showed significant reduction of grain
weight (Fig.5.9b). So it came into consideration whether huge anthocyanin
accumulation (since black grain) resulted reduced grain weight. Interestingly, in
nature large fruits with dark or black color are severely scarce (Steyn 2009).
Moreover, in some wild berries, huge anthocyanin accumulates but their fruit size
is relatively small, along with thin fruit skin (Moyer et al. 2002; Steyn 2009).
Moreover, treatments that induce anthocyanin biosynthesis also reduce cell
growth rate in cell culture (Steyn 2009). So in culture system gain of anthocyanin
production is offset by reduction of growth rate (Steyn 2009). Thus it seems the
intense pigmentation in mutant seeds may be linked with reduced grain weight.
130
5.4.5 Selection of OsbHLH13 as candidate gene
We selected OsbHLH13 as plausible candidate gene of the mutant, mostly based
on phenotypic features and intense literature mining of relevant features. Recent
studies identified a ternary activator complex (MYB-bHLH-WD40 complex)
regulates both anthocyanin biosynthesis and trichome development (Patra et al.
2013). Since mutant plant showed both high anthocyanin along with prolonged &
profuse trichomes, hence we assumed that the mutant plants might have mutation
among the members of these regulatory ternary complexes.
Structural features of bHLHs members involved in these regulatory processes
suggest that it (bHLHs) might act as docking proteins among them. Because its Nterminal regions interact with MYB proteins, negatively charged successive 200
amino acid may interact with either pol III or WD40 complex and finally C
terminal HLH region participate in either homo or hetero dimerization (Fig. 1.6)
(Hichri et al. 2011) . Considering these structural features, we then emphasized on
bHLHs.
Among bHLHs of Arabidopsis, maize, petunia and Antirrhinum , only maize Lc
was reported with features of trichomes , root hair and anthocyanin pigmentation
in both leaf and seed coat (Ramsay and Glover 2005). Oppositely, no gene among
MYBs was reported having all three functions all together whereas among
WD40s, TTG1 of arabidopsis (Walker et al. 1999) and PAC1 of maize (Carey et
al. 2004) were reported with all three functions. Interestingly, maize PAC1 can
complement Arabidopsis ttg1 mutants (Carey et al. 2004). However, maize pac1
mutants only show a reduction in anthocyanin pigmentation in specific tissues
(Carey et al.2004). In addition, over-expression of maize Lc in Arabidopsis ttg1
mutant background complements the phenotypes (Ramsay and Glover 2005). So
it indicates mutation in WD40 genes (especially in TTG1 or PAC1 type) is more
unlikely regulating all these phenotypes.
Li et al. (2007) identified 548 genes using both 57 K Affymetrix rice wholegenome array and 10 K rice cDNA microarray in japonica rice variety,
Nipponbare that were either stigma specific or predominantly expressed in
stigmas of rice. Interestingly, they found OsbHLH13 (maize Lc homolog in rice)
131
as one of the highly expressed probes in stigma although stigma of Nipponbare
was hyaline or pale green (Li et al. 2007). Since the mutant plants showed both
purple and exserted stigmas hence OsbHLH13 might be the more likely candidate
gene of these phenotypes.
Moreover, as purple pigmentation was observed throughout the mutant plants
organs, hence we searched genes that can change pigmentation in diverse organs,
not only in leaf or seed coat. In transgenic petunia expressing maize Lc resulted
deep purple foliage after up-regulation of at least 8 biosynthesis genes (Bradley et
al. 1998), whereas when over-expressed in Arabidopsis resulted elevated number
of trichomes along with high level anthocyanins (Lloyd et al. 1992).
In addition, in an a very recent report of Li et al (2013) showed the sterility
regulating feature of Lc in seventeen independent transgenic rice plants
expressing maize Lc gene under control of the CaMV 35S promoter. Surprisingly,
we also observed huge up-expression of OsbHLH13 in purple mutant (Fig. 5.10).
Thus the candidate gene search narrowed to only maize Lc homolog in rice
although mutation in other upstream regulatory genes could be still possible.
In summary, we isolated a novel mutant of Rayada variety with Kaladigha
background having multiple interesting phenotypes and identified the possible
reason of the sterility of the mutant was found being related to the stigma
receptivity. OsbHLH13 was identified as the candidate gene of these phenotypes.
Further studies of genetic characterization either through genetic mapping or
functional cloning of the candidate gene may open up the practical implications of
this mesmerizing mutant.
132
Chapter 6 General Discussion and Conclusion
Natural selection or evolution tends to increase plant adaptability through genetic
diversity, whereas crop domestication and subsequent breeding or directional
selection narrow the genetic diversities of crop plants (Alonso-Blanco et al. 2009);
even promoted gathering of deleterious mutations in their stress response
mechanisms (Tang et al. 2010). Thus natural variation is the assets of crop
improvement program. Generally wild species are rich in genetic diversity.
However, its direct use in breeding program is limited due to different
incompatibilities as well as its inferior yield or quality. Landraces or ecotypes that
are still growing in native preferences do share some feature of wild species. They
could offer more opportunities for breeders as demand for more genetic resources
increases.
In some areas of Bangladesh where typical deepwater rice cannot be cultivated
due to high depth of flooding, Rayadas are the only option to be cultivated (Perez
and Nasiruddin 1974; Catling 1992). However, due to the invasion of high
yielding modern rice varieties, traditional rice varieties tend to disappear rapidly
in their native ecosystems. No improvement program for deepwater rice varieties
exists although it was initiated as early as in 1917 (Zaman 1977). Moreover, even
IRRI has left deepwater rice variety improvement program out of its priority list.
Bangladesh Rice Research Institute first drew the attention of the scientific
community through its first deepwater rice conference in 1974. Then in successive
years, several countries like India, Thailand etc. also expanded and collaborated in
the deepwater rice research including IRRI. However, in 1990s research of
deepwater rice lost its pace although some research groups around the globe have
identified several important molecular insights of deepwater rice such as snorkel
genes (Hattori et al. 2009).
Being poor yield performance and yearlong life cycle, Rayada has always been
neglected. Moreover, longest life cycle might be a reason for such long duration
varietal disappearance (Vergara and Chang 1985). Some of the features of
Rayadas were reported almost 40-50 years ago. Still the same data are used by
others such as Rayada growing area. No update information is available whether
such types of varieties are still being grown in the field or already been eliminated
133
by high yielding varietal invasion. However, after reviewing and analyzing their
physiological specialty, we are convinced with their special features that could be
certainly used as excellent resources for future crop improvement program as well
as basic scientific studies. For instance, we observed its significantly prompt
recovery from water stress (Fig. 2.9). Despite being big stature of Rayada, after
water stress, it possesses excellent and rapid recovery capacity. Moreover, longer
root system of Rayada is being already reported (Fig.2.8a) (Gowda et al. 2012).
Similar patterns of the longer root system are also observed in well-watered
conditions in our study (Fig.2.8b). In addition, prompt stomata response through
leaf rolling that we observed after transferring high humidity growing Rayada to
low humidity condition suggests efficient water sensing mechanism present in
Rayada rice.
Despite complete and partial submergence tolerance mechanism are different (Xu
et al. 2006; Hattori et al. 2009), we observed somehow Rayada variety withstand
two weeks complete submergence with similar recovery performance to Sub1A
rice (Fig. 2.5c, d) along with its natural ability to elongate after partial flooding
(Fig. 2.4d). So the dual submergence tolerance capacity of Rayada rice makes it
not only special but also unique. Similar feature of dual tolerance capacity was
reported some 40 years ago through farmers but still unexplored scientifically
(Perez and Nasiruddin 1974). Initially it was reported that wild rice does not
possess Sub1A type allele but recent studies identified Sub1A like two alleles
(OrSub1A-1, OrSub1A-2) in O. rufipogon (Li et al. 2011). Hence being most
primitive among deepwater rices (Catling 1992), Rayada still shares some features
with wild rice (Khush 1997), thus it is most likely that Rayada rice also possesses
Sub1A type pathway for complete submergence tolerance. It would be fascinating
to identify how do Rayadas sense and activate signaling pathways after such
stress. Moreover, longer root system, faster recovery and quicker stomata
response are considered traits of drought tolerance or adaptation; interestingly, all
of these three features in some extent are present in some varieties of Rayadas
such as Kaladigha. So considering all of these features altogether we expect
Rayada rice will become a new focus of rice germplasm research with the rapid
advances in genome research weaponry.
