Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
B IOLOGY 20 - C HAPTER 5 E VOLUTION Nelson pages 132 – 173 1 C HAPTER 5.1 C LASSIFICATION OF O RGANISMS Nelson Reference: Pages 132-139 2 3 C URRICULAR O UTCOMES : 20–B1.5k Explain the fundamental principles of taxonomy, i.e., domains, kingdoms and binomial nomenclature 4 5.1 C LASSIFICATION OF O RGANISMS 10 million different species Biological diversity is a sign of a healthy ecosystem Why? Higher chance that some organisms will survive changes in ecosystem 5 T AXONOMIC S YSTEMS Taxonomy Science of classification according to inferred (presumed) relationships among organisms 2 purposes 1. Identify organisms 2. Provide a basis for recognizing natural groupings of living things True Facts about the Tarsier: http://www.youtube.com/watch?v=6Jz0JcQYtqo&safe=activ e&safety_mode=true H ISTORY OF T AXONOMY 6 ARISTOTLE (384-322 BC) 1st person to attempt classifying animals divided them into groups: “blooded” and “bloodless” Linnaeus (1707 –1778) Created biological system of classification Based on organisms’ physical and structural features The more features in common, the closer the relationship among organisms 7 B INOMIAL NOMENCLATURE Developed by Linnaeus A method of naming organisms by using 2 names Genus alone name – may appear Species name – never appears alone FYI - To hand write – genus name is capitalized, species name is not; both are underlined FYI - To type – genus name is capitalized, species name is not; both are italicized 8 ADVANTAGES TO BINOMIAL NOMENCLATURE: Indicates similarities in: Anatomy Evolutionary ancestry “International language” – like the periodic table! L EVELS OF CLASSIFICATION DOMAIN KINGDOM PHYLUM CLASS ORDER FAMILY GENUS SPECIES Levels of 10 Classification Dandelion Housefly Human kingdom Plantae Animalia Animalia phylum Tracheophyta Arthropoda Chordata class Angiosphermae Insecta Mammalia order Asterates Diptera Primates family Compositae Muscidae Hominidae genus Taraxacum Musca Homo species offincinale domestica sapiens 11 A TRICK TO REMEMBER THE 8 TAXA : Organisms are sorted into a hierarchical system, starting with the broadest category—domain—and progressing through kingdom, phylum, class, order, family, and genus to the most specific category—species. Danish Ingeborg King Phillip Came Over For Green Spinach http://en.wikipedia.org/wiki/Philip_II_of_France The classification system that is most commonly used today has three DOMAINS and a number of KINGDOMS. The three Domains used to classify organisms are Bacteria, Archaea, and Eukarya. Bacteria Eukarya Archaea • Prokaryotic, unicellular organisms • Lack a membranebounded nucleus • Reproduce asexually • Heterotrophic by absorption • Autotrophic by chemosynthesis or by photosynthesis • Move by flagella • Eurkaryotic, unicellular to multicellular organisms • Membrane-bounded nucleus • Sexual reproduction • Phenotypes and nutrition are diverse • Each kingdom has specializations • Flagella, if present, have a 9 + 2 organization • Prokaryotic, unicellular organisms • Lack a membranebounded nucleus • Reproduce asexually • Many are autotrophic by chemosynthesis; some are heterotrophic by absorption • Unique rRNA base sequence • Distinctive plasma membrane and cell wall chemistry 3 DOMAINS , 6 KINGDOMS Six Kingdoms. The four in Eukarya are: Plantae Animalia Protists Fungi D OMAIN : E UKARYA Kingdom: Protista Plantae Fungi Animalia (T ABLE 2 P .137) FOR THE 6 KINGDOMS : Kingdom 23 General characteristics 1. Eubacteria Simple organisms lacking nuclei (prokaryote) Either heterotrophs or autotrophs All can reproduce asexually Live nearly everywhere Cell wall Representative organisms Often present (contains peptidoglycan – made of carbohydrate and protein subunits) Bacteria, cyanobacteria 24 Kingdom 2. Archaebacteria General characteristics Prokaryotic Heterotrophs Live in salt lakes, hot springs, animal guts Cell wall Present (does not contain peptidoglycan) Representative organisms Methanogens, extreme thermophiles, extreme halophiles Kingdom 25 General characteristics Cell wall Representative organisms 3. Protista Most are unicellular (single – celled); some are multicellular; eukaryotic Some are autotrophs; some heterotrophs; some both Reproduce sexually and asexually Live in aquatic or moist habitats Absent Algae; protozoans Kingdom 26 General characteristics 4. Fungi Most are multicellular All are heterotrophs Reproduce sexually and asexually Most are terrestrial Cell wall Present (made of chitin) Representative organisms Mushrooms, yeasts, bread molds 27 Kingdom General characteristics 5. Plantae All are multicellular All are autotrophs Reproduce sexually and asexually Most are terrestrial Cell wall Representative organisms Present (made of