Download A new repetitive DNA sequence family in the olive (Olea

Hereditas 134: 73-78 (2001)
A new repetitive DNA sequence family in the olive
(Olea europaea L.)
P. LORITE, M. F. GARCIA, J. A. CARRILLO and T. PALOMEQUE
Departamento de Biologia Experimental, Area de Genitica, Universidad de Jain, Jain, Spain
Lorite, P., Garcia, M. F., Carrillo, J. A. and Palomeque, T. 2001. A new repetitive DNA sequence family in the olive (Oleu
europeu L.).-Hereditas 134: 73-78. Lund, Sweden. ISSN 0018-0661. Received February 8, 2001. Accepted May 21, 2001
Two families of repeated DNA sequences were cloned from Oleu europueu ssp sutiou cv. “Picual”. The first repetitive
DNA is organized in a tandem repeat of monomers of 178 bp. Sequencing of several clones showed that it is relatively
A-T rich (54.49 ‘YO)and possesses short direct and inverted subrepeats as well as some palindromic sequences. Comparison
between the monomers revealed heterogeneity of the sequence primary structure. This repetitive DNA is present in several
cultivars of olive cultivates. Comparison of sequences with other repetitive DNAs described in Oleu europueu has been
carried out. No significant similarity was found. All the obtained results suggest that this repetitive DNA described here
is a new family of repetitive DNA. The second repetitive DNA is organized in a tandem repeat of monomers of 78 bp.
This second family of repetitive DNA showed significant similarity with other repetitive DNAs previously described in
Oleu europueu. Their existence in new cultivars of olive is shown.
Teresu Pulornequr, Departurnento de Biologiu Experimentul. Areu de Gen;ticu, Universiilud c k JuCn, 23071 J u h , Spuin
E-mail: [email protected]
Repetitive sequences form an important part of the
eukaryotic genome. In higher plants they may account
for between 20% and 90% of the genome. Nuclear
DNA content can vary widely among plant species,
even within the same family, and much of this variation in nuclear DNA content seems to be due to
variation in the amount of the repetitive DNA
(FLAVELL
1986). Therefore, cloning and characterization of repetitive sequences is an efficient means of
studying the majority of an eukaryotic genome.
Molecular maps of agriculturally important plants
have become a necessary tool in both basic and
applied research. The integration of molecular markers based in repetitive DNA into these maps is important in several aspects. Firstly, clusters of tandem
repetitive DNA show high variability, and therefore
provide both markers and the opportunity for fingerprinting. Secondly, there are relatively easy targets for
in situ hybridization. Thirdly, in some cases they are
species specific, variety specific and even chromosome
specific (LAPITAN
1992). Lastly, in many cases they are
located in the areas of the chromosomes that attract
specific attention, namely centromeres and telomeres.
This is particularly important in the light of data on
the predominant localization of plant genes in the
telomeric segments of chromosomes (LAPITAN1992;
PICHand SCHUBERT1998; MACASet al. 2000).
The olive (Oleu europaea) is one of the most ancient
cultivated fruit tree species in the Mediterranean
basin. It is the only Mediterranean representative of
the genus Olea, which includes 35-40 species distributed over tropical and southern Africa, south Asia,
eastern Australia, New Caledonia, and New Zealand
(ZOHARY and HOPF 1993). Olea europaea
L. ssp. sativa Hoffmg et Link, is the cultivated olive
tree. The outcrossing origin of the species and the
introgression of genes from wild into cultivated
olives resulted in high diversity of cultivars in all
Mediterranean countries (BARRANCOand RALLO
1985). Despite these considerations and the agricultural value of the olive, very little is known about
the genomic organization of the Olea species. Recently a high genetic variation in the cultivated
and wild olive taxa of the genus Olea has been detected
by analysis of RAPD data (Random Amplified Polymorphic DNA), (FABBRIet al. 1995; CLAROSet al.
2000; GEMASet al. 2000; HESSet al. 2000), by AFLP
(Amplified Fragment Length Polymorphism) data
(ANGIOLILLO
et al. 1999; LUMARET
et al. 2000) and
other molecular techniques (BESNARDet al. 2000;
AMANEet al. 2000; RALLOet al. 2000).