134
In this study, we for the first time examined Rayadas as natural variation to
identify both physiological and genetical bases of one of their special features, the
lack of dormancy that is different from other deepwater rice type (Table 1). Based
on our results it shows several concerted events starting with less ABA in freshly
harvested seeds (Fig.3.1b) enable to accumulate huge ROS after imbibition (Fig.
3.2) as well as faster ABA catabolism through ABA8ox1 (Fig. 3.9) might enable
Rayada seeds to germinate even after freshly harvest. Similar results of high ROS
accumulation in non-dormant seeds of Arabidopsis was reported earlier (Leymarie
et al. 2012). Since in osbzip84 T-DNA insertion was in promoter region, hence
ABA accumulation in seed was not that much higher. In Arabidopsis triple
mutant, cyp707a1a2a3 showed strong dormancy phenotype with 70 fold higher
ABA whereas osbzip84 showed nearly 2 fold only. Interestingly, it was reported
earlier that the expression of ABA8oxs are up-regulated after water stress
(Kushiro et al. 2004), moreover we also observed the same (Fig. 3.8b) but
osbzip84 showed reduced ABA content both in water stress (Fig. 3.12e), normal
condition (Fig. 3.12d). So reduced ABA content in both water stress and normal
conditions suggest that OsbZIP84 might not only regulate ABA catabolism but
also regulate ABA homeostasis. Certainly, further study is necessary to confirm
the exact role in ABA homeostasis.
ABA is one of the key phytohormones of plants; regulating many of growth and
developmental processes including abiotic stress tolerance, seed maturation,
dormancy acquisition and germination. Enormous research on ABA perception,
signaling, transport and function have been done since the discovery of the
compound in the 1960s although the naming of the compound as abscicis acid is a
misnomer, initially thought as a regulator of abscission, however, not involved
directly in that process, rather an ethylene regulated process (Schwartz and
Zeevaart 2010).
Usually acting in the downstream of ABA signaling, ROS is becoming a key
signaling regulator of diverse types of plants growth and development pathways.
It has become increasingly evident of ROS accumulation and dormancy release.
H2O2 both enhances seed germination (Fig 4.3 a) both in aerobic and submerged
conditions as well as alleviates seed dormancy in many plants. Moreover,
hydrogen cyanide or methyl viologen also alleviate seed dormancy (Oracz et al.
135
2007). Apart dormancy, ROS also plays important function in root hair
development. (Foreman et al. 2003), pollen tube growth (Potocky et al.2007), leaf
expansion (Rodriguez et al. 2002), PCD (Breusegum et al. 2008). In our studies,
we observed ROS is necessarily important to Rayada rice too for their growth and
development. Apart ROS accumulation of freshly harvested seeds, we also
observed ROS accumulation also plays a defining role in fertility (Fig. 5.7) as we
observed in purple mutant with reduced ROS accumulation and sterility.
Similarly, Rayada rice also developed shoot under submergence in the presence of
H2O2 (Fig. 4.5). Previous reports establish the essentiality of PCD of adventitious
root development (Steffens and Sauter 2009) as well as aerenchyma formation
(Steffens et al. 2011). Suppression of shoot development by ABA and glucose
might be mediated by restriction of ROS accumulation. Since coatless Rayada
seeds were completely unable to develop shoot (Fig. 4.5a), whereas intact (coated)
seed germinated with shoot in the presence of H2O2, inferring key regulatory
factor reside in kernel or seed coat. After supplementing different vitamin B
complexes we identified riboflavin as the key shoot development inducing
molecule. A good number of reports are available on biotic resistant signaling by
riboflavin (Dong and Beer 2000; Taheri and Tarighi 2010; Deng and Jin 2013).
Similarly, riboflavin derivative, lumichrome is a natural growth promoting
compound released by soil bacteria Sinorhizobium meliloti. Moreover, exogenous
lumichrome application enhances root respiration as well as shoots growth in
alfalfa. Since the H2O2 and riboflavin supplemented condition develop shoot in
intolerant varieties, so it is the time to identify both positive and negative
regulators of this process. Moreover, if lumichrome supplementation can develop
the same under submergence then the involvement of riboflavin will be
confirmed.
Finally, we isolated an eye-catching mutant with interesting four phenotypes on
Rayada variety, Kaladigha background. After phenotypic characterization, we
identified the biggest hurdle of the mutant is its complete sterility. We tried to
identify possible reason of such sterility. After stigma receptivity test (Fig. 5.6 e,
f) and fluorescent H2DCF-DA staining (Fig. 5.7) we have largely identified the
reason of sterility as non-receptivity of stigmas. Interestingly, humidifying the
panicle partially overcomes sterility. Based on phenotypic characterization and
136
previous reports along with gene expression of OSbHLH13 we have identified the
maize Lc gene as the candidate gene of this mutant. The gene expression of
OsbHLH13 is extremely up-regulated in the purple mutant. Further studies of
genetic characterization may open up the practical implications of this
mesmerizing mutant.
In summary, Rayada is such primitive deepwater rice that can offer many traits
and genetic resources that are badly needed in rice breeding for stress tolerance.
More detailed research is needed to characterize its special features and mine its
useful genes. We think the time is mature to do so with the rapid progress in
genome research.
137
138
References
Achard P, Renou JP, Berthome R, Harberd NP, Genschik P (2008) Plant DELLAs
restrain growth and promote survival of adversity by reducing the levels of
reactive oxygen species. Current Biology 18: 656-660
Aguan K, Sugawara K, Suzuki N, Kusano T (1993) Low-temperature dependent
expression of a rice gene encoding a protein with a leucine zipper motif.
Molecular and General Genetics 240: 1-8
Ahmed AU , Mirza MMQ (2000) Review of causes and Dimensions of Floods
with Particular Reference to Flood ’98: National Perspectives. In: Ahmed
QK, Chowdhury AKA, Imam SH, Sarker M (eds) Perspectives on Flood
1998, University Press Limited, Dhaka
Ahmed MS (1974) Ecology, distribution and production of deep-water rice. In:
Proceedings of the International Seminar on Deepwater Rice, August 21-26,
1974. No. 15. Bangladesh Rice Research Institute, 1975, pp 1-9
Albert NW, Lewis DH, Zhang H, Irving LJ, Jameson PE, Davies KM (2009)
Light-induced vegetative anthocyanin pigmentation in Petunia. Journal of
experimental botany 60: 2191-2202
Alexander MP (1969) Differential staining of aborted and non-aborted pollen.
Stain Technol 44:117-122
Alonso-Blanco C, Aarts MGM, Bentsink L, Keurentjes JJB, Reymond M,
Vreugdenhil D, Koornneef M (2009) What has natural variation taught us
about plant development, physiology, and adaptation? Plant cell 21:18771896
Amoutzias GD, Veron AS , Weiner J , Robinson-Rechavi M , Bornberg-Bauer E ,
Oliver SG , Robertson, DL(2007) One billion years of bZIP transcription
factor evolution: conservation and change in dimerization and DNA-binding
site specificity. Molecular biology and evolution 24:27-835.
An L, Zhou Z, Yan A, Gan Y (2011) Progress on trichome development regulated
by phytohormone signaling. Plant signaling & behavior 6: 1959-1962
139
Andaya V, Mackill DJ (2003) QTLs conferring cold tolerance at the booting stage
of rice using recombinant inbred lines from a japonica × indica cross.
Theoretical and applied genetics 106:1084-1090
Angaji SA, Septiningsih EM, Mackill DJ, Ismail AM (2010) QTLs associated
with tolerance of flooding during germination in rice (Oryza sativa L.).
Euphytica 172:159-168
Ashraf M (2010) Inducing drought tolerance in plants: Recent advances.
Biotechnology advances 28: 169-183.
Bailey-Serres J, Fukao T, Ronald P, Ismail AM, Heuer S, Mackill D (2010)
Submergence tolerant rice: SUB1’s journey from landrace to modern cultivar.
Rice 3: 138-147
BalasubramanianV, Hill JE (2002) Direct seeding of rice in Asia: emerging issues
and strategic research needs for the 21st century. In: Pandey S, Mortimer M,
Wade L, Tuong TP, Lopez K, Hardy B, eds. Direct seeding: research
strategies and opportunities, Philippines: International Rice Research
Institute, Los Baños
Bashar KM, Haque MM, Zaman HMS (2004) Rice biodiversity and genetic
wealth of flood-prone environment of Bangladesh. In: Bhuiyan SI, Abedin
MZ, Singh VP, Hardy B, (eds) Rice research and development in the floodprone ecosystem. Proceedings of the international workshop on flood-prone
rice systems held in Gazipur, Bangladesh,9-11 January 2001, International
Rice Research, Los Baños
Beachell (1974) Characteristics for consideration in deepwater breeding
programme. In: Proceedings of the International Seminar on Deepwater Rice,
August 21-26, 1974. No. 15. Bangladesh Rice Research Institute, 1975, pp
92-97
Benschop J, Jackson M (2005) Contrasting interactions between ethylene and
abscisic acid in Rumex species differing in submergence tolerance. The plant
journal 44: 756-68
140
Bentsink L, Jowett J, Hanhart CJ, Koornneef M (2006) Cloning of DOG1, a
quantitative trait locus controlling seed dormancy in Arabidopsis.