Mosses, ferns, conifers, carbohydrates) flowering plants Kingdom 28 General characteristics 6. Animalia All are multicellular All are heterotrophs Most reproduce sexually Live in terrestrial and aquatic habitats Cell wall Absent Representative organisms Sponges, worms, lobsters, starfish, fish, reptiles, birds, mammals 29 K INGDOM E UBACTERIA Escherichia coli cyanobacteria 30 K INGDOM P ROTISTA •Examples: Algae, slime-molds Euglena and Paramecium 31 K INGDOM F UNGI • Examples: yeast and mushrooms 32 J UST FOR F UN : I NKY C AP F UNGI Varieties of the inky cap mushroom can be around the world. While they are edible, ingesting alcohol while eating the mushrooms increases symptoms of nausea and vomiting, and can even cause a heart attack. After the mushroom has released its spores, the cap begins to liquify. The thick black liquid that is seen dripping from the edges is how the inky cap got its name. More info: http://bit.ly/1fWGufI 33 K INGDOM P LANTAE • Examples: mosses, ferns, flowering plants (e.g., buttercup) 34 K INGDOM A NIMALIA • Examples: humans and jellyfish 35 P HYLOGENY History of evolution of a species or a group of organisms 36 P HYLOGENETIC TREE FOR HOMINIDS D ICHOTOMOUS KEY Can be helpful to sort organisms like these… 38 D ICHOTOMOUS A two – part key used to identify living things A series of choices must be made Each choice leads to a new branch of they key KEY 39 D ICHOTOMOUS KEY EXAMPLE : 1. Animal is taller than 1.5 meters ……………….. Go to 2 Animal is smaller than 1.5 meters …………….. Go to 3 2. Animal is black and white …………………….. cow Animal is brown ………………………………… horse 3. Animal has feathers ……………………………. Chicken Animals is pink with curly tail …………………… pig http://dsc.discovery.com/videos/i-was-bitten-brown-recluse-spiderbite.html 43 T ASKS TO BE COMPLETED : Read Chapter 5.1 in your textbook – pages 132-138 Complete Chapter 5.1 Questions: Page 139- #1-3, 5-7 Using a Classification Key – Investigation 5.1 – Textbook pages 162-163 – complete procedure 1-2, and analysis a-d. D IVERSITY IN THE P LANT K INGDOM – A CLOSER L OOK B IOLOGY 35 IB ONLY 46 D IVERSITY IN THE P LANT K INGDOM • The kingdom of the Plantae can be divided into several phyla (DIVISIONS), some of which are: • Phylum Bryophyta: mosses and liverworts • Phylum Filicinophyta: ferns • Phylum Coniferophyta: coniferous plants • Phylum Angiospermatophyta: flowering plants 47 P HYLUM B RYOPHYTA • Live in damp areas and still require water for reproduction • Small, single plants • Do not have vascular tissue or true roots, leaves, or stems • Absorption of water takes place over all surface areas • Mosses do not produce flowers • Male gamete is motile, swimming to the female gamete The moss plant we see is the haploid gametophyte 48 It forms the haploid gametes which meet and a diploid zygote it formed This zygote grows to form a diploid sporophyte, which sits on top of the haploid gametophyte The diploid sporophyte forms haploid spores by meiosis The haploid spores can grow out to form the haploid gametophyte The gametophyte is the dominant stage Bryophyta are homosporous, producing one kind of spore 49 •P HYLUM F ILICINOPHYTA • Vascular plant – they have a specialized transport system: vascular bundles (xylem and phloem) • Have true roots, leaves, and stems • The fern plant we see is the diploid sporophyte • It forms haploid spores by meiosis • The haploid spores can grow out to form the haploid gametophyte, the prothallus The prothallus is a small, flat structure, which produces haploid 50 gametes The gametes meet and form a diploid zygote which can grow out to form the diploid sporophyte Filicinophyta are heterosporous: they form 2 kinds of spores Microspores form the male gametophyte Megaspores form the female gametophyte Filicinophyta do not produce flowers Male gametes are motile and swim to the female gametophyte 51 P HYLUM C ONIFEROPHYTA Vascular plants with true roots, leaves, and stems Sporophyte Gametes is the dominant generation are not motile Heterosporous • Microspores are called pollen grains • Megaspores are called the embryo sac Seeds Plant are not enclosed in an ovary bears no fruit Spores Xylem develop on cones contains only tracheids, vessels are missing; companion cells are absent from phloem 52 P HYLUM A NGIOSPERMOPHYTA Vascular plants with true roots, leaves, and stems Sporophyte generation Gametes is the dominant are not motile Heterosporous Spores develop in flowers Seeds are enclosed in an ovary which develops into a fruit after fertilization Xylem contains vessels, phloem contains companion cells D IVERSITY IN THE A NIMAL K INGDOM – A CLOSER L OOK D IVERSITY IN THE A NIMAL K INGDOM – A CLOSER L OOK Chapter 21 Zebra Book– Pages 370 - 374 P HYLUM P ORIFERA - SPONGES Sponges are a diverse group of sometimes