Download No evidence for a role of modified live virus vaccines in the

Journal
of General Virology (1998), 79, 1153–1158. Printed in Great Britain
..........................................................................................................................................................................................................
SHORT COMMUNICATION
No evidence for a role of modified live virus vaccines in the
emergence of canine parvovirus
Uwe Truyen,1 Klaus Geissler,1 Colin R. Parrish,2 Walter Hermanns3 and Gu$ nter Siegl4
1
Institute for Medical Microbiology, Ludwig Maximillians University, Veterinaerstr. 13, 80539 Munich, Germany
James A. Baker Institute for Animal Health, New York State College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, USA
3
Institute for Animal Pathology, Ludwig Maximillians University Veterinaerstr. 13, 80539 Munich, Germany
4
Institute for Clinical Microbiology and Immunology, Frohbergstr. 3, CH-9000 St Gallen, Switzerland
2
In this study the early evolution and potential
origins of canine parvovirus (CPV) were examined.
We cloned and sequenced the VP2 capsid protein
genes of three German CPV strains isolated in
1979–1980, as well as two feline panleukopenia
virus (FPV) vaccine viruses that were previously
shown to have some restriction enzyme cleavage
sites in common with CPV. Other partial VP2 gene
sequences were obtained by amplifying CPV DNA
from paraffin-embedded tissues of dogs which were
early parvovirus disease cases in Germany in
1978–1979. Sequences were analysed with respect to their evolutionary relationships to other
CPV and FPV isolates. Those analyses did not
support the hypothesis that CPV emerged as a
variant of an FPV vaccine virus. Neither did they
reveal ancestral sequences among the very early
CPV isolates examined. Other possible sources for
the origin of CPV are examined, including the
involvement of viruses from wild carnivores.
Canine parvovirus (CPV) is a newly recognized virus that
was first isolated in 1978. Within a few years CPV spread
worldwide and caused a panzootic of disease in dog populations (for review see Parrish, 1990). CPV now appears to be
endemic in almost all populations of wild or domesticated
dogs. CPV is antigenically and genetically closely related to
the well-known feline panleukopenia virus (FPV) and is
classified in the feline parvovirus subgroup, along with other
closely related carnivore parvoviruses from mink, racoons,
Asiatic racoon dogs and foxes (Berns et al., 1995 ; Truyen et al.,
1995 a). The origin of CPV has not yet been determined and
various hypotheses explaining its derivation and sudden
emergence have been put forward. One is that CPV is a natural
Author for correspondence : Uwe Truyen.
Fax ­49 89 2180 2155. e-mail Uwe.Truyen!LRZ.uni-muenchen.de
variant FPV with an extended host-range. FPV has also been
suggested to be the source of mink enteritis virus (MEV),
which emerged in mink in the 1940s (Schofield, 1949). Another
hypothesis is that growth of modified live virus FPV or MEV
vaccine strains in tissue culture might have lead to the
generation of a CPV-like virus. In this model, that mutant virus
could subsequently have been distributed by vaccination first
in cat and later in dog populations (Siegl, 1984). Early studies
(Tratschin et al., 1982) addressed these hypotheses by
characterizing several vaccine viruses and early CPV isolates
with neutralization assays using polyclonal sera and restriction
enzyme analyses. The restriction enzyme analysis suggested a
closer relationship between two of the FPV vaccine strains and
early CPV isolates, although they did not prove a direct
relationship between the FPV and CPV strains under study
(Tratschin et al., 1982).
Since its emergence antigenic and genetic variants of CPV
have arisen that can be discriminated using specific monoclonal
antibodies (Parrish et al., 1985, 1991). According to their
temporal appearance those antigenic variants were named
CPV type-2a (CPV-2a) and CPV type-2b (CPV-2b). The first
CPV-2a isolates reported were isolated in 1979, while CPV
type-2b viruses were not reported until 1984 (Parrish et al.,
1991). The CPV-2a and CPV-2b types replaced the original
type of CPV [termed CPV type-2 (CPV-2)] worldwide. The
new types differ from the original CPV-2 viruses in being able
to replicate and cause disease in cats (Truyen et al., 1995 b ;
Mochizuki et al., 1996). The genetic differences between the
new types and the original CPV-2 were only between four and
six coding changes in the capsid protein gene (Parrish et al.,
1991 ; Parrish, 1994).
