Download Nuclear and Nucleolar Localization by the N

Nuclear and Nucleolar Localization
by the N-terminal Domain of DNA Topoisomerase I
Yinghui Mao, Issac R. Mehl, and Mark T. Muller*
Department of Molecular Genetics, The Ohio State University,
Columbus, Ohio 43210, USA
* To whom correspondence should be addressed at: Department of Molecular Genetics, the Ohio State University,
484 West 12th Avenue, Columbus, OH 43210, USA.
Phone: (614) 292-1914
Fax: (614) 292-4702
E-mail: [email protected]
Running title: localization of DNA topoisomrease I
Abstract
The nonconserved, hydrophilic N-terminal domain of eukaryotic DNA topoisomerase I
(topo I) is dispensable for the catalytic activity of the enzyme but essential in vivo. There are at
least 3 putative nuclear localization signals (NLSs) and a nucleolin binding signal within the first
215 residues of the topo I N-terminal domain. We have investigated physiological functions of
topo I N-terminal domain by fusing it to an enhanced green fluorescent protein (EGFP). The
first 170 residues of the N-terminal domain allow efficient import of chimeric proteins into
nuclei and nucleoli. The nucleolar localization of this protein is not dependent on its interaction
with nucleolin, while ongoing rDNA transcription clearly is crucial.
Immunoprecipitation
experiments reveal that topo I N-terminus-EGFP (topoIN-EGFP) fusion protein associates with
the TATA-binding protein (TBP) in cells.
Furthermore, we have demonstrated that DNA
damage results in extensive nucleolar redistribution of the topoIN-EGFP chimeric product and
that nucleolar delocalization is p53 dependent. Finally, we identified an interaction between the
N-terminus of topo I and p53 using a mammalian two-hybrid system. Take together these results
suggest that the topo I fusion protein can be localized to rDNA transcription loci and that
retention and egress of topo I from nucleoli is clearly dynamic and can rapidly change based
upon p53 status and in response to transcription and DNA damage from either UV or
topoisomerases.
Key words: topoisomerase I/N-terminal domain/EGFP/localization
2
Introduction
DNA topoisomerase I (topo I) affects DNA topology by making a single strand break in
DNA, followed by one or more cycles of controlled rotation, then resealing and releasing the
DNA (39). Topo I participates in a variety of DNA templating activities, such as transcription
(19, 29, 33, 45) and DNA replication (10, 16), presumably to reduce torsional stress in the
template. Studies with yeast show that topo I is also thought to influence genomic instability
through illegitimate recombination (41-43, 48). Although topo I is not an essential gene in yeast
(46), it is required for embryonic development in Drosophila melanogaster (21) and mice (31);
therefore, topo I is essential in the context of a multicellular organism. Recently, it was proposed
that topoisomerase I and p53 might cooperate to eliminate damaged genomes from the whole
organism (28). Topo I is also the target of a novel class of anticancer drugs active against
previous refractory solid tumors, the camptothecin (CPT) derivatives [for reviews see (24, 35)].
These drugs stabilize topo I-DNA covalent complexes causing single-strand DNA breaks, which
are thought to be converted into lethal double-strand DNA breaks during DNA replication,
possibly other DNA templating events (24, 35).
Limited proteolysis and crystallographic structure determination indicates that the
enzyme is comprised of (i) a highly charged NH2-terminal domain (~24 kDa), (ii) the conserved
core domain (~54 kDa), (iii) a linker region (~3 kDa), and (iv) the highly conserved COOHterminal domain, which contains the active site tyrosine (38, 39). In vitro studies indicate that
two highly conserved globular domains (the core and the COOH-terminal domain) are crucial for
catalytic activity, and two other regions (NH2-terminus and linker) are not required for catalytic
and relaxation functions (38, 39). Despite the fact that the N-terminal domain is dispensable for
the relaxation activity and not well conserved, it may still be important roles in vivo. For
3
example, the lethality of human topo I over-expression in yeast is dependent on the N-terminal
domain, which carries the nuclear localization signal sequence (NLS) and directs the enzyme to
the nucleus (3). Furthermore, studies in Drosophila also show that hydrophilic N-terminus can
target topo I to transcriptionally active loci, suggesting additional roles for this domain in the in
vivo functions of topo I, which remains to be elucidated .
In this work, we have linked the human topo I N-terminus with enhanced green
fluorescent protein (EGFP) to evaluate the dynamics of topo I distribution within living cells. We
demonstrate that topo I fusion proteins localize to sites of rDNA transcription. The localization
can be altered by treating cells with DNA damaging agents and the N-terminal domain of topo I
is necessary for this response. These findings suggest a model whereby the N-terminal domain
of topoisomerase I might serve as a primary targeting signal for the enzyme.
Moreover,
localization of topo I is clearly dynamic and can rapidly change in response to changes in
transcription, DNA damage response and topoisomerase inhibition. The p53 status of the cell
also dictates how endogenous topo I is shuffled around following DNA damage.