Proceedings of the national academy of sciences, 103: 17042-17047
Bewley JD, Bradford K, Hilhorst HW (2013) Seeds: physiology of development,
germination and dormancy. Springer
Bhuiyan SI, Abedin M.Z, Singh VP,Hardy B (2004) Rice Research and
Development in the Flood-Prone Ecosystem. IRRI
Blum A (2011) Drought resistance -is it really a complex trait? Functional plant
biology 38: 753-757
Bouman BAM, Humphreys E, Tuong TP, Barker R (2007) Rice and water.
Advances in agronomy 92:187-237
Bovy A, de Vos R, Kemper M, et al. (2002) High-flavonol tomatoes resulting
from the heterologous expression of the maize transcription factor genes LC
and C1. The plant cell 14:2509-2526
Bradley JM, Davies KM, Deroles SC, Bloor SJ, Lewis DH (1998) The maize Lc
regulatory gene up-regulates the flavonoid biosynthetic pathway of Petunia.
The plant journal 13:381-392
Breusegum FV, Bailey-Serres J, Mittler R (2008) Unraveling the tapestry of
networks involving reactive oxygen species in plants. Plant physiology
147:978-984
Brooks SA, Yan W, Jackson AK, Deren CW (2008) A natural mutation in rc
reverts white-rice-pericarp to red and results in a new, dominant, wild-type
allele: Rc-g. Theoretical and applied genetics 117: 575-580
Cai HW, Morishima H (2000) Diversity of rice varieties and cropping system in
Bangladesh deepwater areas. Japan agricultural research quarterly 34:225-231
Caliskan M, Cuming AC (1998) Spatial specificity of H2O2 -generating oxalate
oxidase gene expression during wheat embryo germination. Plant journal 15:
165-171
141
Carey CC, Strahle JT, Selinger DA, Chandler VL (2004) Mutations in the pale
aleurone color1 regulatory gene of the Zea mays anthocyanin pathway have
distinct phenotypes relative to the functionally similar TRANSPARENT
TESTA GLABRA1 gene in Arabidopsis thaliana. Plant cell 16:450-464
Catling HD (1992) Rice in Deepwater. MacMillan Press, London.
Catling HD, Puckridge DW, Hille Ris Lambers D (1988) The environment of
Asian deepwater rice. In: Proceedings of the 1987 International Deepwater
Rice Workshop. Manila, International Rice Research Institute, Manila
Chang TT, Bardenas EA (1965) The morphology and varietal characteristics of
the rice plant. IRRI Tech Bull 4, p 40
Chen H, Chen W, Zhou J, He H, Chen L, Chen H, Deng XW (2012) Basic leucine
zipper transcription factor OsbZIP16 positively regulates drought resistance
in rice. Plant science 193:8-17
Chen W, Provart NJ, Glazebrook J, Katagiri F, Chang HS, Eulgern T, Mauch F,
Luan S, Zou G, Whitham SA, et al (2002) Expression profilematrix of
Arabidopsis transcription factor genes suggests their putative functions in
response to environmental stresses. Plant cell 14:559-574
Chen Y, Wang M, Ouwerkerk PB (2012) Molecular and environmental factors
determining grain quality in rice. Food and energy security 1:111-132
Chinnusamy V, Schumaker K, Zhu JK (2004) Molecular genetic perspectives on
cross-talk and specificity in abiotic stress signalling in plants. Journal of
experimental botany 55: 225-36
Chinnusamy V, Zhu JK (2009) Epigenetic regulation of stress responses in plants.
Current opinion in plant biology 12:133-139
Chono M, Honda I, Shinoda S, Kushiro T, Kamiya Y, Nambara E, Kawakami N,
Kaneko S, Watanabe Y (2006) Field studies on the regulation of abscisic acid
content and germinability during grain development of barley: molecular and
chemical analysis of pre-harvest sprouting. Journal of experimental botany
57: 2421-2434
142
Clark LG, Zhang W, Wendel JF (1995) A phylogeny of the grass family
(Poaceae) based on ndhF gene sequence data. Systematic botany 20:436-460
Dafni A , Maués MM (1998) A rapid and simple procedure to determine stigma
receptivity. Sexual Plant Reproduction 11:177-180
Dai S, Petruccelli S, Ordiz MI, Zhang Z, Chen S, Beachy RN (2003) Functional
analysis of RF2a, a rice transcription factor. Journal of biological chemistry
278: 36396-36402
Dai S, Zhang Z, Chen S, Beachy RN (2004) RF2b, a rice bZIP transcription
activator, interacts with RF2a and is involved in symptom development of
rice tungro disease. Proceedings of the national academy of sciences of USA
101: 687-692
Dalin P, Ågren J, Björkman C, Huttunen P, Kärkkäinen K (2008) Leaf trichome
formation and plant resistance to herbivory. In Induced plant resistance to
herbivory. Springer Netherlands pp. 89-105
Dasgupta S, Huq M, Khan ZH, Masud MS, Ahmed MMZ, Mukherjee N, Pandey
K (2011) Climate Proofing Infrastructure in Bangladesh: The Incremental
Cost of Limiting Future Flood Damage. The journal of environment &
development 20:167-190
Datta SD, Malabuyoc JA, Aragon EL (1982) Evaluation of rices for drought
tolerance for deepwater areas. In: International Deepwater Rice Workshop,
Bangkok (Thailand), 2-6 Nov 1981, International Rice Research, Los Baños
Deng B, Jin X (2013) Riboflavin spraying impairs the antioxidant defense system
but induces waterlogging tolerance in tobacco. Acta Physiologiae Plantarum
35:2769-2776
Doebley J, Lukens L (1998) Transcriptional regulators and the evolution of plant
form. Plant cell 10: 1075-1082
Doebley JF, Gaut BS, Smith BD (2006) The molecular genetics of crop
domestication. Cell 127: 1309-1301
143
Dong H, Beer SV (2000) Riboflavin induces disease resistance in plants by
activating a novel signal transduction pathway. Phytopathology 90:801-811
El-Maarouf-Bouteau H , Bailly C (2008) Oxidative signaling in seed germination
and dormancy. Plant signaling & behavior 3: 175-182
Finch-Savage WE, Leubner-Metzger G (2006) Seed dormancy and the control of
germination. New phytologist 171: 501-523
Finkelstein R, Reeves W, Ariizumi T, Steber C (2008) Molecular aspects of seed
dormancy. Annual review plant biology 59: 387-415
Foreman J , Demidchik V , Bothwell, JH , Mylona, P , Miedema H , Torres MA ,
Linstead, P , Costa S , Brownlee C , Jones JD , Davies, JM , and Dolan L
(2003) . Reactive oxygen species produced by NADPH oxidase regulate Plant
cell growth . Nature 422:442 - 446
Foyer CH, Noctor G (2005) Oxidant and antioxidant signalling in plants: a reevaluation of the concept of oxidative stress in a physiological context. Plant,
cell & environment 28: 1056-1071
Fukao T, Bailey-Serres J (2008) Submergence tolerance conferred by Sub1A is
mediated by SLR1 and SLRL1 restriction of gibberellin responses in rice.
Proceedings of the national academy of sciences 105: 16814-16819
Fukao T, Yeung E, Bailey-Serres J (2011) The submergence tolerance regulator
SUB1A mediates crosstalk between submergence and drought tolerance in
rice. The plant cell 23: 412-427
Fukazawa J, Sakai T, Ishida S, Yamaguchi I, Kamiya Y, Takahashi Y (2000)
Repression of shoot growth, a bZIP transcriptional activator, regulates cell
elongation by controlling the level of gibberellins. The plant cell 12: 901-15
Glaszmann JC (1987) Isozymes and classification of Asian rice varieties.
