Download Bacterial transfer of large functional genomic DNA into

Gene Therapy (2005) 12, 1559–1572
& 2005 Nature Publishing Group All rights reserved 0969-7128/05 $30.00
www.nature.com/gt
RESEARCH ARTICLE
Bacterial transfer of large functional genomic DNA into
human cells
A Laner1,7, S Goussard2,7, AS Ramalho3, T Schwarz1, MD Amaral3,4, P Courvalin2, D Schindelhauer1,5,6
and C Grillot-Courvalin2
1
Department of Medical Genetics, Childrens Hospital, Ludwig Maximilians University, Munich, Germany; 2Unité des Agents
Antibactériens, Institut Pasteur, Paris, France; 3Centre of Human Genetics, National Institute of Health Dr Ricardo Jorge, Lisboa,
Portugal; 4Department of Chemistry and Biochemistry, Faculty of Sciences, University of Lisboa, Lisboa, Portugal; 5Institute of Human
Genetics, Technical University, Munich, Germany; and 6Livestock Biotechnology, Life Sciences Center Weihenstephan, Freising,
Germany
Efficient transfer of chromosome-based vectors into mammalian cells is difficult, mostly due to their large size. Using a
genetically engineered invasive Escherichia coli vector,
alpha satellite DNA cloned in P1-based artificial chromosome
was stably delivered into the HT1080 cell line and efficiently
generated human artificial chromosomes de novo. Similarly,
a large genomic cystic fibrosis transmembrane conductance
regulator (CFTR) construct of 160 kb containing a portion of
the CFTR gene was stably propagated in the bacterial vector
and transferred into HT1080 cells where it was transcribed,
and correctly spliced, indicating transfer of an intact and
functional locus of at least 80 kb. These results demonstrate
that bacteria allow the cloning, propagation and transfer of
large intact and functional genomic DNA fragments and their
subsequent direct delivery into cells for functional analysis.
Such an approach opens new perspectives for gene therapy.
Gene Therapy (2005) 12, 1559–1572. doi:10.1038/
sj.gt.3302576; published online 23 June 2005
Keywords: gene delivery; bacterial E. coli vector; human artificial chromosome; CFTR
Introduction
For functional analysis of genomic DNA of higher
eukaryotes, stable cloning of large genomic fragments
is well established in bacterial artificial chromosomes
(BACs) and in P1-based artificial chromosomes (PACs)
that are single-copy artificial chromosomes in Escherichia
coli based on the F factor and P1 phage replicons,
respectively.1,2 BACs and PACs can contain the majority
of human genomic loci; most of them are comprised
between 27 and 72 kb in size with just B4% larger than
140 kb.3 In addition, BACs and PACs allow the stable
cloning of highly repetitive sequences, which have
proven to be unstable in other cloning systems, as
demonstrated for larger than 100 kb of highly homogeneous alpha satellite tandem repeat arrays of human
centromeres.4
Successful gene therapy requires persistent tissuespecific expression of the transgene and could be
optimally achieved by delivery of complete loci of
genomic DNA of interest including native regulatory
and promoter elements. To avoid random integration
into the host chromosomes and allow stable inheritance,
additional genetic elements are required. These are based
Correspondence: C Grillot-Courvalin, Unité des Agents Antibactériens,
Institut Pasteur, 25-28 rue du Docteur Roux, 75724 Paris cedex 15,
France and D Schindelhauer, Livestock Biotechnology, Life Sciences
Center, TUM, Hochfeldweg 1, 85354 Freising-Weihenstephan, Germany
7
These authors contributed equally to this work
Received 10 February 2005; accepted 22 May 2005; published online
23 June 2005
either on viruses or, to circumvent viral protein expression, on natural host mechanisms. The most important of
these elements is a functional centromere. Human
artificial chromosomes (HACs) based on alpha satellite
DNA as the only human component in a circular PAC or
on linear, telomerized alpha satellite DNA, faithfully
replicate and segregate during mitosis for many cell
divisions even in the absence of selection.5 Specific alpha
satellite DNA arrays from various human chromosomes,
such as chromosomes 14, 17, 21, 22, X (and Y
inefficiently), have been transferred as purified DNA in
order to form centromeres on de novo HACS.5–13 The
centromeres formed on the transferred DNA acquire
chromatin proteins specific for functional centromeres
such as CENP-A a histone H3 variant, only found within
active centromere chromatin.13 Moreover, complete
genes can be incorporated into HACs and expressed, as
shown for human HPRT (42 kb),14,15 or GCH1 genes
(61 kb).16
However, most gene delivery systems do not allow
efficient transfer of large (4100 kb) DNA fragments into
mammalian cells, thus limiting their functional analysis.
The currently used viral derived vectors do not provide
sufficient packaging capacity. High-capacity herpes
simplex virus-based amplicon vectors are an exception
but still cannot accommodate loci larger than 150 kb.17
Nonviral delivery systems based on lipofection, combined or not with polycations, have no size limits and
have therefore been used with some success to transfer
intact BAC DNA, both in vitro and in vivo.18 However,
this technique requires production and purification of
Bacterial transfer into human cells
A Laner et al
1560
the DNA construct in significant amounts prior to
transfection, a step that can in some cases impair its
physical intactness.
We have shown that invasive E. coli, which undergo
lysis upon entry into mammalian cells because of
impaired cell wall synthesis due to diaminopimelate
(dap) auxotrophy, can efficiently deliver plasmid DNA to
host mammalian cells.19 Plasmid pGB2Oinv-hly containing the inv gene from Yersinia pseudotuberculosis and the
hly locus from Listeria monocytogenes has been introduced
into the dap auxotroph E. coli BM2710. The inv gene
confers to E. coli the ability to invade nonphagocytic cells
provided they express b1-integrins. The hly gene
product, listeriolysin O, is a pore-forming cytolysin that
allows escape of the bacteria, or of its cytoplasmic
content, from the vacuole of entry. Transfer of functional
DNA into a variety of mammalian cell lines occurs after
simple coincubation with the bacterial vector.20 Recombinant-deficient E. coli DH10B is widely used for the
propagation of BAC clones. Recently, a dap DH10B
derivative, similarly made invasive by transformation
with pGB2Oinv DNA was able to mediate transfer into
HeLa cells of a 200 kb BAC plasmid, as demonstrated by
EGFP expression 48 h after transfection.21
We have used the recombination-deficient and dap
auxotroph strain E. coli BM2710 expressing the invasin
and listeriolysin O to deliver three large PAC-derived
vectors into HT1080, a telomerase-proficient human lung
sarcoma cell line often used to analyse HAC formation
due to its relatively stable pseudotetraploid karyotype.