4
Results
Nuclear and nucleolar localization of topoIN-EGFP fusion proteins. To examine the
physiological and biochemical functions of the non-conserved N-terminal domain of endogenous
topo I, we examined the subcellular distribution of a topoIN-EGFP fusion protein in live cells. A
specific, intense green fluorescence signal was clearly restricted to the nuclei of cells transfected
with topoIN-EGFP (Figure 2B). In contrast, EGFP (Figure 2A, vector control) was distributed
more or less evenly throughout the whole cell. In addition, about 90% of transfected cells
displayed nucleolar localization (Figure 2B), which is consistent with immunofluorescence
results of topo I localization (5, 9, 32). These results are also consistent with the recent report
from Mo et al. (30), suggesting that the N-terminal 215 residues in topo I contain both signals for
nuclear and nucleolar localization to allow efficient import of the fusion protein into nuclei and
enrichment in nucleoli.
Nucleolin binding signal is neither sufficient nor necessary for nucleolar localization
of topoIN-EGFP fusion proteins. It has been reported that topo I can bind to the nucleolar
protein, nucleolin, suggesting a possible nucleolar localization signal for topo I (4).
To
determine whether interaction between topo I and nucleolin is necessary and/or sufficient for the
localization of topo I, the N-terminal domain of topo I was dissected using various constructs
fused with EGFP. Western blotting demonstrated the size of all fusion proteins to be consistent
with predicted molecular weight (data not shown).
The initial two constructs involved topo I N-terminal domain fragments cut in half. The
amino terminus pTPIN∆1 (residue 1-142) has one putative NLS and the carboxyl terminus
pTPIN∆2 (residue 142-215) has two putative NLSs and the nucleolin binding region (166-210).
5
However, only about 20% of cells transfected with either of these two constructs displayed
nuclear localization (Figure 3A and 3B) and neither displayed nucleolar localization. These
data imply that nucleolin binding region (residue 166-210) alone is not sufficient for the
nucleolar localization of the enzyme.
To further characterize the nucleolin binding region and localization, we constructed a
fusion protein topoIN∆3 (residue 1-170) which has all the putative NLSs, but lacks the 166-210
residue region. Surprisingly, almost 90% of cells expressing this fusion product displayed green
fluorescence in the nucleoli (Figure 3C). This result clearly demonstrates that the nucleolin
binding region is not necessary for the nuclear localization of topo I.
Co-immunoprecipitation of TBP with topoIN-EGFP protein.
Topo I has been
reported to have a predominantly nucleolar distribution and to be involved in rRNA synthesis
(11, 14, 32, 47). Furthermore, it is associated with TATA-binding protein (TBP) in the general
transcription complex (29). Since the topoIN-EGFP fusion proteins were efficiently transported
into nucleolus, we used an immunoprecipitation assay to examine whether the N-terminal fusion
protein is a part of a macromolecular transcriptional complex just like the full-length topo I.
Extracts from MCF-7 cells transfected with either topoIN-EGFP or vector control EGFP
were immunoprecipitated using rabbit anti-TBP antibodies.
The pellets were washed and
analyzed by Western blotting using antibodies against either topo I or EGFP. The endogenous
topo I with a molecular weight of 97 kDa was detected in both immunoprecipitated pellets from
the topoIN-EGFP and the EGFP vector transfected cells by the topo I-specific antibody (Figure
4). This result was consistent the FAR-Western analysis reported by Merino et al. (29). When
the same samples were probed with a GFP-specific antibody, only the 54 kDa band in
6
immunoprecipitated pellets from the topoIN-EGFP transfected cells were detected by the GFP
antibody, suggesting topo I N-terminus itself was able to associate with TBP in vivo. The
association is specific and was not seen in samples transfected with EGFP vector. These results
demonstrate a physical interaction between the N-terminal domain of topo I and transcriptional
complex, implying a possible mechanism for nucleolar localization (and retention) of topo I.
Loss of topoIN-EGFP nucleolar localization after treatment with RNA transcription
inhibitors. The co-immunoprecipitation data (Figure 4) suggest that the nucleolar localization
of topoIN-EGFP may be mediated (partially or wholly) through protein-protein interaction with
TBP during transcription of rDNA genes.
To determine whether ongoing transcription is
important for the nucleolar localization of topoIN-EGFP proteins, we next examined whether
RNA synthesis inhibitors might cause a redistribution of topo1N-EGFP. MCF-7/topoIN-EGFP
cells were treated with 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) at concentration
that inhibited [3H]uridine incorporation into RNA ≥ 50% (5). After treatment for 2 h with 30
µM DRB, the topoIN-EGFP green fluorescence signal appeared to be dispersed throughout the
nuclei in a pattern of small spheres (Figure 5B), whereas the DMSO control had no effect
(Figure 5A).
Since human rRNA genes are transcribed by RNA polymerase I, actinomycin D was used
to block rRNA transcription in the MCF-7/topoIN-EGFP cells (17, 34). Figure 5C shows an
identical result obtained with DRB treatment. To determine whether the nucleolar delocalization
of topoIN-EGFP is specifically affected by the inhibition of RNA polymerase I transcription, we
used α-amanitin to inhibit RNA polymerase II and III specifically (17, 44). The α-amanitin
treatment did not change the topoIN-EGFP fusion products nucleolar localization (Figure 5D).