Theoretical and applied genetics 74: 21-30
Gomosta R, Vergara BS (1983) Photoperiod sensitivity of Rayada rices. IRRN 8:6
144
Gouws LM, Kossmann J (2009) The molecular analysis of the effects of
lumichrome as a plant growth promoting substance. Doctoral dissertation,
Stellenbosch: University Stellenbosch
Gowda VR, Henry A, Vadez V, Shashidhar HE, Serraj R (2012) Water uptake
dynamics under progressive drought stress in diverse accessions of the
OryzaSNP panel of rice (Oryza sativa). Functional plant biology 39:402-411
Grad LI, Lemire BD (2006) Riboflavin enhances the assembly of mitochondrial
cytochrome c oxidase in C. elegans NADH-ubiquinone oxidoreductase
mutants. Biochimica et Biophysica Acta (BBA)-Bioenergetics, 1757:115-122
Graeber K, Nakabayashi K, Miatton E, Leubner‐Metzger G Erhard Soppe WJ
(2012) Molecular mechanisms of seed dormancy. Plant, Cell & Environment
35: 1769-1786
Gubler F, Millar AA, Jacobsen JV (2005) Dormancy release, ABA and preharvest sprouting. Current opinion in plant biology 8: 183-187
Gutierrez L, Van Wuytswinkel O, Castelain M, Bellini C (2007) Combined
networks regulating seed maturation. Trends in Plant science 12: 294-300
Haque (1974) Physiological behavior of deep-water rice. In: Proceedings of the
International Seminar on Deepwater Rice, August 21-26, 1974. No. 15.
Bangladesh Rice Research Institute, 1975. Pp.184-190
Hasanuzzaman SM (1974) Cultivation of deepwater rice in Bangladesh. In:
Proceedings of the International Seminar on Deepwater Rice, August 21-26,
1974. No. 15. Bangladesh Rice Research Institute, 1975, pp 137-147
Hatier JHB, Gould KS (2009) Anthocyanin function in vegetative organs. In
Anthocyanins. Springer New York. pp. 1-19
Hattori Y, Nagai K, Furukawa S, Song XJ, Kawano R, Sakakibara H, Wu J,
Matsumoto T, Yoshimura A, Kitano H, Matsuoka M, Mori H, Ashikari M
(2009) The ethylene response factors SNORKEL1 and SNORKEL2 allow
rice to adapt to deepwater. Nature 460: 1026-1031
145
Heim MA, Jakoby M, Werber M, Martin C, Weisshaar B, Bailey PC(2003) The
basic helix-loop-helix transcription factor family in plants: a genome-wide
study of protein structure and functional diversity. Molecular biology and
evolution 20:735-747
Henry A, Gowda VR, Torres RO, McNally KL, Serraj R (2011) Variation in root
system architecture and drought response in rice (Oryza sativa): Phenotyping
of the OryzaSNP panel in rainfed lowland fields. Field crop research
120:205-214
Hichri I, Barrieu F, Bogs J, Kappel C, Delrot S, Lauvergeat V (2011) Recent
advances in the transcriptional regulation of the flavonoid biosynthetic
pathway. Journal of experimental botany 62: 2465-2483
Hirano HY, Hirai A, Sano Y, Sasaki T (2008) Rice Biology in the Genomics Era,
Biotechnology in Agriculture and Forestry. Vol. 62. Springer
Hite DR, Auh C, Scandalios JG (1999) Catalase activity and hydrogen peroxide
levels are inversely correlated in maize scutella during seed germination.
Redox report 4: 29-34
Hobo T, Kowyama Y, Hattori T(1999) A bZIP factor, TRAB1, interacts with VP1
and mediates abscisic acid-induced transcription. Proceedings of the national
academy of sciences 96: 15348-15353
Hoffmann-Benning S, Kende H (1992) On the role of abscisic acid and
gibberellin in the regulation of growth in rice. Plant physiology 99: 11561161
Holdsworth MJ, Bentsink L, Soppe WJ (2008) Molecular networks regulating
Arabidopsis seed maturation, after‐ripening, dormancy and germination. New
phytologist 179: 33-54
Hossain M, Jaim WMH (2012) Diversity, spatial distribution, and the process of
adoption of improved rice varieties in Bangladesh. In: Adoption and diffusion
of modern rice varieties in Bangladesh and Eastern India. International Rice
Research Institute, Los Baños
146
Hossain MA, Cho JI, Han M, Ahn CH, Jeon JS, An G, Park PB (2010a) The
ABRE-binding bZIP transcription factor OsABF2 is a positive regulator of
abiotic stress and ABA signaling in rice. Journal of plant physiology 167 :
1512-1520
Hossain MA, Lee Y, Cho JI, Ahn CH, Lee SK, Jeon JS, Kang H, Lee CH, An G,
Park PB (2010b) The bZIP transcription factor OsABF1 is an ABA
responsive element binding factor that enhances abiotic stress signaling in
rice. Plant molecular biology 72:557-566
Hu X, Zhang A, Zhang J, Jiang M (2006) Abscisic Acid is a Key Inducer of
Hydrogen Peroxide Production in Leaves of Maize Plants Exposed to Water
Stress. Journal of experimental botany 47: 1484-1495
Huang X, Kurata N, Wei X, Wang ZX, Wang A, Zhao Q, et al(2012) A map of
rice genome variation reveals the origin of cultivated rice. Nature 490: 497501
Huke RE, Huke EH (1997) Rice area by type of culture: South, Southeast, and
East Asia. IRRI, Los Baños, Philippines
Ichikawa H, Ichiyanagi T, Xu B, Yoshii Y, Nakajima M, Konishi T (2001)
Antioxidant activity of anthocyanin extract from purple black rice. Journal of
medicinal food 4: 211-218
Ishibashi Y, Tawaratsumida T, Kondo K, Kasa S, Sakamoto M, Aoki N, ... &
Iwaya-Inoue M (2012) Reactive oxygen species are involved in
gibberellin/abscisic acid signaling in barley aleurone cells. Plant physiology
158: 1705-1714
Ismail AM, Ella ES, Vergara GV, Mackill DJ (2009) Mechanisms associated with
tolerance to flooding during germination and early seedling growth in rice
(Oryza sativa). Annals of botany 103:197-209
Ismail AM, Johnson DE, Ella ES, Vergara GV, Baltazar AM (2012) Adaptation to
flooding during emergence and seedling growth in rice and weeds, and
implications for crop establishment. AoB PLANTS 2012: pls019;
doi:10.1093/aobpla/pls019
147
Izawa T, Foster R, Nakajima M, Shimamoto K, Chua NH (1994) The rice bZIP
transcriptional
activator
RITA-1
is
highly
expressed
during
seed
development. Plant cell 6: 1277-1287
Jackson MB, Pearce DM, Summers JE (1996) Tolerance to submergence and
anaerobiosis: rice seedlings have something still to learn. In Physiology of
Stress Tolerance in Rice: Proceedings of the international conference on
stress physiology or rice, 28 Feb-5 March 1994, Lucknow, India . Manila,
IRRI, pp31-43
Jakoby M, Weisshaar B, Droge-Laser W, Vicente-Carbajosa J, Tiedemann J, Kroj
T, Parcy F (2002) bZIP transcription factors in Arabidopsis. Trends in plant
science 7: 106-11
Jeon JS, Lee S, Jung KH, Jun SH, Jeong DH, Lee J, Kim C, Jang S, Yang K, Nam
J, et al(2000) T-DNA insertional mutagenesis for functional genomics in rice.
The plant journal 22: 561-70
Jia L, Wu Q, Ye N, Liu R, Shi L, Xu W, Zhi H, Rahman ANMRB, Xia Y, Zhang
J (2012) Proanthocyanidins inhibit seed germination by maintaining a high
level of abscisic acid in Arabidopsis thaliana (F). Journal of integrative plant
biology 54: 663-73
Joo JH, Bae YS, Lee JS (2001) Role of auxin-induced reactive oxygen species in
root gravitropism. Plant physiology 126: 1055-1060
Juliano BO (1993) Rice in human nutrition. Rome, Italy: Food and Agriculture
Organization of the United Nations (FAO)
Juliano BO, Bechtel DB (1985) The rice grain and its gross composition. In Rice:
Chemistry and Technology; American Association of Cereal Chemists: St.