In this paper a new family of repetitive DNA from
Olea europaea cv. “Picual” was cloned, sequenced and
its organization in the genome was studied. Besides,
the existence of a similar DNA repetitive to the 81 bp
family recently described in this taxon (KATSIOTISet
al. 1998; BITONTI
et al. 1999) in other new cultivars of
olive cultivates was also shown.
MATERIAL AND METHODS
Isolation and digestion of genomic DNA
Young leaves of olive trees (Olea europaea cv.
“Picual”) were collected in Jaen (Spain). Sampling
74
P. Lorite et al.
was restricted to the areas where olives have been
cultivated traditionally for a very long time. Leaves
of the “Picual” and the other cultivars, also studied
in this paper, were obtained from the germoplasma
collection of the Centro de Investigacion y Desarrollo
Agrario at Cordoba, Spain. Total genomic DNA was
extracted from leaves according to the technique described by WILKIE(1997). Digestion of isolated DNA
with restriction endonucleases was carried out according to the recommendations of the supplier using
4 U/pg DNA. The digested DNA was analyzed by
electrophoresis in 2 940 agarose gels.
Cloning of’ repetitive D N A
Digestion of genomic DNA with Hue111 originated
two bands of repetitive DNA. The bigger was between 100-200 bp and the smaller less than 100 bp.
These DNA bands were eluted from agarose gel. The
fragments were cloned in the pUC19 vector site
Sma I. Recombinant plasmids were denominated
pOLEU.
Southern blot analysis of digested genomic D N A
Samples of 4 pg of genomic DNA were digested with
several restriction endonucleases according to the
manual of the supplier. Digestion fragments were
separated on 2 (% agarose gels, then blotted onto
Hybond-N
membranes (Amersham) under standard conditions. Southern hybridization was performed according to the technique described by
SAMBROOK
et al. (1989) at 60°C using 20 ng of
labelled probe/ml. The probes (OLEU) were labelled
with digoxigenin-1 I-dUTP using a random primer
DNA labeling kit (Roche). Detection of hybridization
was performed with a DIG-detection kit from Roche.
+
Hereditas 134 (2001)
RESULTS AND DISCUSSION
Genomic DNA from Olea europaea was cleaved with
several restriction enzymes (HaeIII, TaqI, Tru91,
AluI, EcoRI and SacI among others) and the resulting fragments were separated in 2 % agarose gels.
Digestion with Hue111 reveals two bands of repetitive
DNA. The bigger one is between 100-200 bp and the
smaller one is less than 100 bp (Fig. la). These bands
were eluted from the agarose gel and cloned into the
plasmid pUC 19. A portion of the eluted fragment
was labelled with digoxigenin by the random priming
method and used as hybridization probes. Recombinants yielding strong positive signal were directly
sequenced. Fourteen clones, known as pOLEU-788,
POLEU-786, POLEU-828, POLEU-832, POLEU833, POLEU-860, POLEU-220, pOLFU-765,
pOLEU-763A, pOLEU-763B, POLEU-775, POLEU787, pOLEU-773 and pOLEU-900 were sequenced
and selected for further studies (GenBank accession
numbers AJ131614, from AJ131695 to AJ131704,
AJ243943-A5243944 and AJ271721).
The sequencing results of the selected clones
showed that two different families of repetitive DNA
sequences have been cloned. Twelve clones were sequenced from one repetitive DNA sequence family.
The results showed that OLEU-828, OLEU-832,
OLEU-833, OLEU-860, OLEU-220, OLEU-763A,
OLEU-763B, OLEU-765C, OLEU-775, OLEU-787,
OLEU-786 and OLEU-788 inserts have 356, 178,
D N A sequence analysis
Sequencing reactions were performed using the Thermosequenase fluorescent cycle sequencing kit from
Amersham. The samples were analyzed on a 6.5 %
polyacrylamide urea gels in an LICOR400L Automated DNA Sequencer.
Computer analysis
Multiple alignment was performed using the
CLUSTALW program. DNA sequence variation was
carried out using DnaSP3.00 (DNA Sequence Polymorphism) program (ROZASand ROZAS 1995, 1999).
Search for homologous sequences to our clones was
performed at the National Center for Biotechnology
Information (NCBI) using the BLAST network service and the EMBL/GenBank/DDBJ database using
FASTA (ALTSCHUL
et al. 1990, 1997; PEARSONand
LIPMAN1998).