7
These data suggest that the nucleolar localization of topoIN-EGFP is selectively disrupted when
RNA polymerase I transcription is specifically affected.
Redistribution of topoIN-EGFP in response to CPT and UV treatment is p53
dependent.
Treating cells with either topo I poisons or UV irradiation will cause a
redistribution of topo I whereby the enzyme is demobilized away from nucleoli centers (9, 40),
although little is known about this mechanism. Since the recruitment of topo I onto the genome
after UV treatment is p53 dependent, p53 may also play some roles in the redistribution
phenomenon with topo I (28). We explored this possibility by testing effects of topo I poison
camptothecin (CPT) and UV irradiation on the subnuclear localization of the fusion proteins in
cell lines with different p53 status (Figure 6).
In p53 wild-type MCF-7 cells, following a 30
min treatment of CPT (10 µM) or 4 h after a UV pulse (20 J/m2), topoIN-EGFP relocalization
(loss of the nucleolar signal) occurred in 90% of transfected cells (Figure 6B, 6C). In contrast,
the nucleolar fusion protein disappeared only about 10% in p53 mutant SK-BR-3 cells (Figure
6E, 6F). There were no detectable changes in topoIN-EGFP polypeptide level after CPT or UV
treatment (data not shown) which is consistent with our prior studies on intact topo I (28). These
results suggest that translocation of topo1N-EGFP may reflect (or be involved in) an alteration in
some fundamental processes, e.g. DNA repair or apoptosis, in response to DNA damage.
Physical association of topo1 N-terminal domain with p53. Both in vitro and in vivo
association assays revealed that topo I and p53 form a molecular complex (2, 12, 13, 28). The
above experiments further demonstrate that the redistribution of topoIN-EGFP after CPT and UV
treatment is also influenced by p53. We next investigated whether topo I N-terminal domain
8
itself can bind directly to p53 in vivo. The HSV-1 immediate early VP16 activation domain was
fused to either the topo I N-terminal domain or whole length topo I cDNA and cloned into a
mammalian expression plasmid (Figure 7A). The interaction of these two fusion proteins with
p53 was assayed by co-transfecting cells with a plasmid containing p53 sequences fused to the
DNA binding domain of the yeast activator protein GAL4. The activity of the fusion proteins
was then detected using a chloramphenicol acetyltransferase (CAT) reporter controlled by a
promoter containing five GAL4 DNA-binding sites.
These expression constructs were
transfected into MCF-7 cells. As expected, cotransfection of VP16-topo I and GAL4-p53 results
in high levels of reporter gene expression that are at least 5 folder greater than that seen with
VP16 alone (Figure 7B). This result is consistent with the immunoprecipitation data, which
confirmed the interaction of topo I with p53 (2, 12, 13, 28). Similar results were observed when
VP16-topoIN was cotransfected with VP16-p53 (Figure 7B). Therefore, the results of this twohybrid mammalian cell assay suggest topo I N-terminus alone is sufficient to interact with p53 in
vivo.
9
Discussion
The NH2-terminal region of topo I from amino acids 1 to 215 is highly charged, largely
disordered, and hypersensitive to protease digestion (38).
While this domain is not well
conserved and dispensable for catalytic activity of the enzyme in vitro (3), our data as well as
other reports suggest a number of critical intracellular functions. Studies in Drosophila show
that the N-terminus targets to transcriptionally active loci and is important in responding to
cellular processes during the reprogramming of gene expression that attends development (4,
36). In yeast, expression of human topo I is unhealthy and its overexpression is lethal but also
dependent on the N-terminal domain (3). Most likely the N-terminus functions in nuclear
targeting and since the 166-210-amino acid region of human topo I can form a complex with
nucleolin, a possible mechanism for nucleolar localization of topo I was proposed (4).
Green fluorescent protein (GFP) is a powerful genetic reporter and localization system.
Because the detection of intracellular GFP requires only irradiation by near UV without fixation,
addition of substrates or cofactors, it provides an excellent means for monitoring protein
localization in living cells as well as the dynamics in response to different cellular processes or
drug treatment (7, 8). Using the green fluorescence to detect the localization of topoIN-EGFP
fusion constructs, we have shown that the N-terminal 215 residues are able to direct the chimeric
proteins into nuclei and nucleoli. As noted above, the interaction between topo I and nucleolin
suggest that this association may be the mechanism by which topo I enters the nucleus and
concentrates in the nucleoli. The EGFP fusion approach allows us test this hypothesis and using
fusion constructs to dissect of topo I N-terminus, we show that the 166-210 nucleolin binding
region of topo I is neither sufficient nor necessary for the nuclear and nucleolar localization of
topo I.