Paul, MN
Kato H, Namai H (1987) Floral characteristics and environmental factors for
increasing natural outcrossing rate for F1 hybrid seed production of rice
Oryza sativa L. Japanese Journal of Breeding 37:318-330
148
Keith KA, Raskin I, Kende H (1986) A comparison of the submergence response
of deepwater and non-deepwater rice. Plant physiology 80: 479-482
Kendall SL, Hellwege A, Marriot P, Whalley C, Graham IA, Penfield S (2011)
Induction of dormancy in Arabidopsis summer annuals requires parallel
regulation of DOG1 and hormone metabolism by low temperature and CBF
transcription factors. The plant cell 23: 2568-2580
Kende H, van der Knaap E, Cho HT (1998) Deepwater rice: A model plant to
study stem elongation. Plant physiology 118:1105-1110
Khush G (1997) Origin, dispersal, cultivation and variation of rice. Plant
molecular biology 35:25-34
Khush GS, Virk PS (2005) IR varieties and their impact. Los Baños (Philippines):
International Rice Research Institute. 163 p
Kim H, Hwang H, Hong JW, Lee YN, Ahn IP, Yoon IS, Kim BG (2012) A rice
orthologue of the ABA receptor, OsPYL/RCAR5, is a positive regulator of
the ABA signal transduction pathway in seed germination and early seedling
growth. Journal of experimental botany 63:1013-1024
Kitahata N, Saito S, Miyazawa Y, et al. (2005) Chemical regulation of abscisic
acid catabolism in plants by cytochrome P450 inhibitors. Bioorganic and
Medicinal Chemistry 13:4491-4498
Kobata T, Uemuki N (2004) High temperatures during the grain-filling period do
not reduce the potential grain dry matter increase of rice. Agronomy Journal
96:406-414
Kobayashi Y, Yamamoto S, Minami H, Kagaya Y and Hattori T (2004)
Differential activation of the rice sucrose nonfermenting1- related protein
kinase2 family by hyperosmotic stress and abscisic acid. Plant cell 16:11631177
Koes R, Verweij W, Quattrocchio F (2005) Flavonoids: a colorful model for the
regulation and evolution of biochemical pathways. Trends in Plant science10:
236-242
149
Kondo M, Terasaka A, Umino M (1942) Experimental studies on photoperiodism
in rice.III. [translation] Nogaku Kenkyu 33:l-24
Kucera B, Cohn MA, Leubner-Metzger G (2005) Plant hormone interactions
during seed dormancy release and germination. Seed Science Research 15:
281-307
Kushiro T, Okamoto M, Nakabayashi K, Yamagishi K, Kitamura S, Asami T,
Hirai N, Koshiba T, Kamiya Y, Nambara E (2004) The Arabidopsis
cytochrome P450 CYP707A encodes ABA 8’-hydroxylases: key enzymes in
ABA catabolism. EMBO Journal 23: 1647-1656
Lao NT, Long D, Kiang S, Coupland G, Shoue DA, Carpita NC, Kavanagh TA
(2003) Mutation of a family 8 glycosyltransferase gene alters cell wall
carbohydrate composition and causes a humidity-sensitive semi-sterile dwarf
phenotype in Arabidopsis. Plant molecular biology 53: 687-701
Lee KH, Piao HL, Kim HY, Choi SM, Jiang F, Hartung W, ... & Hwang I (2006)
Activation of glucosidase via stress-induced polymerization rapidly increases
active pools of abscisic acid. Cell 126: 1109-1120
Lee YC, Lu, Chen CA, Casaretto PW, Yu SM (2003) An ABA-responsive bZIP
protein, OsBZ8, mediates sugar repression of alpha-amylase gene expression.
Plant physiology 119: 78-86
Leymarie J, Vitkauskaité G, Hoang HH, Gendreau E, Chazoule V, Meimoun P, ...
Bailly C (2012) Role of reactive oxygen species in the regulation of
Arabidopsis seed dormancy. Plant and cell physiology 53: 96-106
Li M, Xu W, Yang W, Kong Z, Xue Y (2007) Genome-wide gene expression
profiling reveals conserved and novel molecular functions of the stigma in
rice. Plant physiology 144: 1797-1812
Li Y, Zhang T, Shen ZW, Xu Y, Li JY (2013) Overexpression of maize
anthocyanin regulatory gene Lc affects rice fertility. Biotechnology letters 35:
115-119
150
Li ZK, Zhang F (2013) Rice breeding in the post-genomics era: from concept to
practice. Current opinion in plant biology 16: 261-269
Li ZX, Septiningsih EM, Quilloy-Mercado SM, McNally KL, Mackill DJ (2011)
Identification of SUB1A alleles from wild rice Oryza rufipogon Griff.
Genetic resources and crop evolution 58: 1237-1242
Lin CC., Kao CH (1995) NaCl stress in rice seedlings: starch mobilization and the
influence of gibberellic acid on seedling growth. Botanical Bulletin of
Academia Sinica 36:169-173
Liu C, Mao B, Ou S, Wang W, Liu L, Wu Y, ... Wang X (2013) OsbZIP71, a
bZIP transcription factor, confers salinity and drought tolerance in rice. Plant
molecular biology 1-18
Liu C, Wu Y, Wang X (2012) bZIP transcription factor OsbZIP52/RISBZ5: a
potential negative regulator of cold and drought stress response in rice. Planta
235: 1157-1169
Liu Y, Ye N, Liu R, Chen M, Zhang J (2010) H2O2 mediates the regulation of
ABA catabolism and GA biosynthesis in Arabidopsis seed dormancy and
germination . Journal of experimental botany 61: 2979-2990
Lloyd AM, Walbot V, Davis RW(1992)Arabidopsis and Nicotiana anthocyanin
production activated by maize regulators R and C1. Science 258:1773-1775
Lloyd AM. et al. (1994) Epidermal cell fate determination in Arabidopsis:
patterns defined by a steroid-inducible regulator. Science 266:436-439
Londo JP, Chiang YC, Hung KH, Chiang TY, Schaal BA (2006) Phylogeography
of Asian wild rice, Oryza rufipogon, reveals multiple independent
domestications of cultivated rice, Oryza sativa. Proceedings of the national
academy of sciences of USA 103: 9578-83
Lowry DB (2012) Ecotypes and the controversy over stages in the formation of
new species. Biological journal of the Linnean society 106: 241-257
Lu G, Gao C, Zheng X, Han B(2009) Identification of OsbZIP72 as a positive
regulator of ABA response and drought tolerance in rice. Planta 229:605-615
151
Lu SJ, Yang ZT, Sun L, Sun L, Song ZT, Liu JX (2012) Conservation of IRE1regulated bZIP74 mRNA unconventional splicing in rice (Oryza sativa L.)
involved in ER stress responses. Molecular plant 5: 504-514
Maclean JL, Dawe D, Hardy B, Hettel GP (2002) Rice almanac. CABI
Publishing, Wallingford UK
Magneschi L, Perata P (2009) Rice germination and seedling growth in the
absence of oxygen. Annals of botany 103:181-196.
Matiru VN, Dakora FD (2005) The rhizosphere signal molecule lumichrome
alters seedling development in both legumes and cereals. New phytologist
166:439-444
McCouch SR, Kovach MJ, Sweeney M, Jiang H, Semon M (2012) The Dynamics
of Rice Domestication: A Balance between Gene Flow and Genetic Isolation.
Gepts P, Famula TR, Bettinger RL, Brush SB, Damania AB (Eds.) In :
Biodiversity in Agriculture: Domestication, Evolution, and Sustainability,
Cambridge University Press
McInnis SM, Emery DC, Porter R, Desikan R, Hancock JT, Hiscock SJ (2006)
The role of stigma peroxidases in flowering plants: insights from further
characterization of a stigma-specific peroxidase (SSP) from Senecio
squalidus (Asteraceae). Journal of experimental botany 57: 1835-1846
McNally KL, Childs KL, Bohnert R, Davidson RM, Zhao K, Ulat VJ, Zeller G,
Clark RM, Hoen DR, Bureau TE, Stokowski R, Ballinger DG, Frazer KA,
Cox DR, Padhukasahasram B, Bustamante CD, Weigel D, Mackill DJ,
Bruskiewich RM, Ratsch G, Buell CR, Leung H, Leach JE (2009)
Genomewide SNP variation reveals relationships among landraces and
modern varieties of rice. Proceedings of the national academy of sciences of
USA 106:12273-12278
Millar AA, Jacobsen JV, Ross JJ, Helliwell CA, Poole AT, Scofield G,Reid JB ,
Gubler F (2006) Seed dormancy and ABA metabolism in Arabidopsis and
barley: the role of ABA 8￠-hydroxylase. Plant journal 45: 942- 954
152
Miro B, Ismail AM (2013) Tolerance of anaerobic conditions caused by flooding
during germination and early growth in rice (Oryza sativa L.). Frontiers in
Plant science, 4:269. doi: 10.3389/fpls.2013.00269
Miyata M, Yamamoto T, Komori T , Nitta N (2007) Marker assisted selection and
evaluation of the QTL for stigma exsertion under japonica rice genetic
background. Theoretical and applied genetics114: 539-548
Mohanty B, Herath V, Wijaya E, Yeo HC, Reyes BG, Lee DY (2012) Patterns of
cis-element enrichment reveal potential regulatory modules involved in the
transcriptional regulation of anoxia response of japonica rice. Gene 511: 235242
Molina J, Sikora M, Garud N, Flowers JM, Rubinstein S, Reynolds A, Huang P,
Jackson S, Schaal BA, Bustamante CD, Boyko AR, Purugganan MD (2011)
Molecular evidence for a single evolutionary origin of domesticated rice.