These vectors included two PACs containing alphoid
DNA, TTE122 and B2T8, of 150 and 200 kb, respectively,
which could form HACs upon cell transfer, and an
engineered 160 kb PAC construct, CGT21, which contains a large portion of the human locus containing the
cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene fused to the EGFP gene as a marker.23
We demonstrate, for the first time, that bacterial gene
delivery systems allow stable clone formation after
transfer into cells of low copy number genetic elements
of large size, either through the formation of free
episomal HACs or through their integration into the
host chromosome. Moreover, bacteria allow transfer of
functional DNA of at least 80 kb, as demonstrated by
expression and correct splicing in stable cell lines of the
transferred construct.
Results
Invasive E. coli can stably propagate PAC-based
constructs
PAC vectors are usually stably maintained and propagated in recA1 E. coli DH10B after introduction by
electrotransformation. We tested if recA1 strains
BM2710 and BM4573, both derivatives of E. coli
MM294,24 were also able to propagate stably PAC-based
constructs. The three P1-derived plasmids used, TTE1,
B2T8 and CGT21 (Figure 1), are compatible and can
therefore coexist with pGB2Oinv-hly in E. coli BM2710.
Figure 1 Maps of the plasmids used. (a) Plasmid TTE1 carries ca. 116 kb of a-satellite DNA from the centromeric region of human chromosome 5. The
array was cloned as a NotI fragment from P1 artificial chromosome (PAC) E1 into the Bsp120 I site of the tetratelomeric PAC vector pTT. The pTT vector
was derived from pTAT-BS by insertional duplication of vector portions, including telomeres, that resulted in tandem repeated vector sequences. An EGFPcDNA cassette (CMV/EGFP), two blasticidin S resistance genes (BS) and 2 pairs of telomeres (TTAGGG)n ¼ 135 (arrows) are present along with the unit
copy replicon of phage P1 (P1). The location of primer pairs used to analyse the constructs by PCR are shown as black dots (5IF/5IR is present in multiple
copies (ca. 340-fold) in the 0.34 kb higher order repeats throughout the array). (b) Plasmid B2T8, a ditelomeric PAC containing approximately 190 kb of asatellite DNA from human chromosome 17, was constructed by subcloning the NotI cut PAC B2 in the Bsp120 I site of pTAT-BS. The location of primer
pairs is indicated by black dots (17-1A/17-2A is present, ca. 70-fold, in the 2.6 kb higher order repeats). (c) Plasmid CGT21 was engineered by cloning from
a PAC containing the human CFTR locus from approximately 60 kb 50 to the middle of intron 9. To this CFTR region, a synthetic CFTR-EGFP fusion,
composed of CFTR intron 9/exon 10 sequences, the EGFP cDNA CFTR exon 24 and 30 UTR and an additional 2 kb 30 region of the CFTR gene, was fused in
frame. The construct was then cloned as a NotI fragment into the Bsp120 I site of the ditelomeric PAC vector pTAT-BS containing a blasticidin S resistance
gene (BS).
Gene Therapy
Bacterial transfer into human cells
A Laner et al
Circular DNA from the three PAC plasmids, TTE1, B2T8
and CGT21 isolated from agarose plugs prepared from
strain DH10B, was introduced by electrotransformation
into E. coli BM2710/pGB2Oinv-hly and BM4573. Structural integrity and stable propagation of the plasmids in
the new hosts were assessed, after 150 generations, by
pulsed-field gel electrophoresis. Plasmid I-SceI fragments
of the expected size were obtained from some of the
clones studied, 124 kb for TTE1 (one out of two, clone F),
212 kb for B2T8 (three out of eight, clones U4, U7 and U8)
and 151 kb for CGT21 (all clones studied, clones 20, 24,
34 and 38) (Figure 2). These data indicate efficient
transfer by electrotransformation of DNA isolated from
E. coli DH10B to E. coli BM2710/pGB2Oinv-hly and
BM4573 and stable propagation of PAC-based constructs
in these two bacterial vectors in the absence of major
DNA rearrangements. Of note, the alphoid arrays tend to
rearrange more than the CFTR region.
Optimal conditions for invasion of HT1080 by invasive
E. coli
The first requirement for gene transfer from bacteria to
mammalian cells to occur is efficient cell internalization
of the bacteria, which varies depending on the cell line.
The percentage of initially infected HT1080 cells was
determined by flow cytometry analysis of fluorescent
cells after invasion with bacteria expressing GFP under
the control of a prokaryotic promoter. Invasive E. coli
harbouring pAT505 (pUC18Ogfpmut1), a plasmid that
directs synthesis of GFP in bacteria, was used at
multiplicities of infection (MOI) (bacteria/mammalian
cells ratio) of 5 or 25 to infect HT1080. After a 2 h
coincubation, the cells were washed and incubated in
complete medium containing 20 mg/ml of gentamicin to
kill extracellular bacteria. After 45 min of incubation, the
cells were trypsinized and analysed by flow cytometry.
At an MOI of 5, 74.5% of the cells were fluorescent
(Figure 3, panel a), and at an MOI of 25, 97.6% of the cells
were strongly fluorescent (Figure 3, panel b). Viable
intracellular bacteria were enumerated after gentle cell
lysis; the number of viable bacteria per cell is calculated
from the number of bacteria recovered per well. The
number of viable intracellular bacteria recovered was
0.25 per cell at an MOI of 5 and 1.2 and at an MOI of 25.
The discrepancy between the number of viable bacteria
recovered from cells and the percentage of GFP-positive
cells can be explained by the fact that dead or dying
bacteria can still be GFP positive. Altogether, the results
indicate that, at an MOI of 25, nearly all cells had
internalized at least one GFP-producing bacterium. Cell
viability, 48 h postinfection, ranged from 90 to 50% for an
MOI of 5 and 25, respectively (data not shown).