Fig. la-c. a Electrophoretic separation on 2 ?hagarose gel
of Olea europaea cv. “Picual” genomic digest with HaeIII.
Arrows indicate the two bands of repetitive DNA. The
DNA molecular weight size marker is the 100 bp ladder. b
Southern blot analysis of Olea europaea cv. “Picual” genomic DNA digests with restriction enzymes (H = HaeIII,
Ta = TaqI, Tr = Tru91, A = AIuI, E = EcoRI, S = SacI),
using OLEU-832 inserts as probe. c Southern blot analysis
of Olra europaea cv. “Picual” genomic DNA digests with
Hue111 using OLEU-773 inserts as probe. The numbers on
the far left indicate the size of DNA fragments in bp.
Repetitive D N A in Olea europaea cu . “Picual”
Hereditas 134 (2001)
... ;... ... .. ...
.. .. .. .. ..
. . . . .
:. :. ; .: :. :.
. . . . .
.. ..
. .
.
..
..
..
.. .. .. . . .
.. .. .. ...€ 4.. ..
.. .. .. .. .. .u
.. .. .. .. .. ..
.- m.
*€I
.. ..
€ 4 -
..
..
. . m . . .
H
$
IaJ
-0
a
y 39
: : L? 9 L? 9 9 9 9
.. .. . .. :. .: A* FI ”. F. :.
. .; . . . . . . .
. . . . . :. + k .: .:
. m .i. . *ii
. .
.D .. .a .. .. .. .. ma .. .. ..
. . . u .u .a . u .
2G .. .. .. .. .. .. m. u. .. ..
0 .. m. : I ? : : : ; : :
u
1:. .. ... . .. I II .. .. .. .. .. ..
... ... ... I .. .. . .. ... ... ... ...
~~
P
..
..
I::::::
0
.d
u. ..
. . . H . .
m]$u
-2>
. .
€4h
.* ..
00
r-
e
Y
..
..
..
.
:;
:
2
5
:
:
+
5
:
.. .. .. .. .. .. .. .. .. .. ..
.. .. .. .. ..
. . .
I
B . . . . .
m . . . . .
m . . . . .
$U 5d , . :. . :.
T“
I
1 1 4 ;
I.
u . . . . .
s:::::
pi;:
I :. .: ..: ..: .. :
. . . ( l J . . .
4 . .
8m :. :. :. :. .:
b . . . . .
m . . . . .
b . . . . .
q ; ; , , ,.
-I3
&
. .. .. ..
... ... ... ... .. . .. . .. ..
.. a. .. .. .. a. .. .. .. i.. ... .
.. .. .. .. .. .. .. .. .. .. ..
.u . . . . . . . . .
.. .. .. .. .. .. .a .. .. .. ..
.. .. .. .. .. .. .. .. m
u .
.. .. .. .. .. .. .. .. ... ... ...
. . . . . . . . . . .
8U 2. 5. .: .: . .: .: .:L!. .:L!.
g : : : : : : .: .: .: .: .:
3 :. :. :. :. :. ; : :
A
8 :. .: .: .: .: . : . :. :. :. :. :
. .. .. .. .. .. .. .. .. ..m.
. . . . . . . . . .
:. 5. 8 :i
:k : : :
. . . . .. .. .. , . i . . . .
I k .: .: .: .: :. :. :. :. ! . : . :
-11
I.
3.
11 : : : : : : : :
8 :; A , : : : : : :
€ 4 :
. :. 5. 5. .: .: :. :.: 5. .:
(rc
8
0
: .. A. .. I . .. .. I’.. 6.. .. ..
. . . . . . . . . . .
I’ I.
I’ I’ I’ I’
I’
I’ I’
.
. . . .
. *. A. ..
5m .: .: .: .: .:
.u . . .
.
5 : :. :. :. :.
Li::::
g $ .. a. .. ..
M
: : : : :
3 u . ..
. . . . .
”B . -. m. u
0 . m
g:;:::
a
h
.
.
.. ..
I
..
EiL! : : : :
.. ..
. .
u. u.
a
.
.. ..
. .
i:
.. ..
. .
a
.
..
-5
c
m
. ..
.
.
..
0
.
...
.. ..
...
..
.
...
.. ...
