Download - Wiley Online Library

DEVELOPMENTAL DYNAMICS 236:2993–3006, 2007
RESEARCH ARTICLE
Rab23 GTPase Is Expressed Asymmetrically in
Hensen’s Node and Plays a Role in the
Dorsoventral Patterning of the Chick Neural
Tube
Naixin Li,1† Jean-Nicolas Volff,2,3 and Andrea Wizenmann*1,4,‡
The mouse Rab23 protein, a Ras-like GTPase, inhibits signaling through the Sonic hedgehog pathway and
thus exerts a role in the dorsoventral patterning of the spinal cord. Rab23 mouse mutant embryos lack
dorsal spinal cord cell types. We cloned the chicken Rab23 gene and studied its expression in the developing
nervous system. Chick Rab23 mRNA is initially expressed in the entire neural tube but retracts to the dorsal
alar plate. Unlike in mouse, we find Rab23 in chick already expressed asymmetrically during gastrulation.
Ectopic expression of Rab23 in ventral midbrain induced dorsal genes (Pax3, Pax7) ectopically and reduced
ventral genes (Nkx2.2 and Nkx6) without influencing cell proliferation or neurogenesis. Thus, in the
developing brain of chick embryos Rab23 acts in the same manner as described for the caudal spinal cord
in mouse. These data indicate that Rab23 plays an important role in patterning the dorso-ventral axis by
dorsalizing the neural tube. Developmental Dynamics 236:2993–3006, 2007. © 2007 Wiley-Liss, Inc.
Key words: Rab23; GTPase; dorsoventral patterning; neural tube; chick
Accepted 14 August 2007
INTRODUCTION
During early development of the neural tube, signaling along the dorsoventral (DV) axis plays a prominent role
in establishing cell type diversity.
Morphogens like sonic hedgehog (Shh)
and members of the family of transforming growth factors (TGF␤) and
Wnts (wingless related mouse mammary tumor virus integration site proteins) have emerged as the inductive
signals involved in DV patterning of
the neural tube. In chick, Shh signals
from the notochord induce formation
of the floor plate (Yamada et al., 1991;
Chiang et al., 1996). Subsequent Shh
expression in the floor plate generates
a ventral-dorsal activity gradient of
Shh that promotes the specification of
a series of ventral cell types (Marti et
al., 1995; Ericson et al., 1997b; Briscoe
and Ericson, 2001). Dorsal neural
tube patterning might proceed analogously, but it is not as well understood
as ventral patterning. It is known that
signals from the surface ectoderm
1
specify the roof plate cells (Dickinson
et al., 1995; Liem et al., 1995), and by
analogy to the floor plate the roof plate
provides the signals to specify the dorsal cell types of the neural tube in
chick and mouse (Liem et al., 1997;
Lee et al., 2000; Millonig et al., 2000;
Chizhikov and Millen, 2004; Millen et
al., 2004). Different members of the
TGF␤ and Wnt family are expressed
in the roof plate and have been suggested to induce different dorsal interneurons (for review, see: Lee and Jes-
University of Würzburg, JRG Developmental Neurobiology, Würzburg, Germany
Department of Physiological Chemistry I, Biocenter, University of Würzburg, Würzburg, Germany
3
Ecole Normale Supérieure de Lyon, Institute of Functional Genomics, Lyon, France
4
GSF National Research Center for Environment and Health, Institute for Stem Cell Research, Neuherberg, Germany
Grant sponsor: Volkswagenstiftung; Grant sponsor: SFB 465 (DFG).
†
Naixin Li’s present address is Department of Neurosurgery,Tianjin Medical University General Hospital, Tianjin, P.R. China.
‡
Andrea Wizenmann’s present address is Institute of Anatomy, University of Tübingen, Germany.
*Correspondence to: Andrea Wizenmann, Institute of Anatomy, University of Tübingen, Österbergstrasse 3, 72074 Tübingen,
Germany. E-mail: [email protected]
2
DOI 10.1002/dvdy.21331
Published online 5 October 2007 in Wiley InterScience (www.interscience.wiley.com).
© 2007 Wiley-Liss, Inc.
2994 LI ET AL.
sell, 1999; Caspary and Anderson,
2003; Chizhikov and Millen, 2005;
Wilson and Maden, 2005; Zhuang and
Sockanathan, 2006). The balance between differentiation and proliferation seems to be regulated by a
crosstalk between Wnt and Bmp signaling (Chesnutt et al., 2004; Ille et
al., 2007). However, the precise roles
and interactions of the members of
these two signaling families are still
not very well understood. Obviously, a
morphogen model for the dorsal neural tube might not be as simple as in
the ventral neural tube since the roof
plate produces more than one patterning molecule.
Ventral and dorsal signals have
been suggested to be antagonistic and,
thus, the interplay between the two
types of signals is likely required for
the final dorsoventral pattern. Ventral specific genes are repressed by
Bmp signaling (Barth et al., 1999;
Nguyen et al., 2000; Timmer et al.,
2002) and Shh signaling represses the
expression of several genes that are
required for dorsal neural development (Goulding et al., 1993b; Liem et
al., 1995; Chiang et al., 1996; Ericson
et al., 1996; Tremblay et al., 1996;
Briscoe et al., 2000; Aruga et al.,
2002). The range of action of both Shh
and Bmp signaling seems to extend
throughout the neural tube (McMahon et al., 1998; Towers et al., 1999;
Liem et al., 2000; Briscoe et al., 2001;
Patten and Placzek, 2002). However,
the activity of Bmps and Shh is actively antagonized in the ventral or
dorsal neural tube, respectively. Ventrally, notochord-derived Bmp antagonists generate a permissive environment for the Shh-mediated induction
of ventral spinal cord cell types (McMahon et al., 1998; Towers et al.,
1999; Liem et al., 2000; Patten and
Placzek, 2002). In the dorsal neural
tube, it is the transcription factor Gli3
that acts primarily to repress hedgehog signaling (Ruiz i Altaba, 1998).
There is also growing evidence that
complex
intracellular
trafficking
might play a role in morphogen distribution in a number of tissues (Piddini
and Vincent, 2003; Wang et al., 2006)
and specifically in regulating Shh signaling in the dorsal neural tube.
Rab23, a member of the Rab family of
GTPase proteins that are involved in
vesicular transport, has been shown
to negatively regulate the Shh pathway in dorsal neural cell types at a
point downstream of Ptc1 and smoothened (Eggenschwiler et al., 2001). A
spontaneous and an ENU-induced
mutation (open brain, Opb) in the
Rab23 gene (Gunther et al., 1994;
Sporle et al., 1996; Sporle and
Schughart, 1997) cause defects in
brain, spinal cord and spinal ganglia,
epaxial muscle, eyes, and limbs. The
opb mutant shows exencephaly in all
brain regions due to a failure of neural
tube closure. However, only in the spinal cord roof plate, dorsal cell types
are absent and ventral cell markers,
including Shh, expand into dorsal regions (Gunther et al., 1994; Sporle et
al., 1996; Eggenschwiler and Anderson, 2000). Such defects are characteristics of overactive Shh signaling like
in Gli3 mutants (Litingtung and
Chiang, 2000; Persson et al., 2002; Wijgerde et al., 2002). Double mutant
mice for opb and Shh not only rescue
the reduced size of the single Shh mutant embryos, but also all ventral cell
types, while dorsal cell types are still
missing as in the single opb mutant
(Eggenschwiler et al., 2001). Taken together, Rab23 inhibits signaling of
Shh intracellularly and establishes
the basis for the development of dorsal
cell types in the mouse embryo, perhaps in concert with Gli3.
In this study, we describe and compare the expression of chick Rab23
during development with the pattern
in mouse embryos. As in mouse,
Rab23 is initially expressed throughout the neural tube and retracts later
to the dorsal half of the neural tube.
Interestingly, we found Rab23 asymmetrically expressed on the right side
of the primitive streak and Hensen’s
node at stage 4 of development opposite to the Shh expression. Overexpression of Rab23 in ventral midbrain
resulted in the expression of the dorsal genes Pax3 and Pax7 in these areas. Rab23 overexpression in the dorsal midbrain did not affect the rate of
proliferation of neuronal precursors or
the differentiation of the first neurons.
These results support a role of Rab23
as negative regulator of the Shh pathway in the dorsal neural tube of chick
embryos to enable the expression of
dorsal specific genes, similar to mouse
development.