1561
Bacterial vectors can stably deliver PAC-derived
constructs into HT1080 cells
Plasmid delivery into HT1080 cells was performed by
simple coincubation for 2 h of HT1080 cells with E. coli
BM2710/pGB2Oinv-hly harbouring plasmids B2T8 or
CGT21, or E. coli BM4573 harbouring plasmid TTE1 at
an MOI of 5 or 25. After 48 h in complete culture medium
Figure 2 PFGE of constructs in bacteria. PAC DNA preparations in agarose plugs were digested with I-SceI, run on a pulsed field gel and stained with
ethidium bromide. Clones with apparently intact inserts of approximately 124 kb (TTE1, clone F), 212 kb (B2T8, clones U4, U7, U8) and 151 kb (CGT21,
clones 20, 24, 34, 38) indicated stability of the constructs. Plugs from strain DH10B are shown for comparison. The sizes of the inserts (in kb) are indicated
on the side. (M, PFG mid range marker II, New England BioLabs). The plasmids are indicated at the bottom, and the host strains at the top.
Gene Therapy
Bacterial transfer into human cells
A Laner et al
1562
with an average of 1.8 clones per 1 105 cells, B2T8
transfer by BM2710/pGB2Oinv-hly was less efficient with
an average of 1.3 clone per 1 105 cells, whereas CGT21
delivery by the same bacterial vector was the least
efficient with 0.25 clone per 1 105. The reasons for these
differences could reside in the nature of the genetic
element, HAC versus integration of a large DNA
fragment for CGT21, or of the bacterial vector, BM4573
being more efficient than BM2710/pGB2Oinv-hly. Of
note, bacterial delivery of pEGFP-C1 into HT1080 in
similar conditions resulted, 48 h after transfer, in 0.3 and
1%, at an MOI of 5, and 1.2 and 2.9%, at an MOI of 25,
EGFP-positive cells for BM2710/pGB2Oinv-hly and
BM4573, respectively. A single internalized bacteria
delivers ca. 500 copies of plasmid pEGFP-C1.
Characterization by PCR of BS-resistant HT1080
clones
The cell clones obtained were further characterized by
PCR using the primer pairs described in Table 4 and
Figure 1: BemF/BemR, LPF/LPR and KF/KR amplified,
respectively, 159, 109 and 381 bp fragments present in the
PAC vectors pTAT-BS and pTT. Primers 17-2A/T7
amplified a 150 bp fragment from B2T8 containing the
junction between a-satellite DNA and the pTAT-BS
vector, and EGF/EGR primer pair amplified a 281 bp
fragment present in plasmids TTE1 and CGT21. Table 3
summarizes the results of the PCR experiments performed on a fraction of isolated BS-resistant clones. As
expected, nearly all clones harboured apparently complete cloning vectors. Most importantly, in the majority
of the clones harbouring plasmids B2T8 (11/12) and
CGT21 (23/40), fragments from the insert (generated
with primer pairs 17-2A/T7 and EGF/EGR, respectively)
could also be amplified. Rare deletant derivatives were
observed with B2T8 (1/12) and more frequently with
TTE1 (5/14) and CGT21 (17/40).
The cell clones were further investigated by FISH for
detection of extrachromosomal elements for B2T8- and
TTE1-derived clones and for the expression of genes
present in TTE1 and CGT21.
Figure 3 Efficiency of bacterial internalization by HT1080 cells. Cells
infected with GFP-producing bacteria were analyzed by flow cytometry.
E. coli BM2710 containing invasion pGB2Oinv-hly and reporter
pUC18Ogfpmut1 plasmids were added at an MOI of (a) 5 or (b) 25.
FL1-H fluorescence was monitored on cells trypsinized 45 min after cell
invasion.
with gentamicin to kill residual extracellular bacteria, the
cells were cultured in the presence of blasticidin S (BS)
for up to 3 weeks. Resistant clones were detected as early
as day 14 and were not isolated after day 19, to avoid
reseeding from existing clones. Clones were obtained,
albeit at a low frequency in every experiment and with
each PAC-derived vector (Table 2). The MOI of 25
yielded more clones for the same number of plated cells
than that of 5. Of note, an MOI of 25 led to the
internalization of at least one bacterium per cell and
therefore of at least one PAC-derived vector molecule per
cell. Efficiency of transfer was variable depending on
both the plasmid and the bacterial vector: the highest
efficiency was obtained for delivery of TTE1 by BM4573,
Gene Therapy
Centromere formation
Dual colour FISH analysis using the Rsf vector probe and
cen 17 probe in B2T8 lines U10-3 and U10-6 and cen 5
probe in TTE1 lines F100-1 and F100-4 was carried out
after 30 days of growth with BS selection, which
corresponds to approximately 30 generations. Free
episomal HACs hybridizing with both probes (vector
and cen) were found in most of metaphases in the four
lines analysed (U10-3, n ¼ 13; U10-6, n ¼ 23; F100-1,
n ¼ 12; F100-4, n ¼ 15). None of the lines showed
integration into the host chromosomes. In the U10-3
and U10-6 lines grown for 30 additional days in the
absence of BS, HACs that hybridized with the Rsf and
the cen 17 probes were still detected (number of
metaphases studied: U10-3, n ¼ 30 and U10-6, n ¼ 42)
(Figure 4a); this demonstrates that transfer of B2T8 leads
to the formation of stably segregating HACs. Similarly,
dual colour FISH analysis with the Rsf and cen 5 probes,
of the two stable F100-1 and F100-4 lines, after 30
generations without BS, showed one, two or rarely three
HACs in the metaphases studied (n ¼ 19 and 23,
respectively), indicating mitotic stability in the absence
Bacterial transfer into human cells
A Laner et al
1563
Figure 5 Southern hybridization of U10-3 and U10-6 cell lines. To
analyse the stability of HAC DNA, chromosomal DNA of the U10-3 and
U10-6 lines (indicated at the top) was prepared 30 days after growth in the
presence (BS) and 30 days in the absence (D) of BS. Equal amounts (3 mg)
of HindIII digested genomic DNA were loaded on a 1% agarose gel,
electrophoresed (left panel), blotted and hybridized with the 32P-labelled
probe Rsf including the BS-resistance marker of pTAT-BS (right panel).
The similar intensities of the characteristic HindIII bands specific to B2T8
(3.4, 2.81 and 1.97 kb) show mitotic stability of the HACs even in the
absence of selection.