10
The nucleolus is the apparatus for ribosomal RNA transcription and transcription
proceeds at a high rate in this region. Prior reports indicate that topo I is enriched in the
nucleolus and catalytically active on ribosomal DNA, suggesting this enzyme is important for
relief of positive and negative supercoiling that attends high transcriptional rates associated with
rDNA templating (11, 14, 32, 47). Nucleolar egress of topoIN-EGFP following treatment with
transcriptional inhibitors suggests that retention of topo I within the nucleolar milieu is
dependent on ongoing rRNA synthesis. DRB inhibits RNA transcription driven by all three
RNA polymerases (5), while Actinomycin D specifically inhibits RNA polymerase I at low
concentrations (17, 34). Note also that these lower concentrations of Actinomycin D do not
cause topo I/DNA cleavage complexes (REF) arguing against the idea that the Actinomycin D
result simply mimics the CPT response. Consistently, both DRB and Actinomycin D treatment
result in a rapid redistribution of chimeric proteins; however, specifically blocking RNA
polymerases II and III with α-amanitin did not. A possible mechanism for the recruitment of
topo I to the transcriptional complex is that topo I might recognize special DNA structures, for
example, positive or negative supercoiling associated with active chromatin (25). However,
based on our results, this explanation alone seems unlikely, since the topoIN-EGFP construct
lacks the conserved core domains which mediate the preferential binding of topo I to supercoiled
DNA (25).
Using immunoprecipitation experiments, we show that the N-terminal domain can direct
topoIN-EGFP fusion protein to associate with the TATA-binding protein, which is involved in
rDNA gene transcription driven by RNA polymerase I. Thus, nucleolar localization could be
driven partially or wholly by protein-protein interactions between topo I and the transcriptional
machinery. The hydrophilic N-terminal region may well provide the surface for the interactions.
11
Indeed, topo I has been reported to be a transcription factor which represses basal transcription,
and DNA relaxation activity of the enzyme was dispensable for this transcriptional repression
(29). These results suggest topo I might have other functions during transcription besides its
relaxation activity.
It has been previously shown that treatment of cells with a topo I poison (camptothecin),
or UV irradiation causes redistribution of nucleolar topo I into nucleoplasm (9, 40); however,
little is known about this mechanism. Taking advantage of our topoIN-EGFP fusion construct,
we show that this redistribution is strongly p53 dependent. It has been suggested that the
redistribution of topo I in response to CPT treatment is associated with action of drug, which
stabilizes topo I on genomic DNA elsewhere other than nucleoli. This seems unlikely since CPT
treatment also leads to topoIN-EGFP nucleolar delocalization, which does not have the active
site of the catalytic domain. Instead, it appears that the altered topo I pattern observed in p53
wild-type cells reflects a true alteration in topo I localization that accompanies the cellular
response to DNA damage caused by drug treatment, since stabilization of topo I onto genomic
DNA by CPT will generate single strand DNA breaks.
Several p53 dependent biological
processes would be activated in p53 wild-type cells: (1) enhanced transcriptional activity (e.g. of
DNA damage response genes other than rDNA), (2) DNA repair, and/or (3) initiation of
apoptosis. One can envision that involvement of topo I in any/all of these processes could drive
the redistribution of topo I. An essentially identical pattern of redistribution of topoIN-EGFP
after UV damage further rules out a purely drug-like mechanism of nucleolar delocalization.
Thus, our topoIN-EGFP constructs should provide useful tools to investigate possible
mechanisms of cellular response to topo I drug treatment, providing new insights into
mechanisms of cytotoxicity with these drugs.
12
Following the kinetics of topoIN-EGFP
redistribution after drug treatment might have utility in distinguishing between patients with
drug-sensitive and drug-resistant neoplasms when applied to clinical tumor specimens.
Since p53 can directly bind to topo I (2, 12, 28), the p53 dependent subcellular
redistribution of topo I might be a direct result of interaction between these two proteins. The
mammalian two-hybrid experiment (Figure 7) also demonstrated that topo I N-terminal domain
is sufficient to interact with p53 in vivo. Both topo I drug treatment and UV irradiation can
relocalize and stabilize wild-type p53 in the nuclei (18, 26, 27). The physical association
between p53 and topoIN-EGFP proteins could simply disrupt the dynamic equilibrium between
nucleolar and non-nucleolar populations of topoIN-EGFP proteins, and the shift of the
equilibrium is reflected by the redistribution of the proteins from the nucleoli. Functional p53 is
required for activation of a G1 checkpoint and the resulting growth arrest is thought to allow cells
time to repair DNA prior to replication (20, 22, 23) or in some cells eradicate DNA damage
laden cells which may be precancerous (15). The dynamic localization of topoIN-EGFP in
response to transcription inhibitors, camptothecin and UV irradiation may reflect the cellular
functions of topo I involving transcription, DNA repair and apoptosis. Previously we proposed
two models to explain how endogenous topo I might be recruited onto the genome in a p53 and
cell cycle dependent manner following DNA damage (28). First, topo I may simply be an active
participant in excision repair and it is recruited to a large number of repair sites. A second model
is that topo I contributes to the general demise of the cell by introducing genomic damage and
subsequent p53 dependent elimination through apoptosis. These two models are not mutually
exclusive and it is possible that DNA damaged cells exist in a balance between repair (or
resurrection) and apoptosis. Double staining cells with specific antibodies against other proteins,
for example, Gadd45 and PCNA, which are involved in these processes, may help us better
13
understand topo I functions in response to DNA damage. Gadd45, a p53 responsive factor,
might drive local chromatin modifications to facilitate topo I accessibility after DNA damage (6).