common types, with about 5000 species known across the world. Sponges are primarily marine, but around 150 species live in fresh water. a system of pores and canals, through which water passes. Water movement is driven by the beating of flagellae, which are located on specialized cells They are supported by a skeleton made up of the protein collagen and spicules, which may be calcareous or siliceous, depending on the group of sponges examined. Sponges capture food (detritus particles, plankton, bacteria) that is brought close by water currents created by the flagellae. Food items are taken into individual cells by phagocytosis, and digestion occurs within individual cells. P HYLUM C NIDARIA - CNIDARIANS The Phylum Cnidaria includes such diverse forms as jellyfish, hydra, sea anemones, and corals. Aggressive predators that have specialized tissues for hunting Muscle like contractile cells organized into tenticles allowing cnidarians to catch their prey Cnidocytes = stinging cells containing coiled filaments with a poison barb on the end – when cnidocyte touches prey, barb lauched like harpoon Have a nervous system that cooridanates the activities of the cnidocytes and tentacles Cnidarian bodies have two or sometimes three layers. gastrovascular cavity has a single exterior opening that serves as both mouth and anus. Often tentacles surround the opening. C NIDARIANS CONTINUED … Cnidarians have two basic body forms, medusa and polyp. Medusae, such as adult jellyfish, are free-swimming Polyps, in contrast, are usually sessile. They have or floating. They usually have umbrella-shaped bodies and tetramerous (four-part) symmetry. The mouth is usually on the concave side, and the tentacles originate on the rim of the umbrella. tubular bodies; one end is attached to the substrate, and a mouth (usually surrounded by tentacles) is found at the other end. Polyps may occur alone or in groups of individuals P HYLUM P LATYHELMINTHES - FLATWORMS Flatworms are unsegmented, bilaterally symmetrical worms that lack a coelom (acoelomate) but that do have three germ layers. Some forms are free living, others are decomposers, but many are parasitic. Sensory receptors and nerve ganglia are located at the anterior end T HREE CLASSES OF FLATWORMS : Turbellaria – live in oceans, lakes, ponds, moist places on land 1. Example – Planarians- found in freshwater – secrete a slime track and beating cilia allow for movement Digestive systems are incomplete – similar to cnidarians Mouth in middle of body 2. T REMATODA parasites commonly called flukes Contain protective body coverings that prevent them from being digested Typically have two suckers to attach to host and suck nutrients Cause schistosomiasis in humans – eggs clog arteries, cause allergic reactions, well and damage to organs – “old disease” - found in Egyptian mummies 3. C ESTODA tapeworms- parasitic – live in digestive tracts of host Do not have a mouth, digestive system, or sense organs but do have a nervous and excretory system Scolex – knob shaped head with hooks, suckers or both P HYLUM A NNELIDA - SEGMENTED WORMS The annelids include earthworms, polychaete worms, and leeches. All members of the group are to some extent segmented, in other words, made up of segments that are formed by subdivisions that partially transect the body cavity. Segments each contain elements of such body systems as circulatory, nervous, and excretory tracts. Fluid in coelom in earthworms serves as a hydrostatic skeleton Circular and longitudinal muscles relax and contract in coordination with setae to propel the earthworm forwards P HYLUM M OLLUSCA Mollusks include: snails, clams, squids, octopuses Contain a muscular foot that is used from locomotion or attachement Contains mucus secreting cells Containt a mantle – soft, outer layer of their bodies, which for most mollusks, produce a protective shell Between the mollusk’s foot and mantle is the visceral mass which contains most of the internal organs P HYLUM A RTHROPODA Arthropods include an incredibly diverse group of taxa such as insects, crustaceans, spiders, scorpions, and centipedes. Arthropods are invertebrates that are bilaterally symmetrical with segmented bodies The body is covered with an exoskeleton made up primarily of chitin (a tough polysaccharide) Most segments have paired, jointed appendages (body extensions like antennae or legs) Most arthropods have a pair of compound eyes and one to several simple ("median") eyes or ocelli; either or both kinds of eyes may be reduced or absent in some groups D IFFERENT C LASSIFICATIONS Kingdom Animalia (animals) Eumetazoa (metazoans) Bilateria (bilaterally symmetrical animals) Phylum Orthonectida (orthonectids) Phylum Rhombozoa (rhombozoans) Deuterostomia (deuterostomes) Phylum