Figure 4 FISH analysis of stable HT1080 derived lines. Metaphases of
B2T8 U10-6 (a) and TTE1 F100-4 (b) lines were prepared from cells grown
30 days in the presence of BS and 30 days in the absence of BS. Free low
copy episomal HACs (white arrowheads) could be detected by colocalization of the vector probe rsf (red) and the centromere probe (green). In all
metaphases analysed (n450 for both cell lines), no integration was
observed with both probes. HACs at higher magnification are shown in the
inserts.
of selection (Figure 4b). Taken together, these data show
that mitotically stable, low copy HACs have formed in
all the cell lines analysed.
Stability of HACs as assessed by Southern
hybridization of B2T8 clones
In addition to monitoring HAC stability directly by FISH,
indirect analysis by Southern blot was carried out on
genomic DNA prepared from the U10-3 and U10-6
clones grown 30 days in the presence of BS and for
another 30 days with or without BS. The Rsf fragment
(Table 4) spanning the BS resistance gene in the pTAT-BS
vector portion was used as a probe. Equal amounts (3 mg)
of HindIII-digested genomic DNA fragments were
loaded onto a 1% agarose gel, separated, blotted and
hybridized with the 32P-labelled probe. As expected, the
Rsf probe hybridized with the bands corresponding to
the B2T8 construct (3.4, 2.81 and 1.97 kb) (Figure 5),
whereas no hybridization was detected in HT1080 (data
not shown). Moreover, a similar pattern was observed
with DNA prepared from clones grown for 30 additional
days in the absence of BS, indicating that the resistance
marker was stably inherited even in the absence of
selection.
Stability of TTE1-derived clones as assessed by EGFP
expression
The pTT PAC vector contains the EGFP expression
cassette and lipofection of TTE1 in HT1080 resulted in
bright and stable expression of EGFP in the vast majority
of the clones obtained (data not shown). This observation
indicates that the EGFP is stably expressed from the
HAC constructs and can therefore be used to assess
indirectly HAC stability. Four out of five cell lines
studied, F100-1, F100-4, F300-3 and F300-6, expressed
visible amounts of EGFP in more than 95% of the cells as
assessed by FACS analysis (data not shown); in line F3005, only 50% of the cells expressed EGFP. All cell lines
were divided into two parallel cultures at day 35 and
grown with or without BS for an additional 30 days. The
percentage of EGFP-expressing cells was determined by
Gene Therapy
Bacterial transfer into human cells
A Laner et al
1564
Figure 6 Stability of EGFP expression from HACs in HT1080 lines
during growth with (continuous lines) and without BS selection (dotted
lines). Five cell lines (F100-1, F100-4, F300-3, F300-5 and F300-6) were
divided into two cultures on day 35, and were passaged in the presence or
in the absence of BS. The percentage of cells expressing EGFP was
determined by flow cytometry at days 45, 55 and 65.
flow cytometry at 10, 20 and 30 days after the split into
two cultures (ie 45, 55 and 65 days after the initial
transfection). As can be seen in Figure 6, the percentage
of EGFP-expressing cells remained stable while selection
was maintained for four of the five cell lines. The
expression of EGFP by line F300-5 was stable until day
55, but started to decrease at day 65. When the cells were
grown without selection, the percentage of EGFPpositive cells decreased slowly over time in three cell
lines. There was a 50% drop after 30 days in a single line
(F300-3), indicating an overall good mitotic stability in
the absence of selection. Stable EGFP expression correlates with HAC formation in lines F100-1 and F100-4.
Study of gene expression in CGT21-derived cell
clones
To evaluate the expression of the CGT21 construct and
further assess its integrity after transfer, HT1080 cells
were infected with E. coli BM2710/pGB2inv-hly harbouring this genomic expression construct and individual
clones were obtained after BS selection. The CGT21 PAC
construct results from the fusion of a portion of the
human CFTR locus (exons 1–9 including 60 kb of
upstream sequences) and of a synthetic exon made of
CFTR exon 10, EGFP-cDNA, 30 UTR of CFTR exon 24,
followed by the endogenous 30 CFTR genomic sequences
as described.23 The resulting transcript encodes an
artificial fusion protein without CFTR Cl channel
function. This transcript, however, is easily distinguishable from endogenous CFTR transcripts by reverse
transcription (RT)-PCR using a reverse primer complementary to the EGFP sequence (see Materials and
methods).
Gene Therapy
From two independent bacterial transfer experiments,
a total of 40 individual cell clones were isolated and
expanded. Although PCR with EGF/EGR primers
amplified an EGFP-specific fragment in 23 lines (Table
3), EGFP expression was never detected in those clones
by FACS analysis (data not shown).
For transcript analysis, RNA was extracted from 14 out
of these 23 lines, subjected to long RT-PCR (see Materials
and methods) and nine out of the 14 clones expressed
transcripts from the CGT21 construct (Figure 7a). Clones
showing CGT21 expression, albeit at various levels,
were: 24-2, 24-4, and 38-1 (faint amplification was
confirmed by sequencing of the product), 20B2, 34A2,
34A3, 34A4, 34B1 and 38A1 (see Figure 7a). Parallel
amplification of b-actin (Figure 7b) showing equivalent
levels of RT-PCR amplification in samples from all clones
demonstrated similar efficiency in RNA extraction.
Although these RT-PCR results cannot be fully interpreted in a quantitative manner, results in Figure 7a also
suggest varying levels of expression of the CGT21
construct in different clones.
The CGT21 RT-PCR product was sequenced in the
nine expressing lines, and the sequences obtained
confirmed that it corresponded to the correctly spliced
CGT21 transcript spanning all exons between CFTR exon
1 and synthetic exon 10-EGFP (data not shown).
Detection of the CGT21 transcripts as well as the fact
they were correctly spliced in all nine cell lines indicates
intact transfer of the CGT21 construct. Moreover, these
data demonstrate maintenance of a genomic region of at
least 80 kb spanning a minimal CFTR promoter.
Two additional RT-PCR were performed to assess the
relative levels of transcripts from the CGT21 construct
and from the endogenous CFTR gene of the parental cell
line. A semiquantitative approach was used consisting in
two amplifications yielding products of similar size, but
each being specific for one of the two transcripts. The
results obtained for the 34A2 and 34A3 clones are shown
in Figure 7c and indicate that the endogenous CFTR gene
is also transcriptionally active in the parental cell line.