Only a few amino acids within the capsid protein gene [in
particular residues 93 (Lys ! Asn) and 323 (Asp ! Asn)]
control the canine host-range and antigenic difference between
CPV and the FPV-like viruses (Chang et al., 1992 ; Truyen et al.,
1995 a). From the sequences of a number of FPV-like viruses
from cats, mink, racoons and foxes, and CPV-like viruses from
dogs and Asiatic racoon dogs, the phylogenetically important
sequences which would be expected in an ancestral viruses can
be predicted (Truyen et al., 1995 a ; Parrish, 1991).
0001-5318 # 1998 SGM
BBFD
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 14:31:44
U. Truyen and others
Table 1. Origin of the samples analysed (dog tissues, and dog isolates or vaccines)
including GenBank accession number
Only sequences that have not been analysed before are listed (compare Truyen et al., 1995 a).
Origin
GenBank
no.
FPV-Panocell
Vaccine virus 1970s
AJ002932
FPV-Dohyvac
Vaccine virus 1970s
AJ002931
CPV-Quinn
Dog, Germany 1980
AJ002929
CPV-ChowChow
CPV-Pudel
FPV-615
FPV-Obihiro
Dog, Germany 1979
Dog, Germany 1979
Cat, Germany 1996
Cat, Japan 1974
AJ002927
AJ002928
AJ002930
AB000056
FPV-Som4
Cat, Japan 1995
AB000061
FPV-TU2
Cat, Japan 1975
AB000066
FPV-483
Cat, Japan 1990
D88286
CPV-314
760}78
838}78
1788}78
1887}78
1703}79
2522}79
2645}79
Cat, Japan 1993
Dog, Germany 1978
Dog, Germany 1978
Dog, Germany 1978
Dog, Germany 1978
Dog, Germany 1979
Dog, Germany 1979
Dog, Germany 1979
D78585







Virus
Reference
Tratschin et al. (1982) ;
this paper
Tratschin et al. (1982) ;
this paper
Tratschin et al. (1982) ;
this paper
This paper
This paper
This paper
Horiuchi (1997) ; Goto
et al. (1974)
Horiuchi (1997) ; Horiuchi
et al. (1996)
Horiuchi (1997) ; Mochizuki
et al. (1989)
Horiuchi (1997)
Horiuchi et al. (1996)
Mochizuki et al. (1996)
This paper
This paper
This paper
This paper
This paper
This paper
This paper
, Not deposited in GenBank.
Here we have therefore re-examined the relationships of
some of the viruses reported in earlier studies of the
relationships between CPV and FPV vaccine strains, using
specific monoclonal antibodies for antigenic analysis, and
DNA sequence analysis. We analysed FPV vaccine viruses that
were widely used in the mid 1970s and that have been
suggested as potential ancestors of CPV, and also examined
some early European CPV isolates. As few early CPV isolates
were available we also included parvovirus DNA sequences
that were amplified from paraffin-embedded tissues taken from
dogs in the first years (1978–1979) of CPV emergence.
The sequences obtained were compared to sequences
available from GenBank and analysed with respect to their
evolutionary status. Sequences were aligned using the program
MegAlign of the University of Wisconsin Genetics Computer
Group sequence analysis package. The phylogenies were
calculated using the nearest neighbour interchange branch
swapping algorithm of the program PAUP version 3.1.1
(Swofford, 1993).