The proliferating cell nuclear antigen (PCNA) plays an essential role in both transcription and
nucleotide excision repair (1, 37).
In summary, we have generated several constructs of human topo I N-terminal domain
sequences linked to EGFP and have used them to demonstrate that the topo I fusion protein can
be localized to rDNA transcription loci. Moreover, localization of topoIN-EGFP is clearly
dynamic and can rapidly change in response to transcription, DNA repair, topoisomerase
inhibition and p53 status. Therefore, the ability of topo I to respond to cellular processes may
reside completely in the N-terminal domain. These topo I fusion constructs should provide
useful biochemical tools to further understand biological functions of topo I.
14
Materials and Methods
Plasmids construction. Plasmids containing the human topo I N-terminus fused with
EGFP and the deletion constructs used in this study are shown in Figure 1. The topo I Nterminus cDNA (residues 1-215) fragment was synthesized with PCR. The primers used in this
PCR
were
5’CCGGGAATTCATGAGTGGGGACCACCTC3’
and
5’CGGGATCCACTTGATGCCTTCAGGATAG3’. After digestion with restriction enzymes
EcoRI and BamHI sites, the PCR fragment was inserted into the EcoRI-BamHI sites of
expression vector pEGFPN2 (Clontech, Palo Alto, CA) and sequenced to confirm the junction
DNA sequences. All three shorter constructs were also constructed from PCR products with
appropriate oligonucleotide primers.
Reagents. The topo I antibody scl 70 is a human antibody against topo I isolated from
serum of scleroderma patients and was from by TopoGEN, Inc. (Columbus, OH). The GFP
antibody was obtained from Clontech (Palo Alto, CA). Camptothecin (CPT) and etoposide
(VP16) were also from TopoGEN, Inc. DRB, Actinomycin D, and α-Amanitin were purchased
from Sigma Chemical Co. (St. Louis, MO).
Cell culture and transfection. The MCF-7 and SK-BR-3 cell lines in this study are
derived from human mammary adenocarcinoma. Both cell lines are cultured in Dulbecco’s
Modified Eagle Medium supplemented with 10% fetal bovine serum (CellGro, Inc., Herndon,
VA).
15
Transfection. Freshly plated MCF-7 and SK-BR-3 cells at 50 to 80% confluence were
transfected with 2 µg of DNAs per 35-mm dish, using SuperFect transfection reagent (QIAGEN,
Valencia, CA), according to the manufacturer’s instruction.
Fluorescence microscopy.
Cells were cultured to 50-80 % confluence on glass
coverslips. Before examination, coverslips were placed directly onto a glass slide with a drop of
50% glycerol in PBS (9.1 mM Na2HPO4, 1.7 mM NaH2PO4, 150 mM NaCl, pH 7.4).
Fluorescent images were captured using a Nikon Eclipse E800 microscope attached to a
MicroMax camera (Princeton Instruments, Inc.).
Images were stored digitally using
IPLabSpectrum software.
Nuclear protein preparation. To prepare samples for western blot, cells were washed
twice with cold PBS and resuspended in 1 ml of buffer A (100 mM NaCl, 50 mM KCl, 20 mM
Tirs-HCl, pH 7.5, 0.1 mM EDTA, 0.1 mM PMSF, 10% glycerol, 0.2% NP40, 0.1% Triton X100). Following 10 min incubation on ice, nuclei were centrifuged (2000× g, 10 min) and lysed
in 100 µl of 1× electrophoresis sample buffer and boiled for 2-3 min.
Immunoprecipitation. Cells were washed twice with PBS, resuspended in 3 ml ice cold
RIPA (1× PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 10 µg/ml PMSF) and
disrupted by repeated aspiration through a 21 gauge needle and centrifugated at 10,000× g for 10
min at 4oC. Supernatant was precleared by adding 1.0 µg of rabbit IgG, together with 20 µl of
Protein A-Agarose at 4oC for 30 min. After centrifugation, supernatants (cell lysates) were
incubated with 10 µg agarose conjugated TBP antibody (Santa Cruz Biotechnology, Inc.) at 4oC
overnight with mixing. Immunoprecipitates were collected by centrifugation at 2,500× g for 5
min at 4oC and washed with 1.0 ml PBS 4 times. After the final wash, pellets were resuspended
16
in 40 µl of 1× electrophoresis sample buffer and boiled for 2-3 min. Samples were analyzed by
SDS-PAGE and western blotting.
Western blotting analysis. The nuclear protein or immunoprecipated samples were
separated by 10% SDS-PAGE, followed by electroblot transfer to nitrocellulose.
Topo I-
specific antibody scl 70 was used to detect endogenous topo I. BM Chemiluminescence Western
Blotting Kit (Mouse/Rabbit) (Boehringer Mannheim, GabH, Germany) was used to detect the
signals. To detect the expression of fusion proteins, immunoblotting was carried out using
antibody against GFP (Clontech, Palo Alto, CA).