Discussion
Several laboratories have recently demonstrated that
bacteria can transfer functional genes to a very broad
range of mammalian cells.25,26 Attenuated strains of
Shigella,27 invasive E. coli,19,20,28 Salmonella29 and of
Listeria30 are able to transfer plasmid DNA to mammalian cells. The bacteria used for transfer to phagocytic
and nonphagocytic cells are facultative intracellular
pathogens that have been engineered to lyse after cell
invasion. Until now, this property has been mainly
exploited to develop DNA vaccines based on the ability
of Shigella and Salmonella to target dendritic cells.27,29,31
More recently, invasive bacteria have also been used as
DNA vectors for gene therapy. Administration to genetically immuno-deficient mice of avirulent Salmonella
bearing the murine plasmid-borne IFN-g gene resulted
in the expression of the transgene within macrophages
and dendritic cells and correction of the genetic defect.32
Taking advantage of the proximity of bowel mucosa to
luminal bacteria, we have successfully delivered a
therapeutic gene to the colonic mucosa of mice. E. coli
BM2710/pGB2Oinv-hly (Table 1) was able to deliver the
Bacterial transfer into human cells
A Laner et al
1565
Figure 7 RT-PCR analysis of CGT21 clones. (a) Results of long RT-PCR of samples from 14 cell lines transfected with the CGT21 genomic construct.
Analysis was performed using primers A1R (CFTR exon 1) and GFP1-AL (synthetic exon 10-EGFP, Table 4). NC, negative control. (b) b-actin
amplification of the same samples as a control for RNA extraction and the relative RNA levels among the samples. (c) Relative expression of the CGT21
construct and of endogenous CFTR in two cell lines, as analysed by two RT-PCR; one amplification specific for short CGT21 transcripts using the primers
B3F (CFTR exon 8) and GFP1-AL (synthetic exon 10-EGFP), spans exon 8 of the CFTR gene to the EGFP sequence in the engineered fusion exon 10 of
CGT21, yielding the 474 bp product (right arrow). The other amplification using the primers B3F and CI6D (CFTR exon 10) specific for endogenous CFTR
transcripts, produces a 391 bp fragment (left arrow). The size of the inserts (in bp) is indicated on the sides (M1, 1 kb ladder; M2, 100 bp ladder).
plasmid-carried TGF-b1 gene into the colonic epithelial
cell line CMT-93 and oral administration to mice of the
bacteria significantly reduced the severity of experimental DNBS-induced colitis.33
However, chromosome-based vectors are considered
to be potentially useful to introduce exogenous genes
into mammalian cells, since they replicate autonomously
and have unlimited cloning capacity allowing insertion
of entire genes with their proper endogenous and tissuespecific regulatory elements.34,35 Thus, simple and
efficient techniques to transfer these very large molecules
into mammalian cells need to be developed.
We have demonstrated that BAC/PAC-based constructs can be transferred into mammalian cells by an
invasive E. coli (Table 1) in which they can be introduced
and propagated (Figure 2) resulting in de novo formation
of HACs (Figure 4) or stable gene expression (Figures 6
and 7).
As shown previously, using an inducible homologous
recombination system adapted for use in E. coli DH10B,36
a dap derivative of this strain was generated and human
genomic BAC clones were modified into suitable vectors
for mammalian cells by the introduction of an EGFP
neocassette.21 After transformation with plasmid
pGB2Oinv DNA, the resulting invasive bacteria were
able to deliver a 200 kb modified BAC to HeLa cells,
resulting in 2.8% of cells expressing EGFP 48 h after
bacterial invasion at high MOI (1500–4000); however,
intactness of the transferred BAC and long-term BAC
stability in the transfected cells were not studied.
We demonstrate here that E. coli strain BM2710 can be
transformed by large (from 140 to 220 kb) genomic
constructs and that the bacterial vector allows stable
cloning and propagation of the highly homogeneous
tandem repeat arrays known to support de novo
centromere formation (Figure 2). Bacterial transfer led
to formation of stable HACs, which faithfully segregated
in the absence of selection (Figure 4) and thus supported
centromere formation by alpha satellite DNA. Until now,
de novo formation was observed only after transfection of
purified DNA from constructs by lipofection or microinjection. Since transfer occurs by direct cytoplasmic
delivery upon lysis of intracellular dap bacteria28
without the need for DNA purification from E. coli, a
possible negative effect of prokaryotic proteins bound to
the PAC-DNA on the initial steps of HAC formation
seems unlikely.
Efficiency of stable clone recovery (Table 2) was in the
same range as that observed with other transfer methods
(ie 105–106, Magin-Lachmann et al18), although these
figures are usually not rigorously documented; most
studies consider early gene, such as egfp expression as an
estimation of transfer efficiency. The optimal conditions
for bacterial invasion defined in this study lead to more
than one bacterium per cell (Figure 3) and therefore to
more than one PAC-derived vector delivered intracellularly in each cell. Access to the cell cytosol of bacteria and
plasmid DNA is an important requirement for successful
gene transfer,37 but transfer to the nucleus is another
limiting step as is the case for all other methods.
Detection of free episomal HACs after bacterial
transfer of TTE1 or B2T8 (Figure 4) do not prove per se
transfer of intact centromere constructs. Owing to the
highly homogeneous nature of alpha satellite arrays,
Gene Therapy
Bacterial transfer into human cells
A Laner et al
1566
Table 1
Plasmids and bacterial strains used
Designation
Relevant characteristicsa
Source or reference
Plasmids
pAT504
pAT505
pTAT-BS
pTT
B2T8
pGB2Oinv-hly, inv from Y. pseudotuberculosis and hly from L. monocytogenes, SmR, SpR
pUC18Ogfpmut1, ApR
ditelomeric PAC vector, PSV40-BSR; ApR, KmR
tetratelomeric PAC vector, PSV40-BSR; PCMV-egfp, ApR, KmR
pTAT-BSO190 kb a-satellite DNA array from human chromosome 17, PSV40-BSR; ApR, KmR
20
20
5
22
4, this work and
unpublished data
22
23
TTE1
CGT21
E. coli
DH10B
BM2710
BM4573
pTTO116 kb a-satellite DNA array from human chromosome 5, PSV40-BSR, PCMV-egfp; ApR, KmR
pTAT-BSOhuman CFTR locus with EGFP fusion, PSV40-BSR; ApR, KmR, TcR
F mcrA D(mrr-hsdRMS-mcrBC) (f80dlacZDM15) DlacX74 deoR recA1 araD139 D(ara-leu)7697
galU galK rpsL (SmR) endA1 l nupG
+
R
thi-1 endA1 hsdR17 (r
K m K) supE44 DlacX74 recA1 DdapAOcat (Cm )
BM2710 DmsbB DdapAOPtac-inv DdapBOPtet-hly
43
19
Unpublished data
a
Abbreviations used for antibiotic resistance (R): Ap ¼ ampicillin; BS ¼ blasticidin S; Cm ¼ chloramphenicol; Km ¼ kanamycin; Sm ¼ streptomycin; Sp ¼ spectinomycin; Tc ¼ tetracycline.