.. ..
.. ..
.€4
.. ..
5. :.
. .
.. ..
. .
em
.. ..
. .
* H
.. ..
..
.. ..
i
. .:
€ 4 .
m . . . . . .
m . . . . . .
3
1
I:::”:
,.:::L!
u . . m . .
5
.-
.. ..
:. +.
*
.. .u.
.. ..
. .
0 .
>
0
76
P. Lorite et al.
172, 177, 170, 123, 79, 79, 80, 79, 79, 99 and 99 bp
respectively.
To determine whether the cloned repetitive DNA
sequences were dispersed or tandemly repetitive sequences, genomic DNA was examined by Southern
blot hybridization (Fig. 1b). OLEU-833 and OLEU832 inserts hybridized to multimers of a basic unit of
about 180 bp which was generated by digestion with
HaeIII, AluI and EcoRI indicating that the cloned
DNA belonged to tandemly repetitive DNA sequences. Hybridization to Hue111 digests also shows
intermediate bands with less intensity and with sizes
about 80-100 bp and 250-260 bp among others.
Some hybridization bands were also observed with
Sac1 (Fig. lb).
The obtained nucleotide sequences belonging to
this family were aligned to establish a consensus
sequence using the CLUSTAL W computer program
(Fig. 2). The homology comparison within the sequences showed that the monomeric unit of the repetitive DNA has about 178 bp. OLEU-828 is composed
of two monomeric units, known as OLEU-828B and
OLEU-828C, each one of two with a restriction site
by HaeIII. The comparison of sequencing results is
summarized in Fig. 2, where the best alignment of
repeating units is presented. Gaps are inserted in
order to optimize the alignments. As can be seen in
Fig. 2 the smaller sizes of the OLEU-763A, OLEU763B, OLEU-765, OLEU-775, OLEU-787, OLEU-
Fig. 3. Southern blot of genomic DNA from several cultivars of Olea europaea after digestion with HaeIII using
OLEU-832 inserts as probes. The numbers on the far left
indicate the size of DNA in bp.
Hereditas 134 (2001)
786, and OLEU-788 inserts are due to the new
restriction site by Hue111 as a result of a single point
of mutation. Two DNA fragments with about 79 and
99 bp are originated as consequence of this new
restriction site. Southern analysis of genomic DNA
digests with Hue111 showed bands with multiple sizes
of the monomeric unit of 178 bp and intermediate
bands with less intensity and with sizes of about
80-100 bp, and 250-260 bp among others (Fig. lb).
This result is characteristic of the digestion of repeated sequences arranged in tandem, indicating that
the new restriction site is not present in all the
monomeric units. Sequencing results support this
fact. Fig. 2 showed several monomeric unit sequences
without the new restriction site. The existence of
another new restriction site can also explain the
smaller size of OLEU-220.
The consensus sequence with 178 bp is relatively
A-T rich (54.49 YO),possesses several direct, inverted
and palindromic sequences (Fig. 2) and does not bear
any similarity to other DNAs in the sequence data
bank. The variability among sequences is mainly a
result of base substitution spread randomly within
the sequence as the predominant deviation from the
consensus. These sequences can be considered as
members of the same family of repetitive DNA. The
average number of nucleotide differences per site
between sequences or nucleotide diversity, Pi (NEI
1987) is 0.35 with a standard deviation of 0.07 and
the nucleotide diversity using the Jukes and Cantor
correction (JUKESand CANTOR1969) is 0.71. The
sequences showed are of Hue111 generated repeated;
therefore the high frequency of nt substitution in
position 79 is a consequence of the cloning of repetitive DNA methods.
Hybridization experiments were performed to test
the possible existence in other cultivars of a repetitive
sequence similar to that cloned in 0. europaea cv.
“Picual”. Genomic DNA from “Koroneiki”, “Hojiblanca”, “Manzanilla”, “Arbequina”, “Frantoio”,
and “Mastoidis” was cleaved with the Hue111 enzyme. Sequence similarities were detected by Southern analysis using OLEU-833 and OLEU-832 inserts
as probe (Fig. 3).
Although the olive tree is one of the oldest cultivated crops, very little is known about the molecular
and genomic organization of Olea species. Only two
tandemly repeated DNA sequences in Olea europaea
var. “Koroneiki” have been described (KATSIOTISet
al. 1998). The repeated sequences are the 81 bp family
and the clone pOS281 (218 bp). Both are A-T rich (51
and 58 YO)and were isolated from a genomic library.
