Download Assignment

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Gene expression profiling wikipedia , lookup

Epigenetics of neurodegenerative diseases wikipedia , lookup

Protein moonlighting wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Expanded genetic code wikipedia , lookup

Metagenomics wikipedia , lookup

Gene therapy wikipedia , lookup

Neuronal ceroid lipofuscinosis wikipedia , lookup

Public health genomics wikipedia , lookup

Non-coding RNA wikipedia , lookup

Saethre–Chotzen syndrome wikipedia , lookup

Population genetics wikipedia , lookup

Genomics wikipedia , lookup

Gene expression programming wikipedia , lookup

Gene wikipedia , lookup

Gene nomenclature wikipedia , lookup

Genome evolution wikipedia , lookup

Primary transcript wikipedia , lookup

Epistasis wikipedia , lookup

Designer baby wikipedia , lookup

Genetic code wikipedia , lookup

Microsatellite wikipedia , lookup

Gene therapy of the human retina wikipedia , lookup

Messenger RNA wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Helitron (biology) wikipedia , lookup

RNA-Seq wikipedia , lookup

Mutation wikipedia , lookup

Epitranscriptome wikipedia , lookup

Haplogroup G-P303 wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Microevolution wikipedia , lookup

Frameshift mutation wikipedia , lookup

Point mutation wikipedia , lookup

Transcript
BIOL510 • Winter 2017• Assignment 5: Characterization of a mutation responsible for immune deficiency in
humans
Assignment 5: Characterization of a single nucleotide polymorphism
(SNP) responsible for immune deficiency in humans
6 March 2017 • Due Date: 14 March 2011
In the following assignment you will characterize a mutation that is associated with a deficiency in the
human immune system’s response to bacterial infection. In this hypothetical situation, a patient has
an unexplained immune deficiency that causes them to be susceptible to typhoid fever (Salmonella).
Upon screening the patient’s transcriptome, a single point mutation was found in the following cDNA
sequence:
>cDNA
TCCGGTCCTTACTGTGTCTACATCCGGAATGCTGTGGATGGAAAATGGTTCTGCTTCAATGACTCCAATATTTGCTTGGTGTC
CTGGGAAGACATCCAGTGTACCTACGGAAATCCTAACTACCACTGGCAGGAAACTGCATATCTTCTGGTTTACATGAAGATGG
AGTGCTAA
**the cDNA sequence is accessible at the BCI website. It’s the file entitled “typhoid_mutation.fasta”.
Using the tools associated with NCBI and MEGA, characterize the mutation by answering the
following questions:
1. What is the name of the gene in which this mutation occurs? (HINT: use blastn and search against
the refseq_rna database with organism set to “human” ) (2 marks)
2. What is the length of the mature mRNA for this gene? What region of the mature mRNA is proteinencoding? (HINT: go to the GQuery nucleotide entry for the mRNA) (2 marks)
3. What is the length of the gene? Why does gene length and mature mRNA length differ? (1 mark)
4. Where is the mutation in the coding DNA sequence of the mRNA? What is the nucleotide mutation?
(HINT: align the mutated sequence with a reference sequence from NCBI using MEGA or pairwise
blast) (2 marks)
5. Does this mutation cause a change in the amino acid sequence of the protein? (HINT: use MEGA to
properly translate the nucleotide sequences or use blastx) (2 marks)
6. Is this gene only found in humans? (2 marks)
1
BIOL510 • Winter 2017• Assignment 5: Characterization of a mutation responsible for immune deficiency in
humans
7. If this gene is not specific to humans, is the corresponding amino acid associated with this mutation
conserved among other species? (HINT: align the nucleotide or protein sequences from 5 other
species and comment on the conservation across the species you selected OR use NCBI
Homologene). (2 marks)
8. What is the reported function of this protein? (2 marks)
9. Would you expect this amino acid to be critical for the function of the protein? (2 marks)
2