Table 2 HT1080 clones obtained at days 17–19 with selection on BS
Experiment
Plasmid transferred
1
B2T8, clone U7
2
3
B2T8, clone U7
B2T8, clone U4
clone U7
clone U8
1
TTE1, clone F
2
TTE1, clone F
3
TTE1, clone F
1
CGT21, clone
clone
clone
clone
CGT21, clone
clone
clone
clone
2
20
24
34
38
20
24
34
38
MOI
Number of clones
per total number
of plated cells
5
25
25
25
25
25
3/3 106
B60/3 106
13/1.5 106
11/1.5 106
12/1.5 106
19/1.5 106
5
25
5
25
25
3/5 105
17/5 105
0/5 105
19/5 105
8/1.5 106
25
25
25
25
25
25
25
25
0/3 106
11/3 106
3/3 106
1/3 106
17/3 106
5/3 106
17/3 106
7/3 106
transfer of a deleted construct could result, by subsequent homologous recombination, in a final functional
centromere; in fact, de novo formed HACs have been
estimated to be larger than single input centromere
sequences implying DNA concatemerization7,6,14,38 and
arrays as small as 70 kb of contiguous sequences have
proven to be sufficient to form centromeres.5
To test if bacteria allow transfer of large intact and
functional genomic loci, we used an engineered genomic
construct CGT21,23 which expresses a large transcriptional unit of the CFTR gene and is easily distinguishable
from the endogenous CFTR transcripts due to an EGFP
fusion. Results indicated that the CGT21 construct after
bacterial transfer into mammalian cells is expressed from
the CFTR promoter lying at a distance of 80 kb from the
last of the 12 exons (exon 10 according to the CFTR
Gene Therapy
nomenclature),39 indicating successful transfer of a large
functional unit of at least 80 kb. A long RT-PCR spanning
all CGT21 exons (from the CFTR start codon to the EGFP
coding region fused to CFTR exon 10) showed that this
construct is stably expressed from the CFTR promoter in
the mammalian HT1080 cell line and that all exons are
correctly spliced. Assuming complete transfer of a given
PAC construct, integration requires opening (ie linearization) of the circular molecules. If this process occurs
randomly, any region of the construct, including the
functional unit (ie the gene), could be interrupted during
insertion. Within the 159 kb sized CGT21 construct, the
functional unit covers at least 80 kb. Therefore, one
would expect that less than 50% of the integrants should
have an intact functional CGT21 unit. Among the 40
clones resistant to BS obtained after transfer of CGT21, 23
harboured vector and insert portions as assessed by PCR
(Table 3). In all, 14 candidate clones were analysed and
nine (64%) were shown to express the correctly spliced
transgene, as assessed by long RT-PCR and sequencing
(Figure 7, and data not shown). Since stable cell lines
were isolated with selection for the BS marker spanning
only 2 kb, there was no bias towards transfer of the intact
80 kb unit. Taken together, these data suggest that
transfer and maintenance of an unaltered large construct
is not a rare event.
Gene delivery systems play a central role in the
development of gene therapy strategies for monogenetic
hereditary diseases, like CF, as they offer the potential of
correcting the underlying cause when the responsible
gene is known.35 Since delivery of a large gene, like
CFTR, to the relevant cells, at the proper expression level
seems difficult to achieve with available vector systems,
alternative approaches should be considered. Engineered
bacteria have the potential to circumvent some of the
problems associated with construct/vector systems
currently in use, such as the inefficiency of intact gene
delivery and lack of stable expression. In particular, this
system further extends the ability of introducing very
large DNA sequences into phenotypically inert and
nonintegrative autonomously replicating vectors such
as artificial chromosomes. This is achieved by combining
their inherent advantages (ie stability and large carrying
Bacterial transfer into human cells
A Laner et al
1567
Table 3 PCR screening of BS-resistant HT1080 clones
Primers used for PCR
Plasmid transferred
17-2A/T7
EGF/EGR
LPF/LPR
BemF/BemR
KF/KR
Number of clones
B2T8
+
NAa
NA
+
+
+
+
+
11/12
1/12
TTE1
NA
NA
NA
+
+
+
+
+
+
+
+
+
9/14
4/14
1/14
CGT21
NA
NA
NA
NA
+
+
+
+
+
+
+
+
+
23/40
10/40
4/40
3/40
a
NA ¼ not applicable.
capacity) with the ease of purification and transferability
into mammalian cells. The potential of this system is
demonstrated by the design of CGT21 that could be
modified by replacing EGFP by the remainder of CFTR
to encode a functional CFTR or by insertion of the other
elements required for HAC formation, opening new
perspectives for gene therapy of CF or for any other
human genomic-based cell therapy.
A number of genetic techniques can be used to modify
in bacteria the genomic inserts cloned in BACs and direct
transfer of the engineered BAC from the host strain into
the target cell can be performed without DNA purification. This approach allows functional analysis of
large structural and regulatory genomic regions in cell
culture assays and has been successfully adapted for the
analysis and rapid phenotypic screening of the murine
cytomegalovirus genome.40 Combined with the efficient
transfer of low copy intact large functional DNA
demonstrated here for the human CFTR locus, these
data suggest that, in principle, bacteria can be engineered
to transfer artificial chromosomes that express human
genes.
Materials and methods
PAC-based plasmids
The maps of the PAC vectors are shown in Figure 1.