Proceedings of the national academy of sciences of USA 108: 8351-8356
Moyer RA, Hummer KE, Finn CE, Frei B, Wrolstad RE (2002) Anthocyanins,
phenolics, and antioxidant capacity in diverse small fruits: Vaccinium, Rubus,
and Ribes. Journal of agricultural and food chemistry 50:519-525
Nagai K, Kuroha T, Ayano M, Kurokawa Y, Angeles-Shim RB, Shim JH, Yasui
H, Yoshimura A, Ashikari M (2012) Two novel QTLs regulate internode
elongation in deepwater rice during the early vegetative stage. Breeding
science 62: 178
Nakabayashi K, Bartsch M, Xiang Y, Miatton E, Pellengahr S, Yano R, ... &
Soppe WJ (2012) The time required for dormancy release in Arabidopsis is
determined by DELAY OF GERMINATION1 protein levels in freshly
harvested seeds. The plant cell 24: 2826-2838
Nakagawa H, Ohmiya K, Hattori T (1996) A rice bZIP protein, designated
OSBZ8, is rapidly induced by abscisic acid. Plant journal 9: 217-227
Nakashima K, Yamaguchi-Shinozaki K (2013) ABA signaling in stress-response
and seed development. Plant cell reports 32: 959-970
153
Nambara E, Marion-Poll A (2005) Abscisic acid biosynthesis and catabolism.
Annual review plant biology 56: 165-185
Nambara E, Okamoto M, Tatematsu K, Yano R, Seo M, Kamiya Y (2010)
Abscisic acid and the control of seed dormancy and germination. Seed
science research 20: 55-67
Nantel A, Quatrano RS (1996) Characterization of three rice basic/leucine zipper
factors, including two inhibitors of EmBP-1 DNA binding activity. Journal of
biological chemistry 271: 31296-31305
Nasiruddin M, Hassan MS (2009) Subsector: rice , Agricultural Research Priority
: Vision 2030 and Beyond. Bangladesh Agricultural Research Council, Dhaka
Neill S, Desikan R, Hancock J (2002) Hydrogen peroxide signalling. Current
opinion in plant biology 5:388-395
Nijhawan A, Jain M, Tyagi AK, Khurana JP(2008) Genomic survey and gene
expression analysis of the basic leucine zipper transcription factor family in
rice. Plant physiology 146: 333-50
Ogawa K, Iwabuchi M(2001) A mechanism for promoting the germination of
Zinnia elegans seeds by hydrogen peroxide. Plant and cell physiology 42:
286-291
Oh SJ, Kim YS, Kwon CW, Park HK, Jeong JS, Kim JK (2009) Overexpression
of the transcription factor AP37 in rice improves grain yield under drought
conditions. Plant physiology 150:1368- 1379
Oka HI, Chang WT (1960) Survey of variations in photoperiodic response in wild
Oryza species. Bot Bull Acad Sinica 1: 1-14
Okamoto M, Kuwahara A, Seo M, Kushiro T, Asami T, Hirai N, Kamiya Y,
Koshiba T, Nambara E (2006) CYP707A1 and CYP707A2, which encode
abscisic acid 8′-hydroxylases, are indispensable for proper control of seed
dormancy and germination in Arabidopsis. Plant physiology 141: 97-107
Okamoto M, Tanaka Y, Abrams SR, Kamiya Y, Seki M, Nambara E(2009) High
humidity induces abscisic acid 8′-hydroxylase in stomata and vasculature to
154
regulate local and systemic abscisic acid responses in Arabidopsis. Plant
physiology 149: 825-834
Okamoto M, Tatematsu K, Matsui A, Morosawa T, Ishida J, Tanaka M , et al.
(2010) Genome‐wide analysis of endogenous abscisic acid‐mediated
transcription in dry and imbibed seeds of Arabidopsis using tiling arrays. The
plant journal 62:39-51
Oliver MJ, Guo L, Alexander DC, Ryals JA, Wone BW, Cushman JC (2011) A
sister group contrast using untargeted global metabolomic analysis delineates
the biochemical regulation underlying desiccation tolerance in Sporobolus
stapfianus. The plant cell 23:1231-1248
Onodera Y, Suzuki A, Wu CY, Washida H, Takaiwa F (2001) A rice functional
transcriptional activator, RISBZ1, responsible for endospermspecific
expression of storage protein genes through GCN4 motif. Journal of
biological chemistry 276: 14139-14152
Onofri A (2007) Routine statistical analyses of field experiments by using an
Excel extension.In: Proceedings 6th National Conference Italian Biometric
Society: "La statistica nelle scienze della vita e dell’ambiente", Pisa, 20-22
June 2007, 93-96
Oracz K, Bouteau HEM, Farrant JM, Cooper K, Belghazi M, Job C, ... Bailly C
(2007) ROS production and protein oxidation as a novel mechanism for seed
dormancy alleviation. The plant journal 50: 452-465
O'Toole JC, Cruz RT (1980) Response of leaf water potential, stomatal resistance,
and leaf rolling to water stress. Plant physiology 65: 428-432
Passardi F, Longet D, Penel C, Dunand C (2004) The class III peroxidase
multigene family in rice and its evolution in land plants. Phytochemistry 65:
1879-1893
Patra B, Pattanaik S, Yuan L (2013) Ubiquitin protein ligase 3 mediates the
proteasomal degradation of GLABROUS 3 and ENHANCER OF
GLABROUS 3, regulators of trichome development and flavonoid
biosynthesis in Arabidopsis. The plant journal 74:435-447
155
Perez AT, Nasiruddin M (1974) Field notes on the Rayadas: a flood-tolerant
deepwater rice of Bangladesh. In: Proceedings of the International Seminar
on Deepwater Rice, August 21-26, 1974. No. 15. Bangladesh Rice Research
Institute, 1975, pp 87-91
Phillips DA, Joseph CM, Yang GP, Martínez-Romero E, Sanborn JR, Volpin H
(1999) Identification of lumichrome as a Sinorhizobium enhancer of alfalfa
root respiration and shoot growth. Proceedings of the national academy of
sciences 96: 12275-12280
Potocky M , Jones MA , Bezvoda R , Smirnoff N , Zarsky V (2007) . Reactive
oxygen species produced by NADPH oxidase are involved in pollen tube
growth. New phytologist 174: 742 - 751
Puntarulo S, Sa´nchez RA, Boveris A (1988) Hydrogen peroxide metabolism in
soybean embryonic axes at the onset of germination. Plant physiology 86:
626-630
Qin X, Zeevaart JAD (1999) The 9-cis-epoxycarotenoid cleavage reaction is the
key regulatory step of abscisic acid biosynthesis in water-stressed bean.
Proceedings of the national academy of sciences 96: 15354-15361
Rabbani MA, Maruyama K, Abe H, Khan MA, Katsura K, Ito Y, Yoshiwara K,
Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Monitoring expression
profiles of rice genes under cold, drought, and high-salinity stresses and
abscisic acid application using cDNA microarray and RNA gel-blot analyses.