RESULTS
Isolation and Analysis of the
Chick Rab23
Using the mouse Rab23 cDNA sequence
(NM 008999) as a query, eleven clones
were found in the BBSRC Chick EST
Database Bank (http://www.chick.
umist.ac.uk). Alignment of four of these
clones (ChEST75d14, ChEST545g23,
ChEST885j22, ChEST925k6) provided
the cDNA sequence of Rab23 with
1,706 nucleotides including 5 prime
and 3 prime untranslated regions
(Fig. 1). The deduced chicken 237 aa
Rab23 GTPase sequence is encoded by
a 711-bp open reading frame with a
start codon at position 151 and a stop
codon at position 864. In the 3 prime
UTR, two AT-rich elements (ATTTA)
were identified, which might be involved in mRNA degradation (Chen
and Shyu, 1995). BLAST analysis of
the draft of the chicken genome
(http://www.ncbi.nlm.nih.gov/genome/
seq/GgaBlast.html) using the cDNA
sequence as a query revealed that the
Rab23 consists of seven exons (six coding exons) and is located on chromosome 3.
The amino acid sequence of Rab23
reveals characteristic features of
small G proteins. It contains four conserved regions involved in GTP binding and hydrolysis (Fig. 1; designated
in yellow), the conformational switch
between a GTP- and GDP-bound
state, a Cys-containing C-terminal
motif (boxed in Fig. 1), membrane association sequences and an unusually
long carboxyterminal tail (underlined
in Fig.1; Olkkonen et al., 1994; Paduch et al., 2001; Pereira-Leal and
Seabra, 2001). The four highly conserved domains (Fig. 1, marked in yellow) and the effector domain (Fig. 1;
marked in blue) locate to the five
polypeptide loops (G1 to G5). The domain in the G2 loop (the effector loop
or switch I region) is the interacting
site for effectors and GTPase-activating protein (GAP). The G1 loop (also
called P-loop, aa 16-23, yellow in Fig.
1) is responsible for the binding of alpha or beta-phosphate groups of nucleotides. The G3 loop or Switch II
region (aa 63– 69; yellow in Fig. 1) provides residues for the binding of Mg2⫹
and for gamma-phosphate. The consensus region is DXXG (Amor et al.,
RAB23 IN CHICK NEURAL TUBE 2995
Fig. 1. cDNA and deduced amino acid sequence of chick Rab23 (GenBank accession number EU176872). Start and stop codons are indicated by
double-underlining. The AU-rich elements and the carboxyterminal tail are underlined. The four highly conserved domains are marked in yellow. The
sequence corresponding to the effector domain is marked in blue and the post-translational modification domain is boxed. The amino acid sequence
is shown in single code letters beneath the cDNA sequence.
2996 LI ET AL.
1994). The guanine base is recognized
by the G4 and G5 loops. The G4 loop
(VQNKID) locates at position 119 –124.
The consensus sequence NKXD of G4
loop contains lysine (K) and aspartic
acid (D) residues directly interacting
with the nucleotides and is also called
the recognition loop (Zhong et al.,
1995; Sprang, 1997). The fourth conserved domain (RASVKE; aa 149 –154)
lies in the G5 loop, which is a recognition site for guanine bases. The consensus sequence is (RE) –x-S-V (Sprang,
1997). Switch I and Switch II regions
surround the gamma-phosphate group
of the nucleotide (Paduch et al., 2001).
Switch I and Switch II stretches undergo structural changes upon GTP
binding and hydrolysis. The Switch III
region is absent in this small G-protein
(Gilman, 1987). A Cys-containing motif
(CSIP) locates in the C-terminus. The
sequence pattern is generally known as
the CAAX box (A-aliphatic aa) in Raslike proteins, which is conserved and
provides a prenyl-group binding site for
the posttranslational prenylation modifications by the attachment of either a
farnesyl or a geranyl group to a cysteine
residue when Ras-like proteins are required for the membrane association
(Newman and Magee, 1993; Leung et
al., 2007). A striking feature of the
Rab23 sequence is the exceptional
length of the C-terminal tail, which is
significantly longer than that of other
Rab members. This hypervariable
C-terminal domain of Rab proteins is
thought to be a targeting signal crucial
for specific membrane association
(Chavrier et al., 1991).
Sequence comparison of the chick
Rab23 sequence with Rab23 proteins
from other animals revealed a very
high homology (Fig. 2). All five
polypeptide loops (G1–G5) containing
the different binding site regions are
highly conserved between the different vertebrate groups and even in
Drosophila. The phylogenetic analysis
(Fig. 3) confirmed the identity of the
chick sequence as a bona fide Rab23
protein with orthologues in mammals,
fish, amphibians, and insects.
Rab23 Expression During
Early Chick Embryogenesis
Expression of the Rab23 gene was initially detected at stage 4 in chick embryos, when the primitive streak is at
its full posterior to anterior extension
during the process of gastrulation
(Fig. 4). At stage 4, Rab23 mRNA was
found in Hensen’s node and primitive
streak along the primitive groove (Fig.
4A). This expression was sustained
until stage 7 when node and primitive
streak begin to regress posteriorly
(Fig. 4B–D). Initially, epiblast (epidermis) and the newly forming mesoderm
expressed
Rab23
(Fig.
4E–G),
whereby Rab23-positive cells were located basally in the epidermis (Fig.
4H,L). At stage 7, Rab23 was expressed in the caudal mesoderm underlying the neural plate (Fig. 4S,T).
In the forming brain region, mesoderm and the entire neural tube expressed Rab23 (Fig. 4D,R,U,V).
Interestingly, between stage 4 and
7, Rab23 was asymmetrically expressed in Hensen’s node and the anterior primitive streak with a stronger
bias to the right lip (Fig. 4A–C,F,G,J,
K,N,O). At these stages, Hensen’s
node shows an asymmetric morphology with a steep right boundary at
stage 4 and a significant bulge of the
right side at stage 7 (Fig. 4F,J,N,S;
Viebahn, 2001; Dathe et al., 2002).
Rab23 expression in Hensen’s node
and primitive streak weakened from
stage 4 to 6 and was almost absent at
stage 7 (Hensen’s node: Fig. 4A–
D,F,J,N,S; primitive streak: Fig. 4A–
D,G,K,O,T), while neural plate expression increased (Figs. 4D, 5) and
expression in the mesenchyme was
sustained. Somites exhibited Rab23
expression from stage 15 onwards
(Fig. 5M–P), where the expression became more and more restricted to the
dermamyotome.
Rab23 expression was also detected
in the head process (Fig. 4B,C,I).
These mesodermal (chordamesoderm)
cells rostral to Hensen’s node were
shown to form an anterior notochord
and prechordal instead to form notochord and prechordal plate (Fig. 4Q,V;
Psychoyos and Stern, 1996). Rab23
expression in the notochord was visible up to stage 13 (Fig. 5E,M).
Rab23 mRNA Expression in
the Neural Tube
In the forming neural plate, Rab23
expression was first detected at stage
6 (Fig. 4C,Q), anterior to Hensen’s
node. Anterior to the head fold, the
epidermis also expressed Rab23 (Fig.
4M), whereas posterior to Hensen’s
node it mainly located to the underlying mesoderm (Fig. 4O). Rab23 neural
plate expression became strong in the
rostral neural fold at stage 7 (Fig.
4D,R,U,V), but not in neural crest and
epidermis cells (Fig. 4M,R,V). During
the formation of brain vesicles (stages
9 –12), the entire neural tube expressed diffusely Rab23 (Fig. 5A,E,
I,M,Q,R). Open book preparations of
midbrain and spinal cord at stage 11
showed Rab23 expression along the
entire dorso-ventral axis with a
weaker expression in the floor plate
and the roof plate (Fig. 5A,I). Rab23
expression retreated gradually from
the ventral neural tube over the next
five stages (Fig. 5B–D,F,J–L,S). From
stage 18 onwards, the entire neural
tube displayed Rab23 expression in
the alar plate sparing the narrow
stripe of the roof plate as seen in the
example of midbrain and spinal cord
(Fig. 5D,F,L,N). This pattern was still
observed up to embryonic day 6 (Fig.
Fig. 2. Sequence comparison of Rab23 proteins. Identical residues are white on black,
conservative substitutions are black on grey.
Accession numbers are given in the legend of
Figure 3. The highly conserved domains are
marked in yellow, the effector domains in blue,
and the post-translational modification domain
is boxed.
Fig. 4. Expression pattern of Rab23 in chick
embryos from stage 4 to 7. A–D: The dorsal
view of chick embryos shows that initially,
Rab23 was strongly expressed in Hensen’s
node and primitive streak (A–C) but weakened
towards stage 7 (D). At stage 5 (B), Rab23 became evident in the head process and was still
present in the neural fold at stage 7 (D). The
border between area opaca and pellucida is
indicated as dashed line (A,B). E–V: Transverse
sections (20 ␮m) through embryos in A–D.