Viruses examined are listed in Table 1. Three early CPV
isolates were isolated in 1979 and 1980 in Germany and
BBFE
passaged twice in tissue culture. Two FPV vaccine viruses,
FPV-Panocell and FPV-Dohyvac, were chosen as they have
previously been reported to show a CPV-like pattern after
digestion with HinfI (Tratschin et al., 1982). The viruses were
antigenically typed using monoclonal antibodies and a haemagglutination inhibition (HI) test as described (Parrish &
Carmichael, 1983). Viral DNA was amplified from 1 µl samples
of tissue culture supernatant using primer pair B [primers M1
(5« AGCTGTCGACGAAAACGGATGGGTGGAAAT 3«)
and 41 (5« GCCCTTGTGTAGACGC3«)], amplifying the
regions between nt 2949–3840, and primer pair E [primers M5
(5« ATAACAAACCTTCTAAATCCAATATCAAAT 3«) and
19 (5« GAGACCAGCTGAGGTTGG 3«)], amplifying the
region between nt 3779–4709 (Fig. 1). This allowed the
sequence analysis of about 85 % of the VP2 capsid protein
gene, including all evolutionary informative nucleotides
(Truyen et al., 1995 a).
Few isolates from the early CPV infections of dogs in
Europe were available, but many paraffin-embedded tissues of
the very first German disease cases were stored in the collection
of the Institute of Veterinary Pathology at the Munich
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 14:31:44
Canine parvovirus emergence
Fig. 1. (A) Conserved nucleotide differences between the CPV- and FPV-like viruses and the viruses examined in this study.
The positions of primer pairs B and E used for amplification of the capsid protein gene are indicated. Reference viruses were
CPV-d (type 2), CPV-15 (type 2a) and FPV-b (FPV). Asterisks indicate the positions of isolate-specific coding nucleotide
changes ; the changes are detailed for each virus on the right-hand side. Additional isolate-specific non-coding changes are
listed in the text. Amino acids are depicted in the one-letter code. (B) The primer pairs used for amplification of parvovirus DNA
sequences from paraffin-embedded tissues of dogs are indicated. The primer pairs cover evolutionary relevant regions of the
capsid protein gene.
Veterinary School. Those cases were diagnosed as parvovirus
disease by clinical and histopathological features and in some
cases by positive parvovirus-specific immunofluorescence.
Paraffin-embedded tissues were processed essentially as
described previously (Truyen et al., 1994 ; Wright & Manos,
1990) and parvovirus DNA covering the evolutionary informative regions of the capsid protein gene (Fig. 1) was
amplified by PCR as described (Truyen et al., 1994 ; Schunck
et al., 1995). For amplification of nt 2949–3150 primer pair D
[primers M1 and M2 (5« CTCAGAAATTCAGTTGCCAATCTCCTGGATT 3«)], for nt 3693–4065 primer pair F [primers
M4 (5« CAAACCAACTTGGCGTTACTCA 3«) and M42 (5«
CATTTGTTACAGGAAGG 3«)], and for amplification of nt
4307–4676 primer pair A [primers 34 (5« GTACAATATTTCTATGC 3«) and 63 (5« TAACAAATGAATATGAT 3«)]
were used. Amplified DNA was cloned into the pCRII vector
and analysed by DNA sequencing on an automated sequencer
using cycle sequencing and Taq polymerase. In addition to the
dog tissues described we also attempted to amplify, using
various primer pairs, parvovirus DNA from a total of 13
paraffin-embedded tissue samples from cats that had been
diagnosed with panleukopenia in the 1970s ; however, no
parvovirus DNA sequences could be amplified from any of
those tissues.
The viruses were antigenically typed as FPV-like viruses
(FPV-Panocell, FPV-Dohyvac) or CPV-2-like viruses (CPVPudel, CPV-ChowChow), respectively. The CPV-Quinn isolate was antigenically and genetically identified as a CPV-2a
isolate.