Plant physiology 133:1755-1767
Raghavendra AS, Gonugunta VK, Christmann A, Grill E (2010) ABA perception
and signalling. Trends in plant science 15: 395-401
Ramsay NA, Glover BJ (2005) MYB-bHLH-WD40 protein complex and the
evolution of cellular diversity. Trends in plant science, 10: 63-70
Rapisarda P, Fanella F, Maccarone E (2000) Reliability of analytical methods for
determining anthocyanins in blood orange juices. Journal of agricultural and
food chemistry 48:2249-2252
156
Ray H, Yu M, Auser P, Blahut-Beatty L, McKersie B, Bowley S, Westcott N,
Coulman B, Lloyd A, Gruber MY(2003) Expression of anthocyanins and
proanthocyanidins after transformation of alfalfa with maize Lc. Plant
physiology132:1448-1463
Raz V, Bergervoet JHW, Koornneef M (2001) Sequential steps for developmental
arrest in Arabidopsis seeds. Development 128: 243-252
Ren H, Gao Z, Chen L, Wei K, Liu J, Fan Y, Davies WJ, Jia W, Zhang J(2007)
Dynamic analysis of ABA accumulation in relation to the rate of ABA
catabolism in maize tissues under water deficit. Journal of experimental
botany 58: 211-9
Rio LAD, Puppo A (2009) Reactive oxygen species in plant signaling. Springer
Rodriguez AA, Grunberg K, Taleisnik EL (2002) Reactive oxygen species in the
elongation zone of maize leaves are necessary for leaf expansion. Plant
physiology 129: 1627-1632
Saika H, Okamoto M, Miyoshi K, Kushiro T, Shinoda S, Jikumaru Y, Fujimoto
M, Arikawa T, Takahashi H, Ando M, et al (2007) Ethylene promotes
submergence-induced expression of OsABA8ox1, a gene that encodes ABA
8'-hydroxylase in rice. Plant and cell physiology 48: 287-298
Saito S, Hirai N, Matsumoto C, Ohigashi H, Ohta D, Sakata K, Mizutani M(2004)
Arabidopsis CYP707As encode (+)-abscisic acid 8′-hydroxylase, a key
enzyme in the oxidative catabolism of abscisic acid. Plant physiology
134:1439-1449
Sang T, Ge S (2013) Understanding rice domestication and implications for
cultivar improvement. Current opinion plant biology 16: 1-8
Schoft VK, Chumak N, Choi Y., Hannon M., Garcia-Aguilar M, Machlicova A, ...
Tamaru H (2011) Function of the DEMETER DNA glycosylase in the
Arabidopsis thaliana male gametophyte. Proceedings of the National
Academy of Sciences108:8042-8047
157
Schwartz SH, Zeevaart JA (2010) Abscisic acid biosynthesis and metabolism. In
Plant Hormones (pp. 137-155). Springer Netherlands.
Seki M, Kamei A, Yamaguchi-Shinozaki K, Shinozaki K (2003) Molecular
responses to drought, salinity and frost: common and different paths for plant
protection. Current opinion in biotechnology 14:194-199
Seki M, Umezawa T, Urano K, Shinozaki K (2007) Regulatory metabolic
networks in drought stress responses. Current opinion in plant biology 10:
296-302
Septiningsih EM, Ignacio JCI, Sendon PM, Sanchez DL, Ismail AM, Mackill DJ
(2013) QTL mapping and confirmation for tolerance of anaerobic conditions
during germination derived from the rice landrace Ma-Zhan Red. Theoretical
and applied genetics, 1-10
Sharp RE, Davies WJ (1989) Regulation of growth and development of plants
growing with a restricted supply of water. In: Jones HG, Flowers TL, Jones
MB, eds. Plants under stress. Cambridge: Cambridge University Press, 71-93
Shen SQ, Shu QY, Bao JS, Wu DX, Cui HR , Xia YW (2004) Development of a
greenable leaf colour mutant Baifeng A and its application in hybrid rice
production. Chinese J Rice Sci 18: 34-38. (In Chinese with English abstract)
Shigeoka S, Ishikawa T, Tamoi M, Miyagawa Y, Takeda T, Yabuta Y, Yoshimura
K (2002) Regulation and function of ascorbate peroxidase isoenzymes.
Journal of experimental botany 53: 1305-1319
Shimizu H, Sato K, Berberich T, Miyazaki A, Ozaki R, Imai R, Kusano T (2005)
LIP19, a basic region leucine zipper protein, is a Fos-like molecular switch in
the cold signaling of rice plants. Plant and cell physiology 46: 1623-1634
Shinozaki K, Yamaguchi-Shinozaki K (2007) Gene networks involved in drought
stress response and tolerance. Journal of experimental botany 58:221-227
Sohail Q, Inoue T, Tanaka H, Eltayeb AE, Matsuoka Y, Tsujimoto H (2011)
Applicability of Aegilops tauschii drought tolerance traits to breeding of
hexaploid wheat. Breeding science 61: 347
158
Speranza A, Crinelli R, Scoccianti V, Geitmann A (2012) Reactive oxygen
species are involved in pollen tube initiation in kiwifruit. Plant biology 14:
64-76
Sreenivasulu N, Radchuk V, Alawady A, Borisjuk L, Weier D, Staroske et al.
(2010) De‐regulation of abscisic acid contents causes abnormal endosperm
development in the barley mutant seg8. The plant journal 64: 589-603
Steffens B, Geske T, Sauter M (2011) Aerenchyma formation in the rice stem and
its promotion by H2O2. New phytologist 190: 369-378
Steffens B, Sauter M (2009) Epidermal cell death in rice is confined to cells with
a distinct molecular identity and is mediated by ethylene and H2O2 through an
autoamplified signal pathway. The plant cell 21:184-196
Steyn WJ (2009) Prevalence and functions of anthocyanins in fruits. In
Anthocyanins (pp. 86-105). Springer New York
Sugimoto K, Takeuchi Y, Ebana K, Miyao A, Hirochika H, Hara N, ... & Yano,
M (2010) Molecular cloning of Sdr4, a regulator involved in seed dormancy
and domestication of rice. Proceedings of the national academy of sciences
107: 5792-5797
Sun C, Wang X, Yoshimura A, Doi K (2002) Genetic differentiation for nuclear,
mitochondrial and chloroplast genomes in common wild rice (Oryza
rufipogon Griff.) and cultivated rice (Oryza sativa L.). Theoretical and
applied genetics104:1335-1345
Suslow T, Thomas B, Bradford K (2002) Biotechnology provides new tools for
plant breeding. Agricultural Biotechnology in California Series, Publication
8043, Seed Biotechnology Center, UC Davis
Taheri P, Tarighi S (2010) Riboflavin induces resistance in rice against
Rhizoctonia solani via jasmonate-mediated priming of phenylpropanoid
pathway. Journal of plant physiology 167: 201-208
159
Takahashi H, Kawakatsu T, Wakasa Y, Hayashi S, Takaiwa F (2012) A rice
transmembrane
bZIP
transcription
factor,
OsbZIP39,
regulates
the
endoplasmic reticulum stress response. Plant and cell physiology 53:144-153
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5:
Molecular Evolutionary Genetics Analysis using Maximum Likelihood,
Evolutionary Distance, and Maximum Parsimony Methods. Molecular
biology and evolution 28: 2731-2739
Tang H, Sezen U, Paterson AH (2010) Domestication and plant genomes. Current
opinion in plant biology 13:160-166
Tominaga-Wada R, Iwata M, Nukumizu Y, Sano R, Wada T (2012) A full-length
R-like basic-helix-loop-helix transcription factor is required for anthocyanin
up-regulation whereas the N-terminal region regulates epidermal hair
formation. Plant science 183:115-122
Tsugama D, Liu S, Takano T (2012) A bZIP protein, VIP1, is a regulator of
osmosensory signaling in Arabidopsis. Plant physiology 159: 144-155
Tzfira T, Vaidya M, Citovsky V(2001) VIP1, an Arabidopsis protein that interacts
with Agrobacterium VirE2, is involved in VirE2 nuclear import and
Agrobacterium infectivity. The EMBO journal 20: 3596-607
Uga Y, Siangliw M, Nagamine T, Ohsawa R, Fujimura T , Fukuta Y (2010)
Comparative mapping of QTLs determining glume, pistil and stamen sizes in
cultivated rice (Oryza sativa L.). Plant breeding 129: 657-669
UgaY, Fukuta Y , Cai HW, Iwata H, Ohsawa R, Morishima H ,Fujimura T (2003)
Mapping QTLs influencing rice floral morphology using recombinant inbred
lines derived from a cross between Oryza sativa L. and Oryza rufipogon
Griff. Theoretical and applied genetics 107: 218-226
Umezawa T, Nakashima K, Miyakawa T, Kuromori T, Tanokura M, Shinozaki K,
Yamaguchi-Shinozaki K (2010) Molecular basis of the core regulatory
network in ABA responses: sensing, signaling and transport. Plant and cell
physiology 51: 1821-1839
160
Umezawa T, Okamoto M, Kushiro T, Nambara E, Oono Y, Seki M, Kobayashi
M, Koshiba T, Kamiya Y, Shinozaki K(2006) CYP707A3, a major ABA 8′hydroxylase involved in dehydration and rehydration response in Arabidopsis
thaliana. Plant journal 46: 171-182
Van Breusegem F and Dat JF (2006) Reactive oxygen species in Plant cell death.
Plant physiology 141: 384-390
Varshney RK , Koebner RMD (2006) Model Plants and Crop Improvement. CRC
Press Inc, Florida, USA
Vaughan DA (1994) The wild relatives of rice: a genetic resources handbook. .