According to the authors a breakage-reunion mechanism, involving the CAAAA sequence, could be responsible for the derivation of pOS218 from the
77
Hereditas 134 (2001)
Repetitive D N A in Olea europaea cv. “Picual”
81 bp family element (KATSIOTISet al. 1998).
BITONTIet al. (1999) have described the OeTaq80
repeats with significant sequence homology with the
81 bp family.
Sequence comparison between repeated DNA of
Olea europaea cv. “Koroneiki”, and the first family
of repeated DNA of Olea europaea cv. “Picual”
described in this paper was carried out using the
BLASTN2 computer program (ALTSCHULet al.
1997). No significant similarity was found between
these sequences. Between pOS281 and the repetitive
DNA reported here, do not share any longer
stretches of similarity, which would indicate a clear
potential evolutionary relationship. Sequence comparison reveals no significant similarity either in repeating motifs or in other parts of the overall nt
sequence. Only short stretches of similarity are observed, characteristic of sequences with similar A + T
content, as has been reported by other authors
(PLOHL and UGARKOVIC1994). The sequence
CAAAA is also present in the repetitive DNA described here, but it is also present in other unrelated
DNAs (APPELSet al. 1986; GALASSOet al. 1997; LI
et al. 1995).
It is possible that each repetitive monomer unit is
evolved from shorter repeating elements. The conservation of the CAAAA duplication in both repetitive
DNAs, a putative motif responsible for a breakagereunion mechanism (APPELSet al. 1986) would support this possibility. However they have changed so
much that the sequence can now in both cases be
considered unique.
The clones pOLEU-773 and pOLEU-900 belonged
to the second family of repetitive DNA. The sequencing results of the clones pOLEU-773 and pOLEU900 showed that they have inserts of 79 and 160 bp
respectively. A ladder pattern typical of tandemly
organized repeat was observed in HaeIII digest (Fig.
lc) using OLEU-773 inserts as probes. Intervariety
sequence similarities were also detected (data nonshowed). Homology of these sequences with the 81
bp family and POS2 18 from Olea europaea ssp. sativa
cv. “Koroneiki” recently described by KATSIOTIS
et
al. (1998) was found using BLASTN search
(ALTSCHULet al. 1997). As can be seem in Figure 4,
two monomerics units, known as OLEU-900/1 and
OLEU-900/2 compose OLEU-900. This figure shows
the alignment between these sequences and the 81 bp
family (KATSIOTISet al. 1998). However, no signifi-
cant similarity was found after comparison with the
other DNA sequences described in this paper.
Repetitive DNA shows high variability, and in
some cases they are species specific, variety specific
and even chromosome specific (LAPITAN1992). In
accordance with all the observed results we suggest
that the repetitive DNA with a consensus sequence of
178 bp described here is a new family of repetitive
DNA. However the inserts OLEU-773 and OLEU900 showed significant similarity with the 81 bp family described by KATSIOTIS
et al. (1998) and with the
OeTaq80 repeat described by BITONTIet al. (1999).
In this paper the existence of this family of repetitive
DNA in several cultivars of olive cultivates is confirmed. Besides their existence in other cultivars as
“Picual”, “Hojiblanca”, “Manzanilla” and “Arbequina” is shown.
Olea europaea cv. “Koroneiki” and Olea europaea
cv. “Picual” are cultivars with very different origin,
Greece and Spain respectively. A high genetic variation and a high degree of polymorphism of cultivars
in all Mediterranean countries have been detected by
different molecular techniques (BESNARD and
BERVILLE2000; SEFC et al. 2000 among others).
Genetic variation and geographically related genotypes has also been described (OUAZZANI
et al. 1995,
1996; CLAROS
et al. 2000).