The two FPV vaccine strains did not show features that
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 14:31:44
BBFF
U. Truyen and others
Fig. 2. (A) Antigenic profile of the viruses examined in this study. Subtype-specific monoclonal antibodies were used for typing
the viruses in an HI test. +, HI titre " 100 ; *, HI titres ! 10. (B) Phylogeny of some feline parvoviruses including the FPV
vaccine virus and the dog virus sequences. Both phylogenies are based on 85 % of the VP2 gene and were calculated using
the heuristic search of the program PAUP version 3.1 ; 500 bootstrap replicates were examined and bootstrap values for each
branching point are indicated in italics. (C) Alignment of the DNA sequences from nucleotides 3003 to 3100, representing a
region that allows discrimination of the new antigenic types CPV-2a/2b from CPV-2 (nucleotides 3045 and 3088).
distinguished them substantially from other early MEV- or
FPV-like viruses, and the three early CPV isolates were very
closely related to other CPV-2 or CPV-2a viruses. None of the
BBFG
viruses showed sequences intermediate between the FPV-like
and CPV-like viruses, and all clustered with the viruses
commonly associated with their hosts of origin (Fig. 2). We
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 14:31:44
Canine parvovirus emergence
could not confirm the differences in the restriction enzyme
pattern reported previously for the FPV and CPV isolates
(McMaster et al., 1981 ; Tratschin et al., 1982) as the HinfI site
that differs consistently between all FPV and CPV isolates is
located around nt 1905 at the left-hand site of the genome, and
was not examined in this study. The HinfI site at map unit 82
stated to be variable between FPV and CPV could not be
confirmed in the two vaccine viruses or in the CPV isolates.
However, this HinfI site was also not present in the vast
majority of FPV, MEV and CPV sequences deposited in
GenBank, with MEV-13 and FPV-Carlson being the only
viruses that have this restriction site. The reason for this
discrepancy is not known, but this HinfI site does not appear to
be a valuable feature to distinguish between FPV and CPV
viruses. The unique MboI restriction pattern of the German
CPV isolate (CPV-Quinn) in the Tratschin study could be
explained by the sequence obtained, as this isolate is a CPV-2a
virus, and these viruses have an MboI pattern identical to FPV
isolates. Analysing the DNA sequences amplified from very
early CPV isolates did not reveal any indication for an ancestral
status of those sequences (Fig. 2).
While the analysis of only four FPV vaccine strains (FPVPanocell, FPV-Dohyvac, FPV-Philips-Roxane and FPV-Carlson) does not rule out the involvement of any FPV vaccine in
the origin of CPV, it is clear that the FPV vaccine strains
examined here and in previous studies were not the direct
ancestor of CPV.
The analysis of three further CPV isolates from the early
years of CPV confirmed the presence of the distinct CPV-like
clade. Beside some isolate-specific coding nucleotide changes
in the capsid protein gene which are shown in Fig. 1, a few
isolate-specific silent changes were also found : nt 2958 (G),
3596 (C), 4307 (G) and 4358 (T) in FPV-b ; nt 3203 (C),
4307 (G) and 4358 (T) in FPV-Panocell ; and nt 3086 (C) for
FPV-Dohyvac.
At least 12 conserved nucleotide differences were seen
between all CPV isolates and all FPV-like viruses. This was also
confirmed by the partial DNA sequences of isolates from
tissues of dogs dying of CPV infection during 1978 and 1979.
All three capsid protein gene regions could be analysed from
viruses from five dogs (838}78, 1887}78, 1703}79, 2522}79
and 2645}79), and none was an intermediate between CPV
and FPV. In addition, in tissues from two further dogs (760}78
and 1788}79) only some regions could be amplified ; there was
also no indication of an intermediate status.
The virus sequences amplified from the canine tissues
suggested that most viruses were CPV type-2. However, three
CPV sequences from dogs infected in 1978 (dogs 838}78,
1788}78 and 1887}78) showed sequences in common with
the CPV-2a}2b virus (Fig. 2 a). This confirms the evidence from
previous phylogenetic analyses which indicated that the CPV2a strain derived from a common ancestor of the CPVs,
presumably prior to 1978 (Parrish et al., 1991 ; Truyen &
Parrish, 1995). Earlier studies from Parrish et al. (1988) also
reported a prevalence in Denmark of CPV-2a (121 of 125
isolates analysed from 1980).