Plasmid B2T8 contains a 190 kb a-satellite DNA array of
human chromosome 17 composed of 2.6 kb sized, 16meric EcoRI higher-order repeats belonging to the
pentameric family of alpha satellite sequences also found
on human chromosomes X and 11. It was constructed by
inserting NotI cut PAC B2 (isolation described in
Schindelhauer and Schwarz4) in the Bsp120I site of the
ditelomeric 17 kb PAC vector pTAT-BS, which contains a
BS resistance gene. End-sequence pairs of 10 randomly
subcloned EcoRI higher-order repeats showed a high
similarity (497%). The sequences are provided in the
EMBL/Genbank database under accession numbers
AJ563631–AJ563650. Partial restriction and pulsed field
mapping showed the absence throughout the array of
fragments other than the 2.6 kb EcoRI fragments (data
not shown). De novo centromere proficiency of the
plasmid was shown by intranuclear microinjection of
approximately 1–10 linearized copies and by lipofection
(data not shown), and similar alpha satellite arrays of
chromosome 17.6,12
Plasmid TTE1 contains a 116 kb a-satellite array of
chromosome 5, belonging to a subtype of the dimeric
alpha satellite family, which is present on human
chromosomes 1, 5 and 19.41 The homogeneous array
present in TTE1 contains 0.34 kb EcoRI higher-order
repeats as revealed by restriction analysis (not shown). It
was isolated from PAC library RPCI 704 by array-specific
PCR using primers 5IF and 5IR. The primer sequences
were derived from that of the 0.7 kb insert in plasmid
pZ5.1 (Hulsebos et al42; http://www.biologia.uniba.it/
rmc/5-alfoidi/alfoidiplasmids.html). The NotI insert
(116 kb) of PAC E1 was cloned into the Bsp120I site of
pTT (26 kb), a tetratelomeric PAC vector derived from
pTAT-BS by insertional duplication of the portion
between the telomeres, insertion of a prokaryotic
white/blue selectable marker derived from pUC19
(Gibco BRL, Gaithersburg, MD, USA) and insertion of a
eukaryotic CMV/EGFP expression cassette derived by
PCR from plasmid pEGFP-N1 (Clontech, Palo Alto, CA,
USA).22
Construction of the genomic CFTR expression plasmid
CGT21 (EMBL/Genbank accession number BN000167)
is described elsewhere.23 In brief, an unaltered PAC
containing the 50 portion of the human CFTR locus
(60 kb to CFTR intron 9) was joined by cloning with a
synthetic exon fused from sequences of CFTR intron 9,
exon 10, the EGFP coding region, CFTR exon 24 plus
30 UTR and further CFTR 30 downstream region. Sequences of the CF-PAC exons are available online from
the VR of the European working group on CFTR
expression (http://central.igc.gulbenkian.pt/cftr/vr/)
and under Genbank/EMBL accession numbers
AJ574939–AJ575055. The resulting NotI fragment of
142 kb was cloned in the Bsp120I site of pTAT-BS
(17 kb) to include the BS selectable marker and for future
incorporation into HACs. This PAC plasmid designated
CGT21 (159 kb) was functionally analysed in stable
HT1080 cell lines. RT-PCR spanning all exons revealed
correct splicing of all exons, including the synthetic one
(the sequence of the resulting cDNA is deposited in the
EMBL/Genbank database under accession number
AY299332).23
Gene Therapy
1568
Gene Therapy
Table 4
Oligodeoxynucleotides used in this study
Sequence (50 –30 )
Locationa
17-2A
T7
ATAACTGCACCTAACTAAACG
TAATACGACTCACTATAGGG
EGF
EGR
LPF
LPR
BemF
BemR
KF
KR
RsF
AGGGCGAGGAGCTGTTCAC
GTGCGCTCCTGGACGTAGC
GAAACGGCCTTAACGACGTAGTCG
ATGATAAGCTGTCAAACATGAGAATTG
CATGCTCACGGCAATGCCGG
TGGCACTTTGCGTATCGTCCA
GGGAAAACAGCATTCCAGGTATTAG
CCATGAGTGACGACTGAATCCGGT
AGCGGTCGGACCGTGCTC
B2T8, chr. 17 a-sat DNA, present in the 2.6 kb higher-order repeats
Cloning boundary of the NotI insert of chr.17 a-sat DNA derived
from PAC B2
TTE1, CGT21, EGFP cDNA fragment
5IF
GTGAGGAAACAGTCTGTTTGTC
5IR
17-1A
Size of the
PCR product
(bp)
Reference
Ca. 150
45
This work, 4
PCR
281
This work, 23
PCR
B2T8, TTE1, CGT21, vector fragment, adjacent to the loxP site
109
This work, 23
PCR
B2T8, TTE1, CGT21, vector fragment, close to Bsp120I
159
This work, 23
PCR
381
This work
PCR
pTAT-BS vector fragment, includes the loxP site and the BS
selectable marker
3160
This work, 23
TTE1; chr. 5 a-sat DNA type I, present in the 0.34 kb higher-order
repeats
275
41,22
GAATCATTCTGTCTAGTTTTTATAC
TGTTTAGTCAGCTGAAATT
B2T8; chr. 17 a-sat DNA, present in the 2.6 kb higher-order repeats
45
A1R
CGAGAGACCATGCAGAGGTC
CFTR exon 1 (forward)
C16D
GFP1-AL
B3F
ActS
ActAS
AC1L
CFex5.F
B2R
GTTGGCATGCTTTGATGACGCTTC
GAACTTCAGGGTCAGCTTG
AATGTAACAGCCTTCTGGGAG
GCACTCTTCCAGCCTTCC
GCGCTCAGGAGGAGCAAT
GAAACCAAGTCCACAGAAGGC
CTCCTTTCCAACAACCTGAAC
GGAAGGCAGCCTATGTGAGA
Endogenous CFTR exon 10 (reverse)
Synthetic exon 10 in CGT21, EGFP portion (reverse)
CFTR exon 8 (forward)
b-Actin (forward)
b-Actin (reverse)
CFTR exon 6a
CFTR exon 5
CFTR exon 7
Ca. 1900 with
17-2A
1668 with
GFP1-AL
391 with B3F
474 with B3F
a
KmR ¼ resistance to kanamycin; BSR ¼ resistance to blasticidin S.
B2T8, TTE1, CGT21, KmR fragment
R
228
—
—
—
49
47
23
47
48
48
This work
This work
49
Used for
Probe for
Southern and
FISH
Probe for
FISH
Probe for
FISH
RT-PCR
RT-PCR
RT-PCR
RT-PCR
RT-PCR
RT-PCR
Sequencing
Sequencing
Sequencing
Bacterial transfer into human cells
A Laner et al
Primer
Bacterial transfer into human cells
A Laner et al
Bacterial strains, plasmids and growth conditions
The bacterial strains and plasmids used in this study are
listed in Table 1. Bacteria were grown in brain heart
infusion (BHI, Difco Laboratories, Detroit, MI, USA)
broth or agar. The dap auxotroph strains E. coli BM2710
and BM4573 (a BM2710 derivative in which the inv and
hly genes have been inserted in the chromosome,
manuscript in preparation) were grown with 0.5 mM of
diaminopimelic acid (dap, Sigma, St Louis, MO, USA).