International Rice Research Institute, Los Baños
Veasey EA, Karasawa MG, Santos PP, Rosa MS, Mamani E, Oliveira GCX
(2004) Variation in the loss of seed dormancy during after-ripening of wild
and cultivated rice species. Annals of botany 94:875-882
Vergara BS, Chang T T (1985) The flowering response of the rice plant to
photoperiod: A review of the literature, 4th edn, International Rice Research,
Los Baños
Villareal CP, Juliano BO (1989) Variability in contents of thiamine and riboflavin
in brown rice, crude oil in brown rice and bran-polish, and silicon in hull of
IR rices. Plant foods for human nutrition 39: 287-297
Voesenek LACJ, Bailey-Serres J (2009) Genetics of high-rise rice. Nature 460:
959-960
Volpin H, Phillips DA (1998) Respiratory eclicitors from Rhizobium meliloti
affect intact alfalfa roots. Plant physiology 116: 777-783
Walker AR, Davison PA, olognesi-Winfield AC, James CM, Srinivasan N,
Blundell TL, Esch JJ, Marks MD, Gray JC (1999) The TRANSPARENT
TESTA GLABRA1 locus, which regulates trichome differentiation and
anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein.
Plant cell 11:1337-1350
161
Wang JC, Xu H, Zhu Y, Liu QQ, Cai XL (2013) OsbZIP58, a basic leucine zipper
transcription factor, regulates starch biosynthesis in rice endosperm. Journal
of experimental botany 64: 3453-3466
Wang M, Zhu Z, Tan L, Liu F, Fu Y, Sun C, Cai H (2013) Complexity of indicajaponica varietal differentiation in Bangladesh rice landraces revealed by
microsatellite markers. Breeding science 63: 227
Watt G (1891) A Dictionary of the Economic Products of India. Vol. V. Cosmo
Publications, Delhi (Reprint 1972)
Weerakoon WMW, Maruyama A, Ohba K (2008) Impact of Humidity on
Temperature‐Induced Grain Sterility in Rice (Oryza sativa L). Journal of
agronomy and crop science 194: 135-140
Weitbrecht K, Müller K, Leubner-Metzger G. 2011. First off the mark: early seed
germination. Journal of experimental botany 62: 3089-3309
Wood JP, Mammone T, Chidlow G, Greenwell T, Casson RJ (2012)
Mitochondrial inhibition in rat retinal cell cultures as a model of metabolic
compromise: mechanisms of injury and neuroprotection. Investigative
Ophthalmology & Visual Science 53:4897-4909
Xiang Y, Tang N, Du H, Ye H, Xiong L (2008) Characterization of OsbZIP23 as
a key player of the basic leucine zipper transcription factor family for
conferring abscisic acid sensitivity and salinity and drought tolerance in rice.
Plant physiology 148: 1938-1952
Xiong Y, Liu T, Tian C, Sun S, Li J, Chen M (2005) Transcription factors in rice:
a genome-wide comparative analysis between monocots and eudicots. Plant
molecular biology 59: 191-203
Xu K, Xu X, Fukao T, Canlas P, Maghirang-Rodriquez R, Huer S, Ismail AM,
Bailey-Serres J, Ronald PC, Mackill DJ (2006) Sub1A is an ethyleneresponse-factor-like gene that confers submergence tolerance to rice. Nature
442: 705-708
162
Xu ZY, Lee KH, Dong T, Jeong JC, Jin JB, Kanno Y, & Hwang I (2012) A
vacuolar β-glucosidase homolog that possesses glucose-conjugated abscisic
acid hydrolyzing activity plays an important role in osmotic stress responses
in Arabidopsis. The plant cell 24: 2184-2199
Yamakawa H, Hirose T, Kuroda M, Yamaguchi T (2007) Comprehensive
expression profiling of rice grain filling-related genes under high temperature
using DNA microarray. Plant physiology 144:258-277
Yamamoto MP, Onodera Y, Touno SM, Takaiwa F (2006) Synergism between
RPBF Dof and RISBZ1 bZIP activators in the regulation of rice seed
expression genes. Plant physiology 141: 1694-1707
Yamamoto T, Takemori N, Sue N ,Nitta N (2003) QTL analysis of stigma
exsertion in rice. Rice Genet Newsl 20: 33-34
Yamauchi M, Aguilar AM, Vaughan DA, Seshu DV (1993) Rice (Oryza sativa
L.) germplasm suitable for direct sowing under flooded soil surface.
Euphytica 67: 177-184
Yan WG, Li Y, Agrama HA, Luo D, Gao ,Lu X, Ren G (2009) Association
mapping of stigma and spikelet characteristics in rice (Oryza sativa L.).
Molecular Breeding 24: 277-292
Yanagita T, Foster JW (1956) A bacterial riboflavin hydrolase. Journal of
Biological Chemistry 221: 593-607
Yang J, Zhang J (2010) Grain-filling problem in ‘super’rice. Journal of
experimental botany 61:1-5
Yang D, Wu L, Hwang YS, Chen L, Huang N (2001) Expression of the REB
transcriptional activator in rice grains improves the yield of recombinant
proteins whose genes are controlled by a Reb-responsive promoter.
Proceedings of the national academy of sciences of USA 98: 11438-11443
Yang J, Zhang J (2006) Grain filling of cereals under soil drying. New phytologist
169: 223-236
163
Yang SH, Zeevaart JA (2006) Expression of ABA 8′-hydroxylases in relation to
leaf water relations and seed development in bean. The plant journal 47: 675686
Yang SH, Choi D (2006) Characterization of genes encoding ABA 8′-hydroxylase
in ethylene-induced stem growth of deepwater rice. Biochemical and
biophysical research communications 350: 685-690
Ye N, Jia L, Zhang J (2012b) ABA signal in rice under stress conditions. Rice 5: 1
Ye N, Zhu G, Liu Y, Li Y, Zhang J (2011) ABA controls H2O2 accumulation
through the induction of OsCATB in rice leaves under water stress. Plant and
cell physiology 52:689-698
Ye N, Zhu G, Liu Y, Zhang A, Li Y, Liu R, ... & Zhang J (2012a) Ascorbic acid
and reactive oxygen species are involved in the inhibition of seed germination
by abscisic acid in rice seeds. Journal of experimental botany 63: 1809-1822
Yuan Y, Chiu LW, Li L (2009). Transcriptional regulation of anthocyanin
biosynthesis in red cabbage. Planta 230:1141-1153
Yue B, Cui K, Yu S, Xue W, Luo L, Xing Y (2006) Molecular marker-assisted
dissection of quantitative trait loci for seven morphological traits in rice
(Oryza sativa L.). Euphytica 150: 131-139
Zaman SMH (1977) Progress of deep-water rice research in Bangladesh. In:
Proceedings of the workshop on deep-water rice 1976. International Rice
Research Institute, Los Los Baños, pp 127-134
Zetian H, Yanrong W (2009) Advances in japonica hybrid rice breeding.
Accelerating Hybrid Rice Development, IRRI, Manila, Philippines, pp 139149
Zhang H, Jin JP, Tang L, Zhao Y, Gu XC, Gao G, Luo JC (2011) Plant TFDB 2.0:
update and improvement of the comprehensive plant transcription factor
database. Nucleic acids research 39: D1114-D1117
164
Zhang X, Zhang L, Dong F, Gao J, Galbraith DW, Song CP (2001) Hydrogen
peroxide is involved in abscisic acid-induced stomatal closure in Vicia faba.
Plant physiology 126: 1438-1448
Zhu G, Ye N, Zhang J (2009) Glucose-induced delay of seed germination in rice
is mediated by the suppression of ABA catabolism rather than an
enhancement of ABA biosynthesis. Plant and cell physiology 50: 644-651
Zhu Y, Nomura T, Xu Y, Zhang Y, Peng Y, et al. (2006). ELONGATED
UPPERMOST INTERNODE encodes a cytochrome P450 monooxygenase
that epoxidizes gibberellins in a novel deactivation reaction in rice. Plant cell
18:442-56
Zou M, Guan Y, Ren H, Zhang F, Chen F (2008) A bZIP transcription factor,
OsABI5, is involved in rice fertility and stress tolerance. Plant molecular
biology 66: 675-68
165
CURRICULUM VITAE
Academic qualifications of the thesis author, Mr. BIN RAHMAN A N M
Rubaiyath:

Received the degree of Bachelor of Science (Honours) from University of
Dhaka, January 1997.

Received the degree of Master of Science from University of Dhaka, January
1999.
November 2013
166