If FPV vaccines were unlikely to be involved in the
emergence of CPV, and if a gradual accumulation of important
amino acids did not occur in dogs, where did the new canine
virus come from? CPV most likely emerged in Europe, as the
first serological and virological hints for the new virus come
from Greece, Belgium and France (Parrish, 1990). Few isolates
have been collected from wild carnivores, and the only fox
isolate available, isolated from a farmed Arctic (blue) fox
(Alopex lagus) from Finland, showed some indications of an
ancestral DNA sequence in terms of non-coding nucleotide
changes (Truyen et al., 1995 a). Recently, we were able to
amplify some limited parvovirus DNA sequences from the
ileum of a free-ranging red fox (Vulpes vulpes) from Germany.
That sequence showed an intermediate sequence character, as
amino acid 103 was the FPV sequence, while amino acids 80,
93 and 323 were the CPV sequence. The identity of amino acid
87 suggested that the virus was closer to the antigenic type
CPV-2 than CPV-2a or -2b (Truyen et al., 1998).
Although the exact mechanisms of the emergence of the
‘ new ’ virus CPV is still not resolved in detail, these data imply
that FPV vaccine strains were not ancestors of CPV ; rather,
viruses of other carnivores may have been the ancestors of
CPV. Our future studies will be aimed to further characterize
the epidemiology of feline parvoviruses in wild carnivores.
The skilful technical assistance of Gaby Platzer is gratefully
acknowledged. The work was supported by grants from the Deutsche
Forschungsgemeinschaft (Tr282}2-1) and the Gesellschaft fu$ r kynologische Forschung.
References
Berns, K. I., Bergoin, M., Bloom, M., Lederman, M., Muzyczka, N.,
Siegl, G., Tal, J. & Tattersall, P. (1995). Family Parvoviridae. In Virus
Taxonomy. Sixth Report of the International Committee on Taxonomy of
Viruses, pp. 169–178. Edited by F. A. Murphy, C. M. Fauquet, D. H. L.
Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D.
Summers. Vienna & New York : Springer-Verlag.
Chang, S.-F., Sgro, J. Y. & Parrish, C. R. (1992). Multiple amino acids
in the capsid structure of canine parvovirus coordinately determine the
canine host range and specific antigenic and hemagglutination properties.
Journal of Virology 66, 6858–6867.
Goto, H., Yachida, S., Sirahata, T. & Shimizu, K. (1974). Feline
panleukopenia in Japan. I. Isolation and characterization of the virus.
Japanese Journal of Veterinary Science 36, 203–211.
Horiuchi, M. (1997). Evolutionary pattern of feline panleukopenia virus
differs from that of canine parvovirus. Direct submission to GenBank,
December 1996.
Horiuchi, M., Yuri, K., Soma, T., Katae, H., Nagasawa, H. & Shinagawa,
M. (1996). Differentiation of vaccine virus from field isolates of feline
panleukopenia virus by polymerase chain reaction and restriction
fragment length polymorphism analysis. Veterinary Microbiology 53,
283–293.
McMaster, G. , Tratschin, J.-D. & Siegl, G. (1981). Comparison of canine
parvovirus with mink enteritis virus by restriction site mapping. Journal
of Virology 38, 368–371.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 14:31:44
BBFH
U. Truyen and others
Mochizuki, M., Konishi, S., Aijiki, M. & Akaboshi, T. (1989). Comparison
feline parvovirus subspecific strains using monoclonal antibodies against
feline panleukopenia virus. Japanese Journal of Veterinary Science 51,
264–272.
Mochizuki, M., Horiuchi, M., Hiragi, H., San Gabriel, M. C., Yasuda, N.
& Uno, T. (1996). Isolation of canine parvovirus from a cat manifesting
clinical signs of feline panleukopenia. Journal of Clinical Microbiology 34,
2101–2105.