Black arrows and the letters indicate the level of
the sections in the corresponding figures. The
strong asymmetric expression of Rab23 in the
right lip of Hensen’s node in ectoderm and
mesoderm at stage 4 (F,H) and 5 (J) weakened at stage 6 (N) and disappeared completely in ectoderm at stage 7 (S). In the head
process, Rab23 was evident in mesoderm
and ectoderm (E,I,M,R). Higher magnification
images (H,L,P,Q,U,V) of Hensen’s node (F),
head process (M), and neural plate (R) show
Rab23 expression in ectoderm and underlying mesoderm (separated by a line in H,L), the
forming chordamesoderm (Q,V), but not in
neural crest cells and epidermis (R,V). Scale
bars ⫽ (A–D), 500 ␮m; (E–G, I–K, M–O, R–T)
100 ␮m; (H, L, P, Q, U, V) 25 ␮m.
Fig. 2.
Fig. 3. Phylogenetic analysis of Rab23 proteins. Analysis was performed on an alignment of 192
amino acids using the neighbour-joining method (Saitou and Nei, 1987; 1,000 pseudosamples;
bootstrap values are given). This topology was also supported by other methods of analysis (data
not shown). Branches with less than 50% support have been collapsed. Accession numbers:
Rab23: Anopheles gambiae (African malaria mosquito) XP_309942; Canis familiaris (dog)
XP_538975; Drosophila melanogaster (fruit fly) NP_649574; Gallus gallus (chicken) XP_419896;
Homo sapiens (human) NP_899050; Mus musculus (house mouse) AAH25578; Pan troglodytes
(chimpanzee) XP_527422; Rattus norvegicus (Norway rat) XP_346034; Tetraodon nigroviridis
CAG09432; Xenopus laevis (African clawed frog) AAH75188; Trypanosoma cruzi (trypanosome)
AAC32778. Rab7: Caenorhabditis elegans (nematode) NP_496549; Drosophila melanogaster (fruit
fly) NP_524472; Homo sapiens (human) AAA86640. Rab3: Caenorhabditis elegans (nematode)
AAK68195; Drosophila melanogaster (fruit fly) BAD07037; Homo sapiens (human) NP_002857 (a),
D34323 (b), AAK08968 (c).
Fig. 4.
2998 LI ET AL.
Fig. 5. Rab23 mRNA expression pattern in chick neural tube. A–P: Rab 23 expression in chick midbrain (A–D), and spinal cord (I–L) in “open-book”
preparations (anterior up) and transverse sections (E–H,M–P; dorsal up). Rab23 was strongly expressed in entire midbrain and spinal cord at stage 11
(A,I) and 13 (B,E,J,M). The expression gradually retreated from ventral neuroepithelium in both regions (C, D,F–H,K,L,N–P). From stage 18 onwards,
Rab23 was exclusively expressed in the alar plate except for the roof plate (D,G,H,L,O,P,S). Rab23 was also expressed in notochord (E,M) and somites
(N–P) but disappeared later in the notochord (F,N). Black dashed lines indicate positions of floor plate and roof plate. Arrows in C,D indicate
mesencephalon-diencephalon and midbrain-hindbrain boundaries. Q–S: Rab23 expression in whole embryos at stage 8, 12, and 21. T: Parasagittal
section through the eye at stage 23 showed Rab23 expression in the ventricular layer of the retina. Di, diencephalon; FP, floor plate; ME,
mesencephalon; MHB, midbrain-hindbrain boundary; MDB, mesencephalon-diencephalon boundary, N, notochord; PE, prosencephalon; RE,
rhombencephalon; RP, roof plate; S, somite; SC, spinal cord; TE, telencephalon. Scale bar ⫽ 100 ␮m (A–P, R).
RAB23 IN CHICK NEURAL TUBE 2999
5G,H,O,P,S and data not shown). The
ventricular site of the retinal neuroepithelium also expressed Rab23. Since
this area gives rise to retinal ganglion
cells, Rab23 might label the layer of
the retinal ganglion cells (Fig. 5T).
Misexpression of Rab23 in
the Midbrain
To investigate the role that Rab23
plays in dorsoventral patterning of the
neural tube, we misexpressed Rab23
in the lateral and ventral neural tube
of the midbrain. Chick embryos were
electroporated with a plasmid containing chick Rab23 and IRES-GFP or
one containing GFP as control (pMES
and pCAX) (Swartz et al., 2001) at
stage 9 –14 and incubated for 20 or 36
hr (e.g., Fig. 6A). The efficiency of electroporation was monitored by GFPimmunostaining. In situ hybridization
for Rab23 mRNA confirmed the colocalisation of Rab23 and GFP (Fig. 6A–
C). Pax7, Pax3, Nkx6.1, and Nkx2.2
were used as marker genes for dorsal
and ventral midbrain regions, respectively. Ventral midbrain cells, which
ectopically expressed Rab23, also expressed the normally dorsally located
Pax3 mRNA or Pax7 protein when the
neural tube was transfected at stage 9
or 10 (Pax3: Fig. 6D–E’, n ⫽ 6/8; Pax7:
Fig: 6F–H, n ⫽ 11/11). Electroporation
with Rab23-pMES-GFP at stage 12 or
later never resulted in an ectopic Pax7
or Pax3 expression in the ventral midbrains (n ⫽ 4/4, and n ⫽ 6/6, respectively; Fig. 6I–K). Transfection of GFP
alone in ventral or dorsal midbrain
also never induced Pax3 or Pax7 ectopically (n ⫽ 6/6 and n ⫽ 8/8, respectively). However, single cells normally
expressing Nkx2.2 or Nkx6.1 in the
midbrain were affected upon ectopic
expression of Rab23 at stage 9 and 10
(Fig. 7A–G). Nkx2.2 protein and
Nkx6.1 mRNA expression were downregulated in many cells co-expressing
Rab23-GFP (arrowheads in Fig. 7A–D
n ⫽ 9/10; and 7E,F, n ⫽ 8/8; respectively). Electroporation with Rab23pMES-GFP at stage 11 or later
(Nkx2.2: n ⫽ 5/5, Nkx6.1 n ⫽ 6/6) or
with GFP alone (Nkx2.2: n ⫽ 4/4;
Nkx6.1: n ⫽ 3/3) never resulted in a
loss of Nkx2.2 and Nkx6.1 expression
in any ventral cells ectopically expressing Rab23 (Fig. 7H–J). Thus,
electroporation of Rab23-pMES-GFP
but not of pMES-GFP resulted in ectopic Pax3 and Pax7 expression and a
reduction of Nkx2.2 and Nkx6.1 in
ventral midbrain cells but only when
the embryos were electroporated before stage 12 or stage 11, respectively.
These results suggest that during a
particular time window, ectopic
Rab23 in ventral midbrain induced or
facilitated the expression of specific
dorsal genes and reduced the expression of specific ventral genes.
Since in opb mutants, dorsal cell
types are never specified and cells expressing ventral markers occupy expanded domains (Gunther et al., 1994;
Sporle et al., 1996; Kasarskis et al.,
1998), we investigated whether Rab23
is involved in proliferation or has a
direct effect on neurogenesis in the
dorsal neural midbrain. We compared
the amount of proliferating cells per
area in ventral and dorsal midbrain
transfected either with Rab23-GFP or
with GFP alone. Proliferating cells
were labelled with an antibody
against phosphorylated Histone 3 (pH
3; Fig. 8A,B). Misexpression of Rab23pMES-GFP or pMES-GFP in ventral
and dorsal midbrain showed GFP expression in single proliferating cells.
However, the vast majority of proliferating cells was GFP-negative (Fig.
8A,B). The analysis of the proliferation rate per area did not show any
significant increase in the region of
strong Rab23- pMES-GFP expression
compared to pMES-GFP-transfected
midbrains (Fig. 8C). Ectopic pMESGFP in ventral midbrain resulted on
average in 0.43% less proliferating
cells compared to uninjected brains
(n ⫽ 3). Ectopic Rab23-pMES-GFP in
ventral midbrain showed an average
of 0.82% more proliferating cells
(n ⫽ 4). In dorsal midbrain, ectopic
pMES-GFP produced around 1%
more proliferating cells (0.98%, n ⫽
4), and misexpressed Rab23-pMESGFP around 2% (2.27%; n ⫽ 4) more
proliferating cells compared to uninjected regions. None of these values
indicated a significant alteration
(compare standard deviations of the
means in Fig. 8C). This result suggests that Rab23 does not influence
the cell cycle in the midbrain and
very likely also not in the rest of the
neural tube.
The first neurons generated in the
dorsal midbrain later form the mesen-
cephalic trigeminal nucleus (MTN)
(Chedotal et al., 1995; Hunter et al.,
2001). These neurons express the Lim
transcription factor Islet 1/2 and can
be stained with an antibody against
medium weight neurofilament (RMO270). Comparing the development of
MTN neurons stained with either
RMO-270 or Islet 1/2 did not reveal
any obvious rise in neurons in the Rab
23–injected dorsal midbrains compared to the control side (Fig. 9; RMO270 n ⫽ 10, Islet 1/2 n ⫽ 4). Although
Islet 1/2 is expressed in the ventral
midbrain by neurons of the nucleus
oculomotorius, we never observed ectopic Islet1/2-positive cells in ventral
midbrain upon ectopic Rab23-pMESGFP expression (data not shown).