Goat anti-mouse secondary antibody
conjugated with horseradish peroxidase was used to detect the primary antibody. Signals were
visualized with the ECL Western Blot Detection System (Amersham, Arlington Heights,
Illinois).
17
Acknowledgements
This study was supported by grant from the National Institute of Health (RO1-AG16692).
18
Legends to Figures
Figure 1. Schematic description of topoIN-EGFP constructs. The N-terminal domain of topo
I and its deleted fragments were cloned into pEGFPN2. The top line shows the topo I N-terminus
(residues 1-215). The nucleolin binding region is located from amino acid 166 to 210 as
indicated. The lower collectgion of lines represent fusion constructs of N-terminal segments of
topo I (light line) and EGFP (heavy line), and numbers correspond to amino acid residues of topo
I deletions in the fusion constructs.
Figure 2. Nuclear and Nucleolar localization of the topoIN-EGFP fusion proteins. MCF-7
cells were transfected with pTPIN-EGFP (B) or control vector pEGFPN2 (A), and pictured of
living cells at 24 h post-transfection as described in “Materials and Methods”. We found 146
cells out of 161 total display nucleolar localization in cells transfected with pTP1N-EGFP (panel
B).
Figure 3. Subcellular localization of the shorter topoIN-EGFP fusion products. MCF-7
cells were transfected with (A) pTPIN∆1 (residues 1-142). (B) pTPIN∆2 (residue 143-215). (C)
pTPIN∆3 (residue 1-170), and pictures were taken from live cells 24 h post-transfection as
described in “Materials and Methods”. Note that nuclear and nucleolar localization was identical
to those of topoIN-EGFP fusion protein (see Figure 2B) only seen in panel C , .
Figure 4. Coimmunoprecipitation of TBP and topo I or topoIN-EGFP. Lyates from cells
transfected either with pTPIN-EGFP (left lane) or control vector pEGFPN2 (right lane) were
immunoprecipitated with anti-TBP antibody as described in “Materials and Methods”.
19
Immunoprecipitates were separated by 10% SDS-PAGE and Western blots were probed with
either rabbit anti-topo I (top panel) or mouse anti-GFP (bottom panel) as described in
“Materials and Methods”. The 97 kDa arrow designates the position of endogenous topo I, while
the 54 kDa arrow indicates the topoIN-EGFP fusion product. Positions of the heavy and light
IgG chains (of TBP antibody) are also marked.
Figure 5. Effect of RNA transcription inhibitors on topoIN-EGFP localization. MCF-7 cells
transfected with topoIN-EGFP were incubated at 37oC with (A) DMSO for 5 h, (B) 30 µM DRB
for 2 h, (C) 0.04 µg/ml actinomycin D for 3h, and (D) 300 mg/ml α-amanitin for 5h. Pictures
were taken from live cells as described in “Materials and Methods”. Results are representative
of three separate experiments.
Figure 6. Effect of camptothecin and UV irradiation on the subnuclear localization of the
topoIN-EGFP fusion products. P53 wild-type MCF-7 (left panel) and p53 mutant SK-BR-3
cells (right panel) were transfected with pTPIN-EGFP as described in “Materials and Methods”.
24 h after transfection, following a 30 min treatment of CPT (10 µM) or 4 h after a UV pulse (20
J/m2), pictures were taken from live cells as described in “Materials and Methods”. (A) and (D),
no treatment controls. (B) and (E), cells treated with CPT. (C) and (F) cells treated with UV.
We found that 161 cells out of 184 total displayed redistribution of topoIN-EGFP after CPT
treatment in MCF-7 cells compare to 12 cells out of 247 total in SK-BR-3 cells. Similarly, after
UV irradiation, 250 cells out of 266 total displayed nucleolar delocalization. In contrast, only 19
cells out of 131 total lost nucleolar localization in SK-BR-3 cells.
20
Figure 7. Interaction of topo I and topo I N-terminal domain with p53 in transiently
transfected mammalian cells. (A) The activator derivatives, GAL4 construct, and the reporter
used in the transfections are shown. (B) MCF-7 cells were transfected with 1 µg E1bCAT
reporter, 5 µg of the GAL4 construct, and 5 µg of the different activator derivatives. Extracts
were prepared and CAT enzyme products were determined 48 h post-transfection. The units of
CAT enzyme are pg/ml corrected for the variability observed in β-galactosidase levels in the cell
extracts. Results are representative of four separate experiments.
21
Reference
1.
Aboussekhra, A., and R. D. wood. 1995. Detection of nucleotide excision repair
incisions in human fibroblasts by immunostaining for PCNA. Experimental Cell
Research 221:326-332.
2.
Albor, A., S. Kaku, and M. Kulesz-Martin. 1998. Wild-type and mutant forms of p53
activate human topoisomerase I: A possible mechanism for gain of function in mutants.
Cancer Res. 58:2091-2094.
3.
Alsner, J., J. Q. Svejstrup, E. Kjeldsen, B. S. Sorensen, and O. Westergaard. 1992.
Identification of an N-terminal domain of eukaryotic DNA topoisomerase I dispensable
for catalytic activity but essential for in vivo function. J. Biol. Chem. 267:12408-12411.