Chordata (chordates) Phylum Hemichordata (hemichordates) Phylum Echinodermata (echinoderms) Protostomia (protostomes) Phylum Arthropoda (crustaceans, insects, spiders, and relatives) Phylum Tardigrada (water bears) Phylum Onychophora (velvet worms) Phylum Kinorhyncha (kinorhynchs) Phylum Loricifera (loriciferans) Phylum Nematoda (nematodes) Phylum Nematomorpha (gordian worms and horsehair worms) Phylum Priapula (priapulans) Phylum Cycliophora Phylum Gnathostomulida (gnathostomulids) Phylum Ctenophora (comb jellies) Phylum Cnidaria (cnidarians) Phylum Myxozoa (ciliated protozoans) Phylum Placozoa Phylum Porifera (sponges) 71 K INGDOM A NIMALIA C ONTINUED Lophotrochozoa Lophophorates (lophophorates) Phylum Brachiopoda (lamp shells) Phylum Bryozoa (bryozoans, ectoprocts, and moss animals) Phylum Phoronida (phoronids) Trochozoa Phylum Annelida (segmented worms) Phylum Mollusca (mollusks) Phylum Chaetognatha (arrow worms) Phylum Entoprocta (entoprocts) Phylum Gastrotricha (gastrotrichs) Phylum Nemertea (proboscis worms) Phylum Rotifera (rotifers) Phylum Sipuncula (sipunculan worms) Phylum Platyhelminthes (flatworms) Ecdysozoa C HAPTER 5.2 E VIDENCE OF A C HANGING E ARTH Nelson Reference: Pages 140-143 77 78 C URRICULAR O UTCOMES : 20–B2.4k Summarize and describe lines of evidence to support the evolution of modern species from ancestral forms, i.e., fossil record, Earth’s history, embryology, biogeography, homologous and analogous structures, biochemistry 20–B2.1sts Explain that scientific knowledge and theories develop through hypotheses, the collection of evidence through experimentation, observation and the ability to provide explanations 79 5.2 E VIDENCE OF A C HANGING E ARTH Types of evidence include: Fossil records Geographic distribution of species Comparative anatomy Embryology Behavior Plant and animal breeding Biochemistry Genetics 80 I.) E VIDENCE FROM FOSSILS Paleontology Study of fossils 250 000 fossil species discovered Fossilized: Burrows, footprints, chemical remains However, most organisms do NOT leave any evidence 81 F ORMATION OF FOSSILS Hard parts of organisms Teeth, shells, and bones Resist action of weathering for long periods of time, in dry environments Insects may become entrapped in amber (hardened gum given off by trees) 82 F OSSILIZED AMBER 83 S OFT PARTS OF ORGANISMS Impressions or imprints of plants and animals Tracks made in soft mud, and fecal material of animals Intracellular spaces of skeletal material of animals or plants Replaced with mineral matter Silica, calcite, or iron compounds 84 D ATING THE PAST Relative dating – deeper sedimentary rock layers means formed earlier = older fossil! 85 A BSOLUTE D ATING - R ADIOACTIVE Technique used to determine age of a rock or fossil by determining the rate at which radioactive isotopes decay Oldest fossil is ~ 3.8 billion years old Age of Earth is ~ 4.6 billion years old DATING Fossil Record and Geological Time: A closer look... Geologists have developed a relative time scale for dating rocks and fossils The geologic time scale is a series of major and minor divisions that correspond to major evolutionary events 87 4.6 BILLION YEARS IN ONE HOUR ! 88 F INDINGS FROM FOSSIL EVIDENCE Different species lived on Earth at various times in past Very few of today’s species were alive 1 million years ago Almost all are now extinct 2. Complexity of living organisms generally increases from most distant past to present Progression from very simple organisms to species of complexity 3. Living species and their closely related matching fossils live in same geographic region 1. M ISSING L INKS Scientists at the University of Oslo have discovered “Ida,” Aka. Darwinius masillae A 47-million-year-old fossil that has been proclaimed the “missing link” in connecting human skeletal structure to early mammals. she has certain undeniable human characteristics such as forward facing eyes and even an opposable thumb. 19 May 2009 90 E VIDENCE FROM B IOGEOGRAPHY Biogeography Study of geographic distribution of life on Earth 91 P LATE T ECTONICS Explains changes in position of continental land masses Theory of plate tectonics Explains how Earth changed from a single supercontinent (225 million years ago), Pangea, to present continents Species older than 150 million years old were on same continents Species younger than 150 million years old were on separate continents Thus, they developed AFTER break up of Pangea 93 P ANGEA Limited distribution of mammals EXAMPLES : Limited distribution of marsupials in Africa, Australia, and South America Amphibians and reptiles Arose during time of supercontinent - are widely distributed on practically all continents 94 S EE ANYTHING INTERESTING ABOUT THIS GRAPHIC ? 