These data propose that Rab23 does
not exert any influence on the rate of
proliferation or neurogenesis in the
dorsal midbrain but rather has an influence on the regionalisation of the
DV axis of the midbrain and very
likely also on the remaining neural
tube.
Induction of Rab23 by Bmp4
To investigate a regulation of Rab23
by the dorsally expressed morphogen
Bmp4, we overexpressed Bmp4 in the
dorsal midbrain (Fig. 10A). Misexpression of Bmp4 at late stage 8 and
stage 9 resulted in a strong expression
of Rab23 in the dorsal midbrain and
an ectopic expression in the ventral
midbrain (Fig. 10B, n ⫽ 6/7). Misexpression of GFP alone or of Bmp4 after stage 10 showed no induction of
Rab23 in any part of the midbrain
(n⫽4/4 and n ⫽ 5/5). These results
suggest that BMP4 is involved in the
induction of Rab23 in the dorsal midbrain early in development.
DISCUSSION
In this study, we present evidence
that the chicken Rab23 gene, encoding
a member of the large family of GTPhydrolysing enzymes (GTPases), is
highly conserved during evolution and
includes all the canonical motifs required for guanine nucleotide binding,
GTP hydrolysis, membrane association, and the conformational switch
between the GTP- and GDP bound
state (Olkkonen et al., 1994; Ostermeier and Brunger, 1999; Pereira-
Leal and Seabra, 2001). Rab23 is a
relatively divergent Rab protein with
an unusually long carboxy-terminal
tail (Olkkonen et al., 1994). We also
document the expression of Rab23 in
the early chick embryo. Ectopic misexpression of Rab23 proposes an important role for Rab23 in dorsoventral
patterning of the entire neural tube.
The asymmetric expression of Rab23
in Hensen’s node and primitive streak
suggests that Rab23 might be involved in the establishment of leftright asymmetry during chick gastrulation.
Fig. 6.
Fig. 7.
Fig. 6. Ectopic Rab23 in the midbrain induces
Pax3 and Pax7. Embryos were electroporated
with Rab23-pMES-GFP at stage 10 (A–H) or
stage 12 (I–K) and fixed at stages 17/18.
A–C: Midbrain open book preparation stained
for GFP protein (brown) and Rab23 mRNA
(blue). Many cells expressing GFP (A, B; indicated by arrows) were labelled with Rab23
mRNA (A,C). GFP staining (B) was separated
from Rab23 labelling by colour deconvolution
using ImageJ (C). Arrowheads delineate an axons that originated from a double-labelled cell
(grey outlined arrow). D,E: Midbrain open book
preparations that ectopically expressed Rab23GFP (D, green cells to the right) and was stained
for Pax3 (D’, blue) and Nkx6.1 mRNA (D’, red).
Higher magnification of the boxed areas in D’ at
the left (E) and the right (E’) indicated cells in the
ventral midbrain ectopically expressing Pax3
upon Rab23 misexpression (arrowheads).
F–H: Ventral midbrain cells ectopically expressing Rab23 pMES-GFP in a transverse section
(F, green cells) also expressed Pax7 ectopically
(G, red cells). H shows an overlay of F and G.
Arrowheads indicate the DV boundary of Pax7.
I–K: Midbrain open book preparation that
showed no ectopic Pax7 in the ventral midbrain
(J) upon Rab23-pMES-GFP electroporation at
stage 12 (I). Arrows indicate the area of the GFP
positive cells in (I). I and J are overlaid in K. FP,
floor plate; MHB, midbrain-hindbrain boundary;
RP, roof plate. Scale bars ⫽ 100 ␮m.
Fig. 7. Effect of Rab23 on Nkx gene expression.
Embryos were electroporated with Rab23pMES-GFP (A–G) or pCAX (H–J) at stage 9 and
fixed at stage 15 (A–D) or 17 (E–J). All pictures
are open book preparations with anterior up.
A–D: The amount of Nkx2.2-positive cells (A,C;
red cells) was reduced upon ectopic Rab23GFP misexpression (B,D; green cells). Higher
magnification and an overlay of A and B of the
boxed area in A are shown in C and D.
E–G: Arrows in E and F indicate the ectopic
expression of Rab23-GFP (F, green cells) in
ventral midbrain that reduced Nkx6.1 expression (E, blue). G is an overlay of the pictures in
E and F. H–J: The amount of Nkx2.2 expressing
cells (I) was not reduced upon ectopic GFP
expression in the ventral midbrain (H,J). FP,
floor plate; MHB, midbrain-hindbrain boundary.
Scale bars ⫽ 100 ␮m.
The Tissue- and RegionSpecific Expression Pattern
of Rab23
Our expression analysis of Rab23
mRNA showed a very early expression
during gastrulation in the epidermis
and mesoderm layers in the region of
the primitive streak and Hensen’s
node (stage 4 and 5). At stage 6, Rab23
mRNA can be seen in the neural ectoderm but not in the non-neuronal ectoderm. At stage 7, its expression in
the neural plate is confined to the anterior portion but it rapidly spreads
posteriorly in later stages. Rab23 is
initially expressed throughout the
neural tube, but its expression be-
Fig. 8
Fig. 9.
Fig. 8. Rate of proliferation in the midbrain upon
Rab23 overexpression. A,B: Open book preparations of ventral (A) and dorsal (B) midbrain
electroporated with Rab23-pMES-GFP (green)
at stage 9, fixed at stage 17 followed by immunohistochemical detection of mitotic cells with
pH3 (red). Arrows point to cells labelled with
both, Rab-GFP and pH3. C: The percentage of
mitotic cells of the GFP-positive cells (see Experimental Procedures section) upon electroporation with pMES-GFP or Rab23-pMESGFP. No significant change in the average
number of mitotic cells in ventral in dorsal midbrain upon ectopic Rab23 expression was discovered. Scale bar ⫽ 100 ␮m.
Fig. 9. Rab23 overexpression has no influence
on the development of mesencephalic trigeminal neurons (MTN). All embryos were electroporated at stage 10 and fixed at stage 17 (A,B) or
stage 15 (C–F). GFP was visualized with green
fluorescence, Islet1/2 and RMO-270 (neurofilament) with red. A,B: Midbrain open book preparation revealed no obvious difference in the
pattern of the neurofilament labelling of MTN
neurons (A) between control side (left) and
Rab23-GFP injected side (right). B: Overlay of
Rab23-GFP expressing cells and the RMO-270
stained neurons in A. Anterior is up. C–E: A
transverse section showed that Islet 1/2 positive cells (E) emerged on both sides of the midbrain lateral to the roof plate (arrowheads) without any obvious difference between control
side (left) and Rab23-GFP overexpressing side
(right, C). F shows an overlay of C and E. Dorsal
is up. FP, floor plate; ICN, interstitial nucleus of
Cajal, RP, roof plate; LLF. lateral longitudinal
fascicle; MLF, medial longitudinal fascicle;
MTN, mesencephalic trigeminal nucleus. Scale
bars ⫽ 100 ␮m.
Fig. 10. Ectopic Bmp4 induces Rab23. A,B: Ectopic expression of Bmp4 (green cells to the right
in A) at stage 9 resulted in an induction of ectopic
Rab23 in ventral and dorsal midbrain (B) at stage
15. The dorso-ventral boundary is indicated with
a dotted line. FP, floor plate; RP, roof plate. Scale
bars ⫽ 100 ␮m.
Fig. 10.
3002 LI ET AL.
comes confined to the dorsal half of
the neural tube at around stage 18
excluding the roof plate. At around the
same time, Rab23 can be seen in
somites. This expression pattern correlates with the expression of mouse
Rab23 mRNA, which is present at low
levels in most tissues and at high levels in the spinal cord, somites, limb
buds, and cranial mesenchyme (Eggenschwiler et al., 2001). Mouse Rab23
is also initially expressed in the entire
neural tube but localizes to the dorsal
half of the neural tube excluding the
roof plate at embryonic day 10 (E10)
(Caspary and Anderson, 2003). We did
not observe any expression of Rab23
in the cranial mesenchyme or limb
buds at the stages we analysed. Mouse
E10 correlates roughly with stage 18
to 23 in chick. Thus, Rab23 might appear later in the limb buds and the
cranial mesenchyme or there might be
another member of Rab23 in chick embryos, which is expressed in these
structures. In contrast to chick, mouse
Rab23 seems not to be expressed during gastrulation, which is also mirrored by the mutant phenotype of
Rab23 (Gunther et al., 1994). This
might indicate a difference in early
development between mammals and
birds. It will be interesting to know
where Rab23 is expressed in other
vertebrates to see if this early expression of Rab23 is specific for birds.