4.
Bharti, A. K., M. O. J. Olson, D. M. Kufe, and E. H. Rubin. 1996. Identification of a
nucleolin binding site in human topoisomerase I. J. Biol. Chem. 271:1993-1997.
5.
Buckwalter, C. A., A. H. Lin, A. Tanizawa, Y. G. Pommier, Y.-C. Cheng, and S. H.
Kaufmann. 1996. RNA synthisis inhibitors alter the subnuclear distribution of DNA
topoisomerase I. Cancer Res. 56:1674-1681.
6.
Carrier, F., P. T. Georgel, P. Pourquier, M. Blake, H. U. Kontny, M. J. Antinore, M.
Gariboldi, T. G. Myers, J. N. Weinstein, Y. Pommier, and A. J. Fornace, Jr. 1999.
Gadd45, a p53-responsive stress protein, modifies DNA accessibility on damaged
chromatin. Mol. Cell. Biol. 19:1673-85.
7.
Chalfie, M., and S. Kain (ed.). 1998. Green Fluorescent Protein: Properties,
Applications, and Protocols. Wiley-Liss, New York.
8.
Chalfie, M., Y. Tu, G. Euskirchen, W. W. Ward, and D. C. Prasher. 1994. Green
fluorescent protein as a marker for gene expression. Science 263:802-805.
22
9.
Danks, M. K., K. E. Garrett, R. C. Marion, and D. O. Whipple. 1996. Subcellular
redistribution of DNA topoisomerase I in anaplastic astrocytoma cells treated with
topotecan. Cancer Res. 56:1664-1673.
10.
D'Arpa, P., C. Beardmore, and L. F. Liu. 1990. Involvement of nucleic acid synthesis
in cell killing mechanisms of topoisomerase poisons. Cancer Res. 50.
11.
Fleischmann, G., G. Pflugfelder, E. K. Steiner, K. Javaherian, G. C. Howard, J. C.
Wang, and S. C. Elgin. 1984. Drosophila DNA topoisomerase I is associated with
transcriptionally active regions of the genome. Proc. Natl. Acad. Sci. USA 81.
12.
Gobert, C., L. Bracco, F. Rossi, M. Olivier, J. Tazi, F. Lavelle, A. K. Larsen, and J.
F. Riou. 1996. Modulation of DNA topoisomerase I activity by p53. Biochemistry
35:5778-5786.
13.
Gobert, C., A. Skladanowski, and A. K. Larsen. 1999. The interaction between p53
and DNA topoisomerase I is regulated differently in cells with wild-type and mutant
cells. Proc. Natl. Acad. Sci. USA 96:10355-10369.
14.
Higashinakagawa, T., H. Wahn, and R. H. Reeder. 1977. Isolation of ribosomal gene
chromatin. Dev. Biol. 55:375-386.
15.
Hill, L. L., A. Ouhtit, S. M. Loughlin, M. L. Kripke, H. N. Ananthaswamy, and L. B.
Owen_Schaub. 1999. Fas Ligand: A Sensor for DNA Damage Critical in Skin Cancer
Etiology. Science 285:898-900.
16.
Holm, C., J. M. Covey, D. Kerrigan, and Y. Pommier. 1989. Differential requirement
of DNA replication for the cytotoxicity of DNA topoisomerase I and II inhibitors in
Chinese hamster DC3F cells. Cancer Res. 49:6365-6368.
23
17.
Huang, S., T. J. Deerinck, M. H. Ellisman, and D. L. Spector. 1998. The perinucleolar
compartment and transcription. The Journal of Cell biology 143:35-47.
18.
Kastan, M. B., O. Okywere, D. Sidransky, B. Vogelstein, and R. W. Craig. 1991.
Participation of p53 in the cellular response to DNA damage. Cancer Res. 51:6304-6311.
19.
Kertzschmarr, M., M. Meisterernst, and R. G. Roeder. 1993. Identification of human
DNA topoisomerase I as a cofactor for activator-dependent transcription by RNA
polymerase II. Proc. Natl. Acad. Sci. USA 90:11508-11512.
20.
Lane, D. 1994. The regulation of p53 function: steiner award lecture. Int. J. Cancer
57:623-627.
21.
Lee, M. P., S. D. Brown, A. Chen, and T.-S. Hsieh. 1993. DNA topoisomerase I is
essential in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 90:6656-6660.
22.
Levine, A. J., M. E. Perry, A. Chang, A. Silver, D. Dittmer, M. Wu, and D. Welsh.
1994. The 1993 Walter Habert Lecture: the role of the p53 tumor-suppressor gene in
tumorigenesis. Br. J. Cancer 69:409-416.
23.
Linke, S. P., K. C. Klarkin, and G. M. Wahl. 1997. p53 mediates permanent arrest over
multiple cell cycles in response to r-irradiation. Cancer Res. 57:1171-1179.
24.
Liu, L. F. 1989. DNA topoisomerase poisons as antitumor drugs. Annu. Rev. Biochem.
58:351-375.
25.
Liu, L. F., and J. C. Wang. 1987. Supercoiling of the DNA template during
transcription. Proc. Natl. Acad. Sci. USA 84:7024-7027.