In conclusion three tandemly repeated DNA sequences have been described in Olea europaea ssp.
sativa (the cultivated olive tree) until now: the
pOSE218 family isolated from the cultivar “Koroneiki” (KATSIOTIS
et al. 1998) also present in other
species of the genus Olea; the new family described
here, present in the cultivars “Picual”, “Koroneiki”,
“Hojiblanca”, “Manzanilla”, “Arbequina”, “Frantoio”, and “Mastoides”; and the 81 bp family (KATSIOTIS et al. 1998) with significant similarity with
OetTaq80 repeats (BITONTIet al. 1999) and with the
second family of repetitive DNA described here. This
last repetitive DNA is present in several cultivars and
other species of the genus Olea, although with very
different frequencies even between the olive cultivars
studied (BITONTIet al. 1999). The authors suggest
that the redundancy levels of given repeated DNA
sequences might provide suitable parameters for varietal identification within cultivated olives. Further
studies will give new data about the repetitive DNA
of the olive and about the possibility of using repetitive DNA markers for identification of olive varieties.
81 pb (Katsiotis et al. 1998)
GATCAATCTGTCMATTTTAG
CCGATTCCGGACACAGTCGCGAAAAATOACGAAATTGCCCCCGGCGCGATTTTTGTTTCC
OLEU-773
AT
T
1... . . . . . . . . . . . 0 0
OLEU-900/1 ..C . . . . . . ....C ..................... A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . . . . . . . . G
T.
....................................................
OLEU-900/2 ..C... . . . . . . .C
......................................
.............
................ ....
.
.
Fig. 4. Alignment between 81 bp, OEAJ2765, Accession No AJ002765 (KATSIOTIS
et al. 1998), OLEU-773, and OLEU-900.
78
P. Lorite et al.
Hereditas 134 (2001)
Finally, these new data can be important in improving knowledge of the genomic organization of Oleu
species.
REFERENCES
Amane M, Ouazzani N, Lumaret R and Debain C, (2000).
Chroroplast-DNA variation in the wild an cultivated
olives (Olea europaea L.) of Morocco. Euphytica 116:
59-64.
Angiolillo A, Mencuccini M and Baldoni L, (1999). Olive
genetic diversity assessed using amplified fragments
length polymorphisms. Theor. Appl. Genet. 98: 41 1
421.
Altschul SF, Gish W, Miller W, Myers MW and Lipman
DJ, (1990). A basic local alignment search tool. J. Mol.
Biol. 215: 403-410.
Altschul SF, Stephen F, Thomas L, Madden L, Schaffer
AA, Zhang J, Zhang Z, Miller W and Lipman DJ,
(1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids
Res. 25: 3389-3402.
Appels R, Moran LB and Gustafson JP, (1986). Rye
heterochromatin. I. Studies on clusters of the major.
repeating sequence and the identification of a new dispersed repetitive sequence element. Can. J. Genet. Cytol.
28: 645-657.
Barranco D and Rallo L, (1985). Las variedades de olivo
cultivadas en Espafia. Olivae 9: 16-22.
Besnard G and Berville A, (2000). Multiple origins for
Mediterranean olive (Olea europaea L. ssp. europaea)
based upon mitochondria1 DNA. C. R. Acad. Sci. I11
323: 173-181.
Besnard G, Khadari B, Villemur P and Berville A, (2000).
Cytoplasmatic male-sterility in the olive (Olea europaea
L.). Theor. Appl. Genet. 100: 1018-1024.
Bitonti MB, Coza R, Chiappetta A, Contento A, Minelli S,
Ceccarelli M, Gelatis MT, Maginis MT, Baldoni L and
Cionini PG, (1999). Amount and organization of the
heterochromatin in Olea europaea and related species.
Heredity 83: 188-195.
Claros MG, Crespillo R, Aguilar ML and Canovas FM,
(2000). DNA-fingerprinting and classification of geographically related genotypes of olive tree (Olea europaea L.). Euphytica 2000: 131-142.
Fabbri A, Hormanza JI and Polito VS, (1995). Random
amplified polymorphic DNA analysis of olive (Olea
europaea L.) cultivars. J. Amer. SOC. Hort. Sci. 120:
538-542.
Flavell RB, (1986). Repetitive DNA and chromosome evolution in plants. Philos. Trans. R. SOC.Lond. B. Biol. Sci.
312: 227-242.
Galasso I, Blanco A, Katsiotis A, Pignone D and HeslopHarrison JS, (1 997). Genomic organization and phylogenetic relationships in the genus Dasypyrum analysed by
Southern and in situ hybridization of total genomic and
cloned DNA probes. Chromosoma 106: 53-61.