As in mouse, chick Rab23 mRNA
expression is similar to that of Gli3
(Schweitzer et al., 2000). Gli3 in chick
embryos is initially restricted to the
anterior portion of the neural plate
similar to Rab23. However, Gli3 is already strongly expressed in the neural
plate at stage 5, which is one stage
before Rab23 becomes expressed
(Schweitzer et al., 2000). Like Rab23
in the mouse and chick embryos, Gli3
is initially expressed throughout the
neural plate and subsequently becomes restricted to the dorsal neural
tube, where it negatively regulates
the Shh signaling pathway (Buscher
et al., 1997; Ruiz i Altaba, 1998; Persson et al., 2002; Meyer and Roelink,
2003). Both genes are necessary for
the specification of dorsal neuronal
cell types by suppressing Shh in the
dorsal neural tube (Gunther et al.,
1994; Eggenschwiler and Anderson,
2000; Litingtung and Chiang, 2000;
Eggenschwiler et al., 2001; Persson et
al., 2002). The expression of Rab23 in
the retina and somites correlates with
a failure of the development of neural
retina layers (Gunther et al., 1994)
and malformations of axial skeleton in
opb mutant mice (Sporle et al., 1996;
Sporle and Schughart, 1998). Thus,
the expression pattern of Rab23 in the
chick neural tube and eye suggests a
similar role for Rab23 in the chick embryo.
Asymmetric Expression of
Rab23 and Left-right
Determination of Hensen’s
Node in Chick Embryos
Recent studies demonstrate that signals that specify left-right (LR) difference in the lateral plate mesoderm
(LPM) originate in and around the
node in developing chick and mouse
embryos. Shh is thought to be the key
signal conveying the left-right information from the node to lateral plate
mesoderm (LPM). At stage 4 in chick
embryos, Shh and Fgf8 are symmetrically expressed in Hensen’s node,
whereby Fgf8 shows only a weak expression in Hensen’s node compared
to a strong expression in the primitive
streak. Both genes begin to show an
asymmetric pattern in Hensen’s node
at stage 5. Shh is found on the left side
and Fgf8 on the right side (Levin et
al., 1995, 1997; Pagan-Westphal and
Tabin, 1998; Dathe et al., 2002). The
right-sided expression of FGF8 is induced by Bmp4 via chick Mid1 (Levin
et al., 1995, 1997; Monsoro-Burq and
Le Douarin, 2001; Granata and Quaderi, 2003, 2005). Asymmetrically expressed Bmp4 inhibits Shh expression
in the right side of Hensen’s node via
the Polycomblike 2 gene product
(Pcl2), thereby restricting Shh expression to the left side of Hensen’s node
(Wang et al., 2004). Our results show
that Rab23 is asymmetrically expressed in Hensen’s node and the
primitive streak. The expression in
Hensen’s node is persistent between
stages 4 –7 and especially prominent
at stage 4 prior to the asymmetric onset of Shh and Fgf8. Thus, when
Rab23 expression becomes weak in
the node at stage 5, the asymmetric
Shh expression becomes obvious
(stage 5 to 6; Levin et al., 1995). Asymmetric Rab23 expression in Hensen’s
node appears and disappears one
stage earlier than Pcl2 expression but
together with Gli3, another suppressor of Shh signaling (Levin et al.,
1995., 1997; Monsoro-Burq and Le
Douarin, 2001; Granata and Quaderi,
2003, 2005). Pcl2 has been shown to
be a direct downstream target of the
Bmp4 pathway, which suppresses
Shh through direct transcriptional effects in the right side of Hensen’s node
(Wang et al., 2004). Rab23 has been
suggested to be a negative regulator of
Shh, and it might be activated by
Bmps in the dorsal neural tube (Eggenschwiler et al., 2001, 2006; and our
results). It is tempting to assume that
during gastrulation, Rab23 induced
by Bmp4 together with Gli3 negatively regulates the Shh pathway perhaps by supporting Pcl2 suppression
of Shh transcription. Thus, Rab23
might be involved in specifying the LR
axis by helping to establish the leftright asymmetry of Hensen’s node.
Rab23 Misexpression
Dorsalizes Ventral Midbrain
But Has No Apparent
Influence on Cell
Proliferation and
Neurogenesis
We investigated if overexpression of
Rab23 leads to an ectopic expression
of the dorsal genes Pax3 and Pax7 in
ventral midbrain and a reduction in
ventral gene expression. Opb mutants
lack dorsal cell types specifically in
the caudal neural tube and ventral
specific genes extent dorsally (Gunther
et al., 1994; Eggenschwiler and
Anderson, 2000). Hence, overexpression should result in downregulation
of ventral genes and upregulation of
dorsal genes in the ventral neural
tube. Ectopic expression of Rab23 did
indeed produce an ectopic Pax3 and
Pax7 expression in ventral midbrain.
Although, ectopic Pax3 mRNA was
never as strongly induced as Pax7 protein, Pax7 can induce the expression
of Pax3 in the ventral midbrain (Matsunaga et al., 2001). Thus, the weak
ectopic expression of Pax3 upon
Rab23 overexpression might reflect a
necessity of Pax7 for the induction of
Pax3. These results are in agreement
with the phenotype of the opb mutant,
where the dorsal marker Pax7 is not
expressed (Gunther et al., 1994). In
RAB23 IN CHICK NEURAL TUBE 3003
addition, in the area of Nkx2.2 and
Nkx6.1 expression, we observed both
cells that expressed Rab23 and Nkx
genes and cells that expressed only
Rab23. The downregulation of Nkx2.2
or Nkx6.1 in not all cells might be
explained by non-sufficient amounts
of ectopic Rab23 protein to affect
highly abundant Shh signaling required for Nkx2.2 and Nkx6.1 induction (Roelink et al., 1995; Ericson et
al., 1997a). Thus, our data suggest
that ectopic expression of Rab23 is
sufficient to reduce ventral neural
tube markers like Nkx2.2 and Nkx6.1
that need Shh for their expression and
allows for dorsal genes like Pax7 and
Pax3 to be expressed.
We only observed a change in cell
specification of ventral cells when embryos were electroporated prior to
stage 11 (Nkx genes) or stage 12 (Pax
genes). After stage 11 or stage 12, respectively, ectopic Rab23 did not result in reduction of Nkx2.2 or Nkx6.1
or in ectopic Pax3 or Pax7 gene expression or in ventral midbrain. Both
Pax3 and Pax7 genes need dorsal Bmp
signals from the roof plate to be induced (Goulding et al., 1993a; Liem et
al., 1997; Mansouri and Gruss, 1998).
In the ventral neural tube, Bmp antagonists suppress these roof plate
signals (Patten and Placzek, 2002).
We showed recently that at stage 12,
ventral midbrain cells are still able to
adopt a dorsal fate (Li et al., 2005).
However, although ectopic ventral
Rab23 blocks the Shh signaling pathway, dorsal genes were not expressed
after stage 12. This might suggest
that, after stage 12, the amount of
Bmp proteins that reach and/or persist in ventral regions might be too
low to induce dorsal genes (Furuta et
al., 1997; Smith, 1999; Liem et al.,
2000; Patten and Placzek, 2002).
The Rab23 mouse mutant created
by Kasarskis et al. (1998) shows an
open neural tube along the entire anterio-posterior axis but lacks Rab23
expression only in the posterior neural
tube and does not affect the general
DV patterning in the anterior neural
tube (Eggenschwiler et al., 2001). This
suggested that signals from the roof
plate, which are still present in the
anterior neural tube of the open brain
mutant, activate the expression of
Rab23 (Eggenschwiler et al., 2000,
2001). Here, we show that Bmp 4 is
able to induce ectopic Rab23 in the
ventral midbrain at early stages in
development. Thus, our results support the assumption that the presence
of Bmp in the anterior neural tube of
the open brain mutant induces Rab23,
which then promotes dorsal neural
cell fates by silencing the Shh pathway.
Rab 23 localizes to the plasma membrane and the endocytic pathway
(Evans et al., 2003) and is known to
inhibit Shh signaling intracellularly
(Eggenschwiler et al., 2001). Rab23
could regulate the cellular dynamics
of different components of the Shh
pathway that undergo dynamic movements between plasma membrane
and endosomal compartments (Incardona et al., 2000). However, the subcellular distribution pattern of neither
Ptc nor Smo was altered by overexpression of wild type or Rab23 mutant
protein (Evans et al., 2003). Similarly,
Rab23/Smo double mutants exhibit
the same external morphology and
spinal cord cell type patterning as the
Rab23 single mutant (Eggenschwiler
et al., 2006). These results indicate
that Rab23 does not directly regulate
cellular dynamics of proteins, which
lie upstream in the Shh signaling
pathway. Rab23 rather influence Gli
transcription factors in more direct
ways than anticipated. Thus, the phenotype of a double mutant of Rab23
and Gli2 indicates that Rab23 functions upstream of Gli2, as loss of Gli2
could mostly suppress the Rab23 phenotype, in a dose-dependent manner
(Eggenschwiler et al., 2006). Rab23
also has a role in the production of the
Gli3 repressor, as proteolytically processed Gli3 decreases by fivefold in
Rab23 mutant embryos extracts compared with wild type. Rab might affect
the nucleoplasmic trafficking of Gli
proteins or that of relevant components of Shh signaling such as Iguana
or Tectronic (Sekimizu et al., 2004;
Wolff et al., 2004; Reiter and Skarnes,
2006). Nevertheless, our results provide evidence that the ectopic expression of Rab23 in ventral midbrain cells
facilitates the expression of dorsal
genes and reduces ventral genes that
are induced by Shh early in development, confirming a role of Rab23 as
repressor of Shh signaling in chick
embryos.