95 P LATE TECTONICS – ( JUST FOR FUN ) WHAT REALLY HAPPED ! http://www.youtube.com/watch?v=TzzGPfVx32M &safety_mode=true 96 C RASH C OURSE B IOLOGY http://www.youtube.com/watch?v=P3GagfbA2vo& safety_mode=true 97 T ASKS TO BE C OMPLETED : Read Chapter 5.2 in your textbook: Pages 140-143 Complete 5.2 Questions – Page 143 # 1-2 Optional - Evolution and Time Interactive Web Activity – PBS website http://www.pbs.org/wgbh/evolution/educators/lessons/lesson3 /act1.html 5.3 E VIDENCE OF EVOLUTION FROM BIOLOGY Nelson Reference: Pages 144-149 98 99 5.3 E VIDENCE OF E VOLUTION FROM B IOLOGY Includes physical anatomy and genetic makeup of organisms 100 E VIDENCE FROM ANATOMY A comparison of anatomies of various organisms suggests that organisms with similar structures evolved from a common ancestor 101 H OMOLOGOUS STRUCTURES Have similar origin but different uses in different species Example: Front flipper of a dolphin and forelimb of a cat 102 A NALOGOUS STRUCTURES Are similar in function and appearance but not in origin Examples Wing of an insect and wing of a bird Human eye and Octopus Eye Shark and Dolphin Streamlined bodies 103 A NALOGOUS S TRUCTURES EXAMPLE : Recall placental vs. marsupial mammals don’t share a common ancestor until before the breakup of Pangea development of similar adaptions from unrelated species Due to adaptation to similar environmental conditions 104 E MBRYONIC DEVELOPMENT During late 1800s Scientists noted striking similarity between embryos of different species Many structures in an embryo are similar to those found in common ancestors View video clip – Common Pasts, Different Paths 105 Can you identify which embryo is the human, chicken, fish, tortoise, hog, calf, salamander, or rabbit? 106 V ESTIGIAL FEATURES AND ANATOMICAL ODDITIES Vestigial features Rudimentary structures with no useful function Perhaps were once functional in an ancestor Whale skeletons have vestigial hip and leg bones 107 M ORE • • EXAMPLES OF VESTIGIAL STRUCTURES human appendix, coccyx (tail bone), muscles which move the ears Are we descended from animals in which these structures were useful? From an old science text (now out of print). This shows that tail on a human baby. This is not common but also not rare. The tail is removed surgically. 108 II.) E VIDENCE FROM B IOCHEMISTRY All organisms share similar DNA molecules and certain proteins Eg. Pig insulin used to be used to treat type I diabetes We now use genetically modified bacteria that have the human insulin gene inserted into it! Example: amino acid sequencing between human, rhesus monkey, mouse, chicken, frog, and lamprey Differences reflect degree of similarity 109 S IMILARITIES IN THE G ENETIC CODE DNA (Deoxyribonucleic acid) Hereditary material in cells Each DNA molecule contain many different genes Gene – a segment of DNA that performs a specific function 110 DNA C ODE IS U NIVERSAL ! Composed of 4 nucleotide bases arranged in different sequences Adenine (A), thymine (T), cytosine (C), guanine (G) DNA sequences from different species that code for the same protein vary in # and order of nucleotides Part of a Cow milk protein sequence of DNA: AGTCCCCAAAGTGAAGGAGACTATGGTTCCTAAGCACAAG GAAATGCCCTTCC 111 E VIDENCE FROM A RTIFICIAL S ELECTION Process of humans selecting and breeding individuals with desired traits Dramatic changes are produced in a species over a relatively short period of time 112 A RTIFICIAL S ELECTION 113 A RTIFICIAL S ELECTION - DOGS 114 T ASKS TO BE COMPLETED Read pages 144-149 of your textbook Complete Chapter 5.3 Questions – Page 149 - #1-3 Optional: Lab Exercise 5.A – Evidence from Genetics – Page 147 – complete letters Optional: Internet Web Quest Assignment – Evidence of Evolution http://www.pbs.org/wgbh/evolution/educators/lessons/lesson3 /act2.html 5.4 T HE M AKING A CCOUNTING FOR THE Nelson Reference: 150-152 115 T HEORY – E VIDENCE OF A 116 C URRICULAR O UTCOMES : 20–B2.3k Compare Lamarckian and Darwinian explanations of evolutionary change 20–B2.1sts Explain that scientific knowledge and theories develop through hypotheses, the collection of evidence through experimentation, observation and the ability to provide explanations 117 5.4 T HE M AKING OF A T HEORY – A CCOUNTING FOR THE E VIDENCE Scientific theory A model that accounts for all of the known scientific evidence Plausible explanation May be altered or modified as new data is gained 118 119 E XAMPLE – C HANGING I DEAS OF WHAT OUR EARLY ANCESTORS MAY OF LOOKED LIKE Lucy recently underwent a ‘makeover’ due to newly discovered fossils. Earlier reconstructions showed Lucy, who is an example of one of Homo sapiens’ ancestors Australopithecus afarensis, with a cone-shaped thorax and potbelly. In the last few years, researchers have found additional ribs and a new foot bone of A. afarensis. The