Parrish, C. R. (1990). Emergence, natural history and variation of canine,
mink, and feline parvoviruses. Advances in Virus Research 38, 403–450.
Parrish, C. R. (1991). Mapping specific functions in the capsid structure
of canine parvovirus and feline panleukopenia virus using infectious
plasmid clones. Virology 183, 195–205.
Parrish, C. R. (1994). The emergence and evolution of canine parvovirus
– an example of recent host range mutation. Seminars in Virology 5,
121–132.
Parrish, C. R. & Carmichael, L. E. (1983). Antigenic structure and
variation of canine parvovirus type 2, feline panleukopenia virus, and
mink enteritis virus. Virology 129, 401–414.
Parrish, C. R., O’Connell, P. H., Evermann, J. F. & Carmichael, L. E.
(1985). Natural variation of canine parvovirus. Science 230, 1046–1048.
Parrish, C. R., Have, P., Foreyt, W. J., Evermann, J. F., Senda, M. &
Carmichael, L. E. (1988). The global spread and replacement of canine
parvovirus strains. Journal of General Virology 69, 1111–1116.
Parrish, C. R., Aquadro, C. F., Strassheim, M. L., Evermann, J. F., Sgro,
J.-Y. & Mohammed, H. O. (1991). Rapid antigenic-type replacement and
DNA sequence evolution of canine parvovirus. Journal of Virology 65,
6544–6552.
Schofield, F. W. (1949). Virus enteritis in mink. North American
Veterinarian 30, 651–654.
Schunck, B., Kraft, W. & Truyen, U. (1995). A simple touchdown PCR
for the detection of canine parvovirus and feline panleukopenia virus in
feces. Journal of Virological Methods 55, 427–433.
Siegl, G. (1984). Canine parvovirus. Origin and significance of a new
BBFI
pathogen. In The Parvoviruses, pp. 363–387. Edited by K. Berns. New
York : Plenum Press.
Swofford, D. L. (1993). PAUP–phylogenetic analysis using parsimony.
Center for Biodiversity, Illinois Natural History Survey, Champaign,
Illinois, USA.
Tratschin, J.-D., McMaster, G. K., Kronauer, G. & Siegl, G. (1982).
Canine parvovirus : relationship to wild-type and vaccine strains of feline
panleukopenia virus and mink enteritis virus. Journal of General Virology
61, 33–41.
Truyen, U. & Parrish, C. R. (1995). The evolution and control of
parvovirus host ranges. Seminars in Virology 6, 311–317.
Truyen, U., Platzer, G., Parrish, C. R., Ha$ nichen, T., Hermanns, W. &
Kaaden, O.-R. (1994). Detection of canine parvovirus DNA in paraffin-
embedded tissue sections by the polymerase chain reaction. Journal of
Veterinary Medicine Series B 41, 148–152.
Truyen, U., Gruenberg, A., Chang, S.-F., Veijalainen, P., Obermaier, B.
& Parrish, C. R. (1995 a). Evolution of the feline subgroup parvoviruses
and the control of the canine host range. Journal of Virology 69,
4702–4710.
Truyen, U., Evermann, J. F., Vieler, E. & Parrish, C. R. (1995 b).
Evolution of canine parvovirus involved loss and gain of the feline host
range. Virology 215, 186–189.
Truyen, U., Mu$ ller, T., Platzer, G., Heidrich, R., Tackmann, K. &
Carmichael, L. E. (1998). Serological survey on viral pathogens in free-
ranging foxes in Germany with emphasis on feline parvoviruses and
DNA sequence analysis of a red fox parvovirus. Epidemiology and Infection
(in press).
Wright, D. K. & Manos, M. M. (1990). Sample preparation from paraffinembedded tissues. In PCR Protocols. A Guide to Methods and Applications,
pp. 153–158. Edited by M. H. Innis, D. H. Gelfand, J. J. Sninsky & T. J.
White. Sydney, Australia : Academic Press.
Received 11 November 1997 ; Accepted 12 January 1998
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 14:31:44