Does Rab23 only act as a repressor
of Shh or does it also influence proliferation and neurogenesis? Rab23
overexpression in the midbrain did
not reveal any significant change in
the rate of cell proliferation in dorsal
and ventral midbrain or in neurogenesis in dorsal midbrain, at least not
one day after overexpression. Taken
together, our results suggest a similar
role for Rab23 in mouse and chick
neural tube, namely as a negative regulator of Shh. Our results in the chick
midbrain also suggest that Rab23 acts
not only in spinal cord as known from
mouse mutants but also in the brain.
EXPERIMENTAL
PROCEDURES
Isolation of Chick Rab23
Using the coding region of the mouse
Rab23 cDNA (Olkkonen et al., 1994)
as a query, we searched for sequence
similarities in the chick database
(http://www.chick.unist.ac.uk). This
revealed 4 chick EST clones
(ChEST75d14,
ChEST545g23,
ChEST885j22, ChEST925k6) (Boardman et al., 2002; Hubbard et al.,
2005). After sequence analysis, the 3
clones (chEST 545h23, 885j22, and
925k6) with the highest homologies
were used as templates to prepare
RNA probes for in situ hybridization.
The full-length chicken Rab23 was
isolated by linker PCR. Specific primers including start and stop codons
were combined with XbaI and BamH1
(forward primer: CGCTCTAGATGAGCTGCAGAG ATGTTGG; reverse
primer: CGCGGATCCCATAGGCACAA GATT) and subcloned into the
expression vector pMES (Swartz et
al., 2001; kind gift of Dr. C. Krull).
Phylogenetic Analysis
Multiple sequence alignments were
generated using PileUp from the GCG
Wisconsin package (Version 10.3, Accelrys Inc., San Diego, CA) and ClustalX (Thompson et al., 1997). Phylogenetic analyses were performed on an
alignment of 192 amino-acids using
the neighbour-joining method (Saitou
and Nei, 1987; 1,000 pseudosamples)
as implemented in PAUP* (Rogers
and Swofford, 1998). Rab sequences
were retrieved using the NCBI
BLAST server (http://www.ncbi.nlm.
nih.gov/BLAST/).
3004 LI ET AL.
In Situ Hybridization and
Immunohistochemistry and
Visualisation
Fertile hens’ eggs were incubated in a
humidified atmosphere at 37°C to the
required stage. Embryos were staged
according to Hamburger and Hamilton (1951). In situ hybridization was
performed as described (Henrique et
al., 1995). The RNA antisense transcripts from clones 885j22 and 925k6
produced a much stronger signal and
less background than clone 545h23
(both covered most of the coding region including the 5⬘ end), while sense
transcripts of all 3 clones did not show
any significant staining. For double in
situ hybridizations, the protocol was
modified as described by Li et al.
(2005). The Pax3 and Nkx6.1 probe
have been described previously (Goulding et al., 1993b). Pax7 was obtained
from the BBSRC chickenEST Databank (ChEST329n14) (Boardman et
al., 2002; Hubbard et al., 2005).
Patched 2 (Ptc2) was a kind gift of Dr.
Farshid Seif.
Embryos were further stained using
antibodies against Islet 1/2 (39.4D5)
and Pax7 and Nkx2.2 (Developmental
Studies Hybridoma Bank (DSHB) under the auspices of the NICHD, and
maintained by the University of Iowa,
Department of Biological Sciences,
Iowa City, IA 52242 (Ericson et al.,
1996; Kawakami et al., 1997), against
neurofilament (RMO-270, Zymed),
and against the phosphorylated form
of Histon H3 (PH3, Biomol) and GFP
(Polysciences). Appropriate Cy2 and
Cy3 secondary antibodies (4 ␮g/ml;
Jackson ImmunoResearch) or peroxidase coupled antibodies (Amersham)
were applied to detect primary antibody binding. All antibodies were applied as previously described (Li et al.,
2005). Embryonic brains were flatmounted or transversely sectioned at
50 ␮m on a vibratome, mounted on
slides in glycerol/PBS (9:1), and analysed and photographed using a Leica
microscope (Leica D-RM) or a confocal
microscope (Leica TCS Sp). The separation of dyes used in bright field histology was achieved with a plugin of
ImageJ that generates images by colour subtraction. The colour deconvolution plugin implements stain separation using a method described by
Ruifrok and Johnston (2001). The
code is based on an NIH Image macro
kindly provided by A.C. Ruifrok.
Electroporation
The chicken Rab23 coding region was
cloned into the pMES vector (Rab23pMES-GFP; Swartz et al., 2001).
pCAX vector, which expresses an
EGFGP (Swartz et al., 2001) and contains the same promoter and enhancer as pMES, was used as control.
Bmp4 (a kind gift of E. Aguis) cloned
into pCDNA II was mixed with pCAX
to visualise it. Fertilized chicken eggs
were incubated at 37°C in a humidified incubator until stage 9 –13 (Hamburger and Hamilton,1951) and windowed. Rab23-pMES-GFP, Bmp4 plus
pCAX, or pCAX alone were electroporated into the neural tube at midbrain
level (2–5 pulses, 50 ms/20 –25V;
pMES, pCAX, Bmp4 each 3 ␮g/␮l plus
1.5 ␮g/␮l pCAX in the case of Bmp4).
The electrodes were placed parallel to
the neural tube at different dorso-ventral levels, depending on which region
was to be transfected (Muramatsu et
al., 1998). After electroporation, embryos were reincubated to stages
15–23 of development. Successful neural tube transfection was verified in
ovo using a Leica (Germany) fluorescence dissecting microscope equipped
with EGFP optics. Embryos were then
collected and fixed for 2 hr to overnight in 4% paraformaldehyde.
ACKNOWLEDGMENTS
We thank C. Winkler, J. Clarke, and
R. Klafke for a critical reading of the
manuscript and stimulating discussions, C. Krull for kindly providing us
with the pMES- and pCAX plasmids,
E. Aguis for kindly providing the fulllength Bmp4, Barbara Katzenberger,
Marcel Zahn for excellent technical
assistance, and Christian Böhringer
for his help with ImageJ. A.W. was
supported by a Junior Research Group
grant of the Volkswagenstiftung. N.L.
was supported by a fellowship from
the SFB 465 (DFG) and the Volkswagenstiftung.
REFERENCES
Amor JC, Harrison DH, Kahn RA, Ringe D.
1994. Structure of the human ADP-ribosylation factor 1 complexed with GDP.
Nature 372:704 –708.
Aruga J, Tohmonda T, Homma S, Mikoshiba K. 2002. Zic1 promotes the expansion of dorsal neural progenitors in spinal cord by inhibiting neuronal
differentiation. Dev Biol 244:329 –341.
Barth KA, Kishimoto Y, Rohr KB, Seydler
C, Schulte-Merker S, Wilson SW. 1999.
Bmp activity establishes a gradient of
positional information throughout the
entire neural plate. Development 126:
4977–4987.
Boardman PE, Sanz-Ezquerro J, Overton
IM, Burt DW, Bosch E, Fong WT, Tickle
C, Brown WR, Wilson SA, Hubbard SJ.
2002. A comprehensive collection of
chicken cDNAs. Curr Biol 12:1965–1969.
Briscoe J, Ericson J. 2001. Specification of
neuronal fates in the ventral neural
tube. Curr Opin Neurobiol 11:43–49.
Briscoe J, Pierani A, Jessell TM, Ericson J.
2000. A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell
101:435–445.
Briscoe J, Chen Y, Jessell TM, Struhl G.
2001. A hedgehog-insensitive form of
patched provides evidence for direct
long-range morphogen activity of sonic
hedgehog in the neural tube. Mol Cell
7:1279 –1291.
Buscher D, Bosse B, Heymer J, Ruther U.
1997. Evidence for genetic control of
Sonic hedgehog by Gli3 in mouse limb
development. Mech Dev 62:175–182.
Caspary T, Anderson KV. 2003. Patterning
cell types in the dorsal spinal cord: what
the mouse mutants say. Nat Rev Neurosci 4:289 –297.