ribs were curved, which translates to a barrel-shaped thorax like modern humans, while the foot bone showed a distinct arch. More about Australopithecus afarensis:http://bit.ly/1eEQE Cy; http://bit.ly/18WAUmq 120 W HAT HAPPENED TO THE WOOLY MAMMOTHS ? The new evidence from over 300 mammoth remains strongly suggests that the mammoth population decline happened 20,000 years ago, not 14,000 years ago as previously thought. This better correlates with the changing climate than an influx in human hunters. More info: http://bbc.in/15QgVvo Photo credit: Science Photo Library D EVELOPING T HEORIES ABOUT HOW POPULATIONS C HANGE OVER TIME ( EVOLVE ) 121 122 L AMARCK ’ S THEORY OF A CQUIRED CHARACTERISTICS Presented 1st theory of evolution that included a mechanism Organisms had a “desire” or “force” that led them to change for the better Organisms can produce new parts or get rid of unwanted parts Use and disuse of certain structures would be passed on to offspring Organisms eventually adapted to their environment 123 L AMARCKISM Describes “inheritance of acquired characteristics” False concept of inheritance of features acquired during an individual’s life 124 II.) D ARWIN ’ S THEORY In 1831, a five – year voyage on the ship, Beagle Provided Darwin with opportunity to study diverse life forms From South America to South Sea Islands 125 Darwin – mid 1800’s Published the Origin of Species by Means of Natural Selection based on his investigations while on board the 5 year world voyage aboard the Beagle Much of his evidence for the theory of natural selection was his studies of the finches of the Galapagos Islands (1000 km west of Ecuador) 126 127 G ALAPAGOS I SLANDS : A E COSYSTEM UNIQUE I SLAND 128 129 D ARWIN AND OTHER CONTRIBUTING SCIENTISTS Malthus’ essay on populations All species produce more offspring than are able to survive Thus, Darwin realized that competition exists Wallace’s paper sent to Darwin Wallace traveled extensively Independently arrived at the same conclusions as Darwin 130 D ARWIN ’ S T HEORY OF N ATURAL S ELECTION CONDENSED INTO 5 KEY POINTS ! 1. Overproduction Number of offspring produced by a species is greater than can survive and reproduce (from Malthus’ Essay) 131 2. S TRUGGLE FOR EXISTENCE Organisms of the same species (and other species) must compete for the same limited resources 132 3. VARIATION No two individuals are exactly alike (except identical twins). Sexual reproduction creates variability in a population Offspring inherit most of parent’s traits, but not all of them. Some traits arise randomly (eg. by genetic mutation) Eg. A genetic mutation in Africa has led to some individuals being immune to AIDS Eg. Silent crickets in Hawaii 133 4. S URVIVAL OF THE FITTEST The environment acts to select favorable traits (not create them). Those with an advantage survive and reproduce, increasing their numbers. This is selection by nature, hence natural selection 134 5. S PECIATION Individuals do not change, populations change over time. Accumulation of new traits over a long period of time ---> population so different ---> new species. Source: http://evolution.berkeley.edu/evosite/evo101/VBDefiningSpeciation.shtml 135 D ARWIN ’ S G IRAFFES … EXPLAIN EVOLVED LONG NECKS O S V S S HOW THEY 136 L AMARCK VS . D ARWIN ’ S G IRAFFES 137 T ASKS TO BE COMPLETED Read Chapter 5.4 in Your textbook – Pages 150-152 Section 5.4 Questions – Page 152 - #1-2 Peppered Moth Case Study – Workbook Optional: Survival of the Sneakiest Cartoon Optional: Who was Charles Darwin? Internet Assignment http://www.pbs.org/wgbh/evolution/educators/lessons/l esson2/index.html Section 5.2 Questions # 1-2 - answers 5.5 S OURCES OF I NHERITED V ARIATION 139 140 C URRICULAR O UTCOMES 20–B2.1k Explain that variability in a species results from heritable mutations and that some mutations may have selective advantage(s) 20–B2.2k Discuss the significance of sexual reproduction to individual variation in populations and to the process of evolution M UTATIONS 142 MUTATIONS MUTATIONS are RANDOM CHANGES in DNA -your DNA (your GENES) is what codes for every structure in your body -DNA is HEREDITARY -Your DNA is ½ from Mom, ½ from Dad Mutations can be “bad” (harmful) -ex. sheep born without a uterus -the ewe will not pass on her DNA -this mutation has no advantage B ENEFICIAL MUTATIONS Mutations can be “good” (beneficial) -ex. a cheetah is born with the ability to run faster than the others -helps it to survive; it gets more food! -this mutation has a SELECTIVE ADVANTAGE -this mutation likely WILL be passed on to it’s offspring House Fly There is a mutation in house flies that makes them resistant to the insecticide DDT. 145 H YPERTRICHOSIS … HARMFUL , NEUTRAL MUTATION ? BENEFICIAL OR Hypertrichosis is also called “werewolf syndrome” or Ambras syndrome, and it affects as few as one in a billion people; and in fact, only 50 cases have been documented since the Middle Ages. People with hypertrichosis have excessive hair on the shoulders, face, and ears. Studies have implicated it to a rearrangement of chromosome 8. http://io9.com/10-unusual-genetic-mutations-in-humans-470843733 R ECALL MUTATION CREATES VARIABILITY ! MUTATIONS = DIVERSITY! Accumulation of mutations over 100’s or 1000’s of years may lead to SPECIATION -formation of a new species Scientists look to Hawaii’s bugs for clues to origins of biodiversity One species of spider (Tetragnatha anuenue) on the Big Island of Hawaii shows an extraordinary diversity of color, that is matched by genetic variability. This variability seems to serve as the raw material for subsequent divergence and formation of new species over the course of tens or hundreds of thousand years. W HAT CAUSES MUTATIONS ? environmental factors (chemicals, radiation, etc.) spontaneous mistakes - ex. when cells are copying their DNA (before making new cells) 148 C HECK Y OUR U NDERSTANDING … 1. What is a Mutation? 2. Why are mutations important to the survival of a species over time? 3. What are causes of mutations? Tasks to be Completed For Chapter 5.5 Read Pages 153-156 of your Text book Complete #1-3 on page 156 Start Unit B Review – Page 170 #1-14 Key to Questions #1-3 on page 156 1. Darwin was unaware of the source of variation — sexual reproduction and mutation. 2. Short-term variation is derived from the shuffling of genetic combinations through sexual reproduction. Longterm variation in a population is achieved by the introduction of new genes by mutation. 3. Indigenous populations had never been exposed to these diseases, so their population did not contain large numbers of people with resistance to these diseases. The disease acts as a selecting agent. After several generations of exposure, indigenous people have evolved a resistance similar to that of the European settlers. C HAPTER 5.6 S PECIATION AND E VOLUTION 151 152 C URRICULAR OUTCOMES : 20–B2.5k Explain speciation and the conditions required for this process 20–B2.6k Describe modern evolutionary theories, i.e., punctuated equilibrium versus gradualism 153 5.6 S PECIATION AND E VOLUTION I.) Speciation Formation of new species Species A population of individuals who are reproductively isolated Not capable of breeding with individuals of other species under natural conditions 154 A LLOPATRIC SPECIATION – SPECIATION BY REPRODUCTIVE ISOLATION 1. A physical barrier separates a single interbreeding population into 2 or more groups Groups are isolated from each other Any mutations that occur in these groups are not shared with other populations From large to small physical barriers Mountain ranges, oceans, river channels, canyons, dams, canals 155 2. N ATURAL SELECTION WORKS ON SEPARATED GROUPS INDEPENDENTLY Results in inherited differences in the 2 populations I.e., populations evolve independently Differences in selective pressures will be greater the more pronounced the environmental differences 156 3. In time, accumulated physical and / or behavioral populations are pronounced that groups cannot reproduce with each other If reunited, individuals of these 2 groups are not sexually compatible Thus, the formation of two or more distinct species Note: this is only for fun and there is no such thing as unicorns 157 OH WAIT , THERE ARE UNICORNS ! B ETTER E XAMPLE : “D ARWIN ' S F INCHES ” They became different species, of finch, as they were geographically isolated from the mainland, and over time the food source they were best adapted to (via their beak variation) distinguished them from each other = speciation. 159 P ART II.) R ATE OF E VOLUTION Theory of gradualism theory that changes to species happen at a slow, steady pace -would expect many fossils to also show minor changes over time -this is not always the case... often distinct species suddenly appear... The fossil record suggests whales gradually evolved from land to water. 