Gemas VJ, Rijojohansen MJ, Tenreiro R and Fevereiro P,
(2000). Inter-varietal and intra-varietal analysis of 3 Olea
europaea L. cultivars using the RAPD technique. J.
Hortic. Sci. Biotech. 75: 312-319.
Hess J, Kadereit JW and Vargas P, (2000). The colonization
history of Olea europaea L. in Macaronesia based on
internal transcribed spacer 1 (ITS-1) sequences, ran-
domly amplified polymorphic DNAs (RAPD), and intersimple sequence repeats (ISSR). Mol. Ecol. 9: 857-868.
Jukes T and Cantor CR, (1969). Evolution of protein
molecules. In: Mammalian Protein Metabolism. (ed HN
Munro), Academic Press, New York.
Katsiotis A, Hagidimitriou M, Douka A and Hatzopoulos
P, ( I 998). Genomic organization, sequence interrelationship, and physical localization using in situ hybridization
of two tandemly repeated DNA sequences in the genus
Olea. Genome 41: 527-534.
Lapitan NVL, (1992). Organization and evolution of higher
plant nuclear genomes. Genome 35: 171-181.
Li WL, Chen PD, Qi LL and Liu DJ, (1995). Isolation,
characterization and application of a species-specific repeated sequence from Haynaldia villosa. Theor. Appl.
Genet. 90: 526-533.
Lumaret R, Amane M, Ouazzani N, Baldoni L and Debain
C, (2000). Chloroplast DNA variation in the cultivated
and wild olive taxa of the genus Olea L. Theor. Appl.
Genet. 101: 547-553.
Macas J, Pozarkova D, Navratilova A, Nouzova M and
Neumann P, (2000). Two new families of tandem repeats
isolated from the genus Vicia using genomic self-priming
PCR. Mol. Gen. Genet. 263: 741-751.
Nei M, (1987). Molecular Evolutionary Genetics. Columbia
University Press, New York.
Pearson WR and Lipman DJ, (1998). Improved tools for
biological sequence comparison. Proc. Natl. Acad. Sci.
USA 85: 2444-2448.
Pich U and Schubert I, (1998). Terminal heterochromatin
and alternative telomeric sequences in Allium cepa.
Chromosome Res. 6: 315-321.
PIohl M and Ugarkovic D, (1994). Characterization of two
abundant DNAs from the mealworm Tenebrio obscurus.
J. Mol. Evo~.39: 489-495.
Ouazzani N, Lumaret R and Villemur P, (1995). Randomamplified polymorphic DNA analysis of Olive (Olea
europaea L.). J. Amer. SOC.Hort. Sci. 120: 538-542.
Ouazzani N, Lumaret R and Villemur P, (1996). Genetic
variation in the olive tree (Olea europaea L.) cultivated
in Morocco. Euphytica 91: 9-16.
Rallo P, Dorado G and Martin A, (2000). Development of
simple sequence repeats (Ssrs) in olive tree (Olea europaea L.). Theor. Appl. Genet. 101: 984-989.
Rozas J and Rozas R, (1995). DnaSP, DNA sequence
polymorphism: an interactive program for estimating
Population Genetics parameters from DNA sequence
data. Comput. Applic. Biosci. 11: 621-625.
Rozas J and Rozas R, (1999). DnaSP version 3: an integrated program for molecular population genetics and
molecular evolution analysis. Bioinformatics 15: 147175.
Sambrook J, Fritsch EF and Maniatis T, (1989). Molecular
cloning. A laboratory manual. Cold Spring Harbor,
USA: Cold Spring Harbor Laboratory.
Sefc KM, Lopes MS, Mendonca D, Dos Santos MR, Da
Camara Machado ML and Da Camara Machado A,
(2000). Identification of microsatellite loci in olive (Olea
europaea) and their characterization in Italian and
Iberian olive trees. Mol. Ecol. 9: 1171-1173.
Wilkie S, (1997). Genomic DNA isolation, Southern blotting and hybridization. In Plant Molecular Biology. A
Laboratory Manual. (ed MS Clark), Springer-Verlag
Berlin Heidelberg New York. p. 3-15.
Zohary M and Hopf M, (1993). Domestication of plant in
the old world. 2nd ed. Clarendon Press, Oxford.