Chavrier P, Gorvel JP, Stelzer E, Simons
K, Gruenberg J, Zerial M. 1991. Hypervariable C-terminal domain of rab proteins acts as a targeting signal. Nature
353:769 –772.
Chedotal A, Pourquie O, Sotelo C. 1995.
Initial tract formation in the brain of the
chick embryo: selective expression of the
BEN/SC1/DM-GRASP cell adhesion molecule. Eur J Neurosci 7:198 –212.
Chen CY, Shyu AB. 1995. AU-rich elements: characterization and importance
in mRNA degradation. Trends Biochem
Sci 20:465–470.
Chesnutt C, Burrus LW, Brown AM,
Niswander L. 2004. Coordinate regulation of neural tube patterning and proliferation by TGFbeta and WNT activity.
Dev Biol 274:334 –347.
Chiang C, Litingtung Y, Lee E, Young KE,
Corden JL, Westphal H, Beachy PA.
1996. Cyclopia and defective axial patterning in mice lacking Sonic hedgehog
gene function. Nature 382:407–413.
Chizhikov VV, Millen KJ. 2004. Control of
roof plate development and signaling by
Lmx1b in the caudal vertebrate CNS.
J Neurosci 24:5694 –5703.
Chizhikov VV, Millen KJ. 2005. Roof platedependent patterning of the vertebrate
dorsal central nervous system. Dev Biol
277:287–295.
Dathe V, Gamel A, Manner J, Brand-Saberi B, Christ B. 2002. Morphological
left-right asymmetry of Hensen’s node
precedes the asymmetric expression of
RAB23 IN CHICK NEURAL TUBE 3005
Shh and Fgf8 in the chick embryo. Anat
Embryol (Berl) 205:343–354.
Dickinson ME, Selleck MA, McMahon AP,
Bronner-Fraser M. 1995. Dorsalization
of the neural tube by the non-neural ectoderm. Development 121:2099 –2106.
Eggenschwiler JT, Anderson KV. 2000.
Dorsal and lateral fates in the mouse
neural tube require the cell-autonomous
activity of the open brain gene. Dev Biol
227:648 –660.
Eggenschwiler JT, Espinoza E, Anderson
KV. 2001. Rab23 is an essential negative
regulator of the mouse Sonic hedgehog
signalling pathway. Nature 412:194 –
198.
Eggenschwiler JT, Bulgakov OV, Qin J, Li
T, Anderson KV. 2006. Mouse Rab23 regulates hedgehog signaling from smoothened to Gli proteins. Dev Biol 290:1–12.
Ericson J, Morton S, Kawakami A, Roelink
H, Jessell TM. 1996. Two critical periods
of Sonic Hedgehog signaling required for
the specification of motor neuron identity. Cell 87:661–673.
Ericson J, Briscoe J, Rashbass P, van Heyningen V, Jessell TM. 1997a. Graded
sonic hedgehog signaling and the specification of cell fate in the ventral neural
tube. Cold Spring Harb Symp Quant Biol
62:451–466.
Ericson J, Rashbass P, Schedl A, BrennerMorton S, Kawakami A, van Heyningen
V, Jessell TM, Briscoe J. 1997b. Pax6
controls progenitor cell identity and neuronal fate in response to graded Shh signaling. Cell 90:169 –180.
Evans TM, Ferguson C, Wainwright BJ,
Parton RG, Wicking C. 2003. Rab23, a
negative regulator of hedgehog signaling, localizes to the plasma membrane
and the endocytic pathway. Traffic 4:869 –
884.
Furuta Y, Piston DW, Hogan BL. 1997.
Bone morphogenetic proteins (BMPs) as
regulators of dorsal forebrain development. Development 124:2203–2212.
Gilman AG. 1987. G proteins: transducers
of receptor-generated signals. Annu Rev
Biochem 56:615–649.
Goulding M, Sterrer S, Fleming J, Balling
R, Nadeau J, Moore KJ, Brown SD, Steel
KP, Gruss P. 1993a. Analysis of the
Pax-3 gene in the mouse mutant splotch.
Genomics 17:355–363.
Goulding MD, Lumsden A, Gruss P. 1993b.
Signals from the notochord and floor
plate regulate the region-specific expression of two Pax genes in the developing
spinal cord. Development 117:1001–
1016.
Granata A, Quaderi NA. 2003. The Opitz
syndrome gene MID1 is essential for establishing asymmetric gene expression
in Hensen’s node. Dev Biol 258:397–405.
Granata A, Quaderi NA. 2005. Asymmetric
expression of Gli transcription factors in
Hensen’s node. Gene Expr Patterns 5:
529 –531.
Gunther T, Struwe M, Aguzzi A,
Schughart K. 1994. Open brain, a new
mouse mutant with severe neural tube
defects, shows altered gene expression
patterns in the developing spinal cord.
Development 120:3119 –3130.
Hamburger V, Hamilton HL. 1951. A series of of normal stages in the development of the chick embryo. J Morphol 68:
49 –95.
Henrique D, Adam J, Myat A, Chitnis A,
Lewis J, Ish-Horowicz D. 1995. Expression of a Delta homologue in prospective
neurons in the chick. Nature 375:787–
790.
Hubbard SJ, Grafham DV, Beattie KJ,
Overton IM, McLaren SR, Croning MD,
Boardman PE, Bonfield JK, Burnside J,
Davies RM, Farrell ER, Francis MD,
Griffiths-Jones S, Humphray SJ, Hyland
C, Scott CE, Tang H, Taylor RG, Tickle
C, Brown WR, Birney E, Rogers J, Wilson SA. 2005. Transcriptome analysis for
the chicken based on 19,626 finished
cDNA sequences and 485,337 expressed
sequence tags. Genome Res 15:174 –183.
Hunter E, Begbie J, Mason I, Graham A.
2001. Early development of the mesencephalic trigeminal nucleus. Dev Dyn 222:
484 –493.
Ille F, Atanasoski S, Falk S, Ittner LM,
Marki D, Buchmann-Moller S, Wurdak
H, Suter U, Taketo MM, Sommer L.
2007. Wnt/BMP signal integration regulates the balance between proliferation
and differentiation of neuroepithelial
cells in the dorsal spinal cord. Dev Biol
304:394 –408.
Incardona JP, Lee JH, Robertson CP, Enga
K, Kapur RP, Roelink H. 2000. Receptormediated endocytosis of soluble and
membrane-tethered Sonic hedgehog by
Patched-1. Proc Natl Acad Sci USA 97:
12044 –12049.
Kasarskis A, Manova K, Anderson KV.
1998. A phenotype-based screen for embryonic lethal mutations in the mouse.
Proc Natl Acad Sci USA 95:7485–7490.
Kawakami A, Kimura-Kawakami M, Nomura T, Fujisawa H. 1997. Distributions
of PAX6 and PAX7 proteins suggest their
involvement in both early and late
phases of chick brain development. Mech
Dev 66:119 –130.
Lee KJ, Jessell TM. 1999. The specification
of dorsal cell fates in the vertebrate central nervous system. Annu Rev Neurosci
22:261–294.
Lee KJ, Dietrich P, Jessell TM. 2000. Genetic ablation reveals that the roof plate
is essential for dorsal interneuron specification. Nature 403:734 –740.
Leung KF, Baron R, Ali BR, Magee AI,
Seabra MC. 2006. Rab GTPases containing a CAAX motif are processed
post-geranylgeranylation by proteolysis and methylation. J Biol Chem 282:
1487–1497.
Levin M, Johnson RL, Stern CD, Kuehn M,
Tabin C. 1995. A molecular pathway determining left-right asymmetry in chick
embryogenesis. Cell 82:803–814.
Levin M, Pagan S, Roberts DJ, Cooke J,
Kuehn MR, Tabin CJ. 1997. Left/right
patterning signals and the independent
regulation of different aspects of situs in
the chick embryo. Dev Biol 189:57–67.
Li N, Hornbruch A, Klafke R, Katzenberger B, Wizenmann A. 2005. Specification of dorsoventral polarity in the embryonic chick mesencephalon and its
presumptive role in midbrain morphogenesis. Dev Dyn 233:907–920.
Liem KF, Tremml G, Roelink H, Jessell
TM. 1995. Dorsal differentiation of neural plate cells induced by BMP-mediated
signals from epidermal ectoderm. Cell 82:
969 –979.
Liem KF Jr, Tremml G, Jessell TM. 1997.
A role for the roof plate and its resident
TGFbeta-related proteins in neuronal
patterning in the dorsal spinal cord. Cell
91:127–138.
Liem KF Jr, Jessell TM, Briscoe J. 2000.
Regulation of the neural patterning activity of sonic hedgehog by secreted BMP
inhibitors expressed by notochord and
somites. Development 127:4855–4866.
Litingtung Y, Chiang C. 2000. Specification of ventral neuron types is mediated
by an antagonistic interaction between
Shh and Gli3. Nat Neurosci 3:979 –985.