160 T HEORY OF PUNCTUATED EQUILIBRIUM Proposed by Eldridge and Gould 3 assertions: 1. Many species evolve rapidly in evolutionary time 2. Usually occurs in small isolated populations 3. Dr. Niles Eldridge Intermediate fossils are rare After an initial burst of evolution, species are well adapted to their environment They do not significantly change over long periods of time Dr. Stephen Jay Gould 161 G RADUALISM VS . PUNCTUATED EQUILIBRIUM 162 T ASKS T O B E C OMPLETED Read Pages 157-161 in your textbook Complete Section 5.6 Questions – Page 161 #1, 4-5 Optional: Web Activity – Lactose Intolerance and Evolution – Page 158 Text Web Activity – Peppered Moth Simulation – Page 161 Prepare for a Unit Exam!!! Chapter 5 Review: Page 168-169 # 1-10 Unit B Review Pages 170-173 #2-3, 12-14, 36-37 Section 5.6 Questions – Page 161 #1, 4-5 1. First, a physical barrier separates a single interbreeding population into two or more groups that are reproductively isolated from each other. Any mutations that occur in these isolated groups are not shared with the entire population. Second, natural selection works on the separated groups independently, resulting in inherited differences in the two populations. In other words, the populations evolve independently. Differences in selective pressures will be greater if the populations experience pronounced differences in their environments. Finally, over time, accumulated physical and/or behavioural differences between the populations become so pronounced that the groups, should they be reunited, would no longer be sexually compatible. At this point, they have formed two or more distinct species. Section 5.6 Questions – Page 161 #1, 4-5 4. According to the theory of gradualism, we would expect to find many fossils that show small changes in species over time. Instead, distinct species often appear abruptly in the fossil record, and then little further change is seen over very long periods of time. O N A SIDE TOPIC … 165 166 D O EVOLUTIONIST SCIENTISTS SUGGEST THAT HUMANS HAVE EVOLVED FROM MONKEYS OR APES ? No! So how did humans evolve? Who were our ancestors and what did they look like? 167 W HO ARE OUR CLOSEST LIVING RELATIVES ? H OW ARE WE RELATED TO MONKEYS , APES AND GORILLAS ? O UR EVOLUTIONARY J OURNEY WAS MUCH MORE 168 COMPLEX AND IS STILL DEBATED AMONG SCIENTISTS TODAY 169 170 171 A PHYLOGENIC T REE FOR THE E VOLUTION OF H UMANS 172 W HERE N EWLY D ISCOVERED “ HOBBIT ” INTO EVOLUTION OF HUMANS ? DO THE SPECIES FIT 173 H OW HUMANS POPULATED THE WORLD 174 H OW DID THE EVOLUTION OF DIFFERENT RACES OCCUR IN THE HUMAN POPULATION ? 175 T HE E VOLUTION VS . C REATIONISM D EBATE 176 T HE S CIENCE / R ELIGION D ICHOTOMY I T ’ S EITHER OR AND NOTHING IN BETWEEN …. Atheist View Creationist View However, the spectrum of beliefs is actually much more complicated in today’s society with a range of beliefs that fall inbetween D R , D R , D R .( NOT A TYPO ) D ENIS O. L AMOUREUX 177 Lamoureux's academic specialty focuses on the modern origins controversy. In "Beyond the 'Evolution vs. Creation' Debate" he argues that the simple either/or approach to origins inhibits everyone from making informed choices. He asserts that if the limits of both conservative Christianity and evolutionary biology are respected, then their relationship is not only complementary, but also necessary. This view of origins is known as Evolutionary Creation. Concisely stated, it claims that the Father, Son and Holy Spirit created the universe and life through an ordained and sustained evolutionary process. Lamoureux holds three earned doctoral degrees: dentistry, theology, and biology. Lamoureux has developed a summarized table of the spectrum of beliefs that exist Chapter 5 Review (Pages 168–169) Part 1 1. D 2. C 3. D 4. B 5. D 6. D 7. C 8. 3, 2, 1, 4 9. 1, 4, 2, 3 10. 1, 4, 3, 2 Unit B Review (Pages 170–173) Part 1 2. D 3. C 12. D 13. 1, 3, 6, 7 14. 2, 4, 3, 1 36. (a) Lamarck would suggest that in reaching for food, giraffes stretched their necks slightly. This acquired trait, a slightly longer neck (resulting from stretching), would be passed on to the giraffe’s offspring. Darwin would suggest that neck length was variable and those giraffes with the longest necks were better able to survive and have offspring. The offspring would inherit the trait from their parents. (b) Lamarck would suggest that the continual chasing of prey by the cheetahs would result in their becoming better and faster runners. This acquired trait would then be passed on. Darwin would counter that regardless of the “training,” some cheetahs are inherently faster runners and would be able to catch more food and have more offspring than the slower cheetahs. These cheetahs would be more likely to pass the trait of speed to their offspring. 37. (a) The chance of any particular gene mutating is extremely small; however, most organisms have extremely large quantities of DNA, and it is estimated that most gametes carry at least one mutation. Therefore, mutations are not rare events from the perspective of an individual. However, as most mutations are neutral and have no obvious effect on the phenotype of the individual, they go completely unnoticed. (b) With extremely large numbers of individuals reproducing over long periods, mutations are extremely common. (c) The mutation rate within an elephant population would be much lower than that within a bacterial population. Bacteria have a very large population