26.
Lu, X., and D. P. Lane. 1993. Differential induction of transcriptionally active p53
following UV or ionizing radiation: defects in chromosome instability synaromes? Cell
75:765-778.
24
27.
Maltzman, W., and L. Czyzyk. 1984. UV irradiation stimulates levels of p53 cellular
tumor antigen in nontransformed mouse cells. Mol. Cell. Biol. 4:1689-1694.
28.
Mao, Y., S. Okada, L.-S. Chang, and M. T. Muller. 2000. p53 dependence of
topoisomerase I recruitment in vivo. Cancer Res. in press.
29.
Merino, A., K. R. Madden, W. S. Lane, J. J. Champoux, and D. Reinberg. 1993.
DNA topoisomerase I is involved in both repression and activation of transcription.
Nature 365:227-232.
30.
Mo, Y.-Y., P. Wang, and W. T. Beck. 2000. Functional expression of human DNA
topoisomerase I and its subcellular localization in HeLa cells. Experimental Cell Res.
256:480-490.
31.
Morham, S. G., K. D. Kluckman, N. Voulomanos, and O. Smithies. 1996. Targeted
disruption of the mouse topoisomerase I gene by camptothecin selection. Mol. Cell. Biol.
16:6804-6809.
32.
Muller, M. T., C. S. Bolles, and D. S. Parris. 1985. Association of type I DNA
topoisomerase with herpes simplex virus. J. Gen. Virol. 66:1565-1574.
33.
Muller, M. T., W. P. Pfund, V. B. Mehta, and D. K. Trask. 1985. Eukaryotic type I
topoisomerase is enriched in the nucleolus and catalytically active on ribosomal DNA.
EMBO J. 4:1237-1243.
34.
Perry, R. P. 1963. Selective effects of actinomycin D on the intracellular distribution of
RNA synthesis in tissue culture cells. Exp. Cell Res. 29:400-406.
35.
Pommier, Y., P. Pourquier, Y. Fan, and D. Strumberg. 1998. Mechanism of action of
eukaryotic DNA topoisomerase I and drugs targeted to the enzyme. Biochimica et
Biophysica Acta 1400:83-106.
25
36.
Shaiu, W.-L., and T.-S. Hsieh. 1998. Targeting to transcriptionally active loci by the
hydrophilic N-terminal domain of Drosophila DNA topoisomerase I. Molecular and
cellular biology 18:4358-4367.
37.
Smith, M., J. M. Ford, M. C. Hollander, R. A. Bortnick, S. A. Amundson, Y. R. Seo,
C.-X. Deng, P. C. Hanawalt, and A. J. J. Fornace. 2000. p53-Mediated DNA Repair
Responses to UV Radiation: Studies of Mouse Cells Lacking p53, p21, and/or gadd45
Genes. Mol. Cell. Biol. 20:3705-3714.
38.
Stewart, L., G. C. Ireton, and J. J. Champux. 1996. The domain roganization of
human topoisomerase I. J. Biol. chem. 271:7602-7608.
39.
Stewart, L., M. R. Redinbo, X. Qiu, W. G. J. Hol, and J. J. Champoux. 1998. A
model for the mechanism of human topoisomerase I. Science 279:1534-1541.
40.
Thielmann, H. W., O. Popanda, and H. J. Staab. 1999. Subnuclear distribution of
DNA topoisomerase I and Bax protein in normal and xeroderma pigmentosum fibroblasts
after irradiation with UV light and gamma rays or treatment with topotecan. J Cancer Res
Clin Oncol 125:193-208.
41.
Wang, J. C. 1991. DNA topoisomerase: Why so many. J. Biol. Chem. 266:6659-6662.
42.
Wang, J. C. 1996. DNA topoisomerases. Annu. Rev. Biochem. 65:635-692.
43.
Wang, J. C., P. R. Caron, and R. A. Kim. 1990. The role of DNA topoisomerases in
recombination and genome stability: A double-edged sword. Cell 62:403-406.
44.
Weinmann, R., H. J. Raskas, and R. G. Roeder. 1975. The transcriptional role of host
DNA-dependent RNA polymerases in adenovirus-infected KB cells. Cold Spring Harbor
Symp. Quant. Biol. 34:495-500.
26
45.
Wu, H.-Y., and L. F. Liu. 1991. DNA looping alters local DNA conformation during
transcription. J. Mol. Biol. 219:615-622.
46.
Yanagida, M., and R. Sternglanz. 1990. Genetics of DNA topoisomerases, p. 299-320.
In N. R. Cozzarelli, and J. C. Wang (ed.), DNA topology and its biological effects. Cold
Spring Harbor Laboratory Press, N.Y.
47.
Zhang, H., J. C. Wang, and L. F. Liu. 1988. Involvement of DNA topoisomerase I in
transcription of human ribosomal RNA genes. Proc. Natl. Acad. Sci. USA 85:1060-1064.
48.
Zhu, J., and R. H. Schiestl. 1996. Topoisomerase I involvement in illegitimate
recombination in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:1805-1812.
27