Mansouri A, Gruss P. 1998. Pax3 and Pax7
are expressed in commissural neurons
and restrict ventral neuronal identity in
the spinal cord. Mech Dev 78:171–178.
Marti E, Bumcrot DA, Takada R, McMahon AP. 1995. Requirement of 19K form
of sonic hedgehog for induction of distinct ventral cell types in CNS explants.
Nature 375:322–325.
Matsunaga E, Araki I, Nakamura H. 2001.
Role of Pax3/7 in the tectum regionalization. Development 128:4069 –4077.
McMahon JA, Takada S, Zimmerman LB,
Fan CM, Harland RM, McMahon AP.
1998. Noggin-mediated antagonism of
BMP signaling is required for growth
and patterning of the neural tube and
somite. Genes Dev 12:1438 –1452.
Meyer NP, Roelink H. 2003. The aminoterminal region of Gli3 antagonizes the
Shh response and acts in dorsoventral
fate specification in the developing spinal cord. Dev Biol 257:343–355.
Millen KJ, Millonig JH, Hatten ME. 2004.
Roof plate and dorsal spinal cord dl1 interneuron development in the dreher
mutant mouse. Dev Biol 270:382–392.
Millonig JH, Millen KJ, Hatten ME. 2000.
The mouse Dreher gene Lmx1a controls
formation of the roof plate in the vertebrate CNS. Nature 403:764 –769.
Monsoro-Burq A, Le Douarin NM. 2001.
BMP4 plays a key role in left-right patterning in chick embryos by maintaining
Sonic Hedgehog asymmetry. Mol Cell 7:
789 –799.
Muramatsu T, Nakamura A, Park H. 1998.
In vivo electroporation: a powerful and
convenient means of nonviral gene
transfer to tissues of living animals. Int
J Mol Med 1:55–62.
Newman CM, Magee AI. 1993. Posttranslational processing of the ras superfamily of small GTP-binding proteins. Biochim Biophys Acta 1155:79 –96.
Nguyen VH, Trout J, Connors SA, Andermann P, Weinberg E, Mullins MC. 2000.
Dorsal and intermediate neuronal cell
types of the spinal cord are established
3006 LI ET AL.
by a BMP signaling pathway. Development 127:1209 –1220.
Olkkonen VM, Peterson JR, Dupree P,
Lutcke A, Zerial M, Simons K. 1994. Isolation of a mouse cDNA encoding Rab23,
a small novel GTPase expressed predominantly in the brain. Gene 138:207–211.
Ostermeier C, Brunger AT. 1999. Structural basis of Rab effector specificity:
crystal structure of the small G protein
Rab3A complexed with the effector domain of rabphilin-3A. Cell 96:363–374.
Paduch M, Jelen F, Otlewski J. 2001.
Structure of small G proteins and their
regulators. Acta Biochim Pol 48:829 –
850.
Pagan-Westphal SM, Tabin CJ. 1998. The
transfer of left-right positional information during chick embryogenesis. Cell 93:
25–35.
Patten I, Placzek M. 2002. Opponent activities of Shh and BMP signaling during
floor plate induction in vivo. Curr Biol
12:47–52.
Pereira-Leal JB, Seabra MC. 2001. Evolution of the Rab family of small GTP-binding proteins. J Mol Biol 313:889 –901.
Persson M, Stamataki D, te Welscher P,
Andersson E, Bose J, Ruther U, Ericson
J, Briscoe J. 2002. Dorsal-ventral patterning of the spinal cord requires Gli3
transcriptional repressor activity. Genes
Dev 16:2865–2878.
Piddini E, Vincent JP. 2003. Modulation of
developmental signals by endocytosis:
different means and many ends. Curr
Opin Cell Biol 15:474 –481.
Psychoyos D, Stern CD. 1996. Fates and
migratory routes of primitive streak cells
in the chick embryo. Development 122:
1523–1534.
Reiter JF, Skarnes WC. 2006. Tectonic, a
novel regulator of the Hedgehog pathway required for both activation and inhibition. Genes Dev 20:22–27.
Roelink H, Porter JA, CHiang C, Tanabe T,
Chang DT, Beachy PA, Jessell TM. 1995.
Floor plate and motor neuron induction
by different concentrations of the aminoterminal cleavage product of sonic
hedgehog autoproteolysis. Cell 81:445–
455.
Rogers JS, Swofford DL. 1998. A fast
method for approximating maximum
likelihoods of phylogenetic trees from
nucleotide sequences. Syst Biol 47:77–
89.
Ruifrok AC, Johnston DA. 2001. Quantification of histochemical staining by color
deconvolution. Anal Quant Cytol Histol
23:291–299.
Ruiz i Altaba A. 1998. Combinatorial Gli
gene function in floor plate and neuronal
inductions by Sonic hedgehog. Development 125:2203–2212.
Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol
Evol 4:406 –425.
Schweitzer R, Vogan KJ, Tabin CJ. 2000.
Similar expression and regulation of
Gli2 and Gli3 in the chick limb bud.
Mech Dev 98:171–174.
Sekimizu K, Nishioka N, Sasaki H, Takeda
H, Karlstrom RO, Kawakami A. 2004.
The zebrafish iguana locus encodes
Dzip1, a novel zinc-finger protein required for proper regulation of Hedgehog
signaling. Development 131:2521–2532.
Smith WC. 1999. TGF beta inhibitors. New
and unexpected requirements in vertebrate development. Trends Genet 15:3–
5.
Sporle R, Schughart K. 1997. Neural tube
morphogenesis. Curr Opin Genet Dev 7:
507–512.
Sporle R, Schughart K. 1998. Paradox segmentation along inter- and intrasomitic
borderlines is followed by dysmorphology of the axial skeleton in the open
brain (opb) mouse mutant. Dev Genet
22:359 –373.
Sporle R, Gunther T, Struwe M, Schughart
K. 1996. Severe defects in the formation
of epaxial musculature in open brain
(opb) mutant mouse embryos. Development 122:79 –86.
Sprang SR. 1997. G protein mechanisms:
insights from structural analysis. Annu
Rev Biochem 66:639 –678.
Swartz M, Eberhart J, Mastick GS, Krull
CE. 2001. Sparking new frontiers: using
in vivo electroporation for genetic manipulations. Dev Biol 233:13–21.
Thompson JD, Gibson TJ, Plewniak F,
Jeanmougin F, Higgins DG. 1997. The
CLUSTAL_X windows interface: flexible
strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876 –4882.
Timmer JR, Wang C, Niswander L. 2002.
BMP signaling patterns the dorsal and
intermediate neural tube via regulation
of homeobox and helix-loop-helix tran-
scription factors. Development 129:2459 –
2472.
Towers P, Patel K, Withington S, Isaac A,
Cooke J. 1999. Flik, a chick follistatinrelated gene, functions in gastrular dorsalisation/neural induction and in subsequent maintenance of midline Sonic
hedgehog signalling. Dev Biol 214:298 –
317.
Tremblay P, Pituello F, Gruss P. 1996. Inhibition of floor plate differentiation by
Pax3: evidence from ectopic expression
in transgenic mice. Development 122:
2555–2567.
Viebahn C. 2001. Hensen’s node. Genesis
29:96 –103.
Wang S, Yu X, Zhang T, Zhang X, Zhang Z,
Chen Y. 2004. Chick Pcl2 regulates the
left-right asymmetry by repressing Shh
expression in Hensen’s node. Development 131:4381–4391.
Wang Y, Ng EL, Tang BL. 2006. Rab23:
what exactly does it traffic? Traffic 7:746 –
750.
Wijgerde M, McMahon JA, Rule M, McMahon AP. 2002. A direct requirement for
Hedgehog signaling for normal specification of all ventral progenitor domains in
the presumptive mammalian spinal
cord. Genes Dev 16:2849 –2864.
Wilson L, Maden M. 2005. The mechanisms of dorsoventral patterning in the
vertebrate neural tube. Dev Biol 282:1–
13.
Wolff C, Roy S, Lewis KE, Schauerte H,
Joerg-Rauch G, Kirn A, Weiler C, Geisler
R, Haffter P, Ingham PW. 2004. iguana
encodes a novel zinc-finger protein with
coiled-coil domains essential for Hedgehog signal transduction in the zebrafish
embryo. Genes Dev 18:1565–1576.
Yamada T, Placzek M, Tanaka H, Dodd J,
Jessell TM. 1991. Control of cell pattern
in the developing nervous system: polarizing activity of the floor plate and the
notochard. Cell 64:635–647.
Zhong JM, Chen-Hwang MC, Hwang YW.
1995. Switching nucleotide specificity of
Ha-Ras p21 by a single amino acid substitution at aspartate 119. J Biol Chem
270:10002–10007.
Zhuang B, Sockanathan S. 2006. Dorsalventral patterning: a view from the top.
Curr Opin Neurobiol 16:20 –24.