Bacteria harbouring pGB2Oinv-hly were selected with
25 mg/ml of spectinomycin. Bacteria harbouring B2T8
and TTE1 were selected with both 25 mg/ml of kanamycin, 50 mg/ml of ampicillin; bacteria harbouring CGT21
were selected with kanamycin, ampicillin and 2 mg/ml of
tetracycline. Ampicillin (50 mg/ml) was used to select
strains containing pAT505.
Electroporation
Overnight cultures of E. coli BM2710/pGB2Oinv-hly or E.
coli BM4573 were diluted 1:50 in 40 ml of BHI broth
containing 0.5 mM dap. Bacteria were grown at 371C with
shaking to an OD600 of 0.5–0.6, chilled 15 min on ice,
harvested by centrifugation for 5 min at 6000 r.p.m. at
41C, washed twice in 10 ml of cold sterile water and
collected by centrifugation for 5 min at 6000 r.p.m. at 41C.
The bacteria were resuspended in 10 ml of 10% cold
glycerol, centrifuged 10 min at 6000 r.p.m. and the pellet
was resuspended in 0.2 ml of 10% glycerol. Circular
DNA of PAC plasmids B2T8, TTE1 and CGT21 was
isolated from E. coli DH10B43 in agarose plugs containing
approximately 1 mg/100 ml of DNA. From 30 to 50 mg of
low melting point agarose containing plasmid DNA was
melted by incubation at 651C for 10 min with 1/10
volume of 10 b-Agarase I buffer (New England
BioLabs, Beverly, MA, USA). The melted agarose was
cooled to 401C and incubated from 1 to 1 h 30 with bAgarase (one unit for 100 ml). Electrocompetent bacteria
(25 ml) and 3 ml of plasmid DNA were added to
microcentrifuge tubes placed on ice, mixed and transferred to cuvettes with a 0.1 cm gap (Bio-Rad Laboratories, Richmond, CA, USA) chilled on ice.
Electroporation (Bio-Rad gene Pulser) conditions were
100 O, 1.6 kV and 25 mF. A measure of 1 ml of BHI
medium with 0.5 mM dap was immediately added to the
cuvette and the content was then transferred to sterile
glass cultured tubes for growth for 1 h with moderate
shaking at 371C. Bacteria (0.25 ml) were spread on BHI
agar containing 0.5 mM dap and appropriate antibiotics,
and the plates were incubated for a minimum of 24 h at
371C.
Analysis of plasmid DNA by pulsed field gel
electrophoresis (PFGE)
To verify integrity of the PAC plasmids after transfer in
the bacteria, agarose plugs were prepared from E. coli
BM2710 harbouring pGB2Oinv-hly+B2T8 or CGT21, E.
coli BM4573 harbouring TTE1 and from parental E. coli
DH10B strain. Circular DNA was purified after fragmentation of E. coli chromosome by restriction digestion
and PFGE purification as described.44 The size of the
plasmids was determined by I-SceI cleavage, removing
vector sequences outside of the telomeric repeats, and
PFGE with a CHEF DRII apparatus (Bio-Rad Laboratories, Richmond, CA, USA) with the following settings:
6 V/cm, ramped switch time 1–30 s, 16 h run in 0.5 TAE buffer at 121C. The gels were stained with ethidium
bromide and the bands visualized under UV light.
1569
Bacterial invasion of cells
The HT1080 (human lung sarcoma) cell line was
maintained in complete culture Dulbecco’s modified
Eagle’s medium (DMEM; ICN Biomedicals, Aurora, OH,
USA) supplemented with 2 mM L-glutamine and 10%
fetal calf serum (FCS, Gibco-BRL, Gaithersburg, MD,
USA). The cells were incubated overnight in six-well
plates (2.5 105 cells/well) or in 100 mm Petri dishes
(0.65 105–1.5 106 cells/dish). Bacteria were grown
overnight at 301C in BHI broth supplemented with
0.5 mM dap and the appropriate antibiotics, harvested by
centrifugation and resuspended in DMEM containing
0.5 mM dap at 2.5 108 bacteria/ml. Bacteria were added
to HT1080 cells in 2 ml (six-well plates) or 6 ml (100 mm
Petri dishes) of DMEM with dap to obtain an MOI of ca.
5 or 25 and the plates or dishes were incubated for 2 h at
371C. The cells were then washed three times with
DMEM and incubated in complete medium containing
20 mg/ml of gentamicin to remove extracellular bacteria
for 2 days.
Generation of stable BS-resistant HT1080 clones
The infected cells were then incubated in complete
medium containing 4 mg/ml of BS (ICN Biochemicals,
Aurora, OH, USA) for at least 2 weeks and individual
resistant HT1080 clones (containing 250–1000 cells) were
isolated using cloning cylinders (Sigma, St Louis, MO,
USA). Colonies were trypsinized and transferred into
six-well plates and subsequently expanded in 25 and
75 cm2 flasks for analysis.
Counts of internalized bacteria
After invasion, cells were incubated 30 min at 371C in
complete medium containing 20 mg/ml of gentamicin
and washed three times with DMEM. The bacteria were
released from the cells with 0.25% deoxycholate, and
viable counts were determined on BHI agar plates
containing 0.5 mM dap and antibiotics.
Flow cytometric analysis
HT1080 cells were trypsinized, washed once with 2%
FCS in phosphate-buffered saline (PBS), resuspended in
the same medium at 106 cells/ml and 3 104 cells were
analysed by flow cytometry using a FACScan flow
cytometer with CellQuest software (Becton-Dickinson,
Mountain View, CA, USA).
PCR screening of resistant HT1080 clones
Cell clones were screened by PCR using primer pairs
described in Table 4. Cells (1–2 106) were trypsinized,
and washed once with 5 ml of PBS; the pellet was
resuspended in 50–100 ml of TTE buffer (0.01% Triton
X-100, 20 mM Tris-HCl (pH 8), 2 mM EDTA, pH 8),
incubated 10 min at 1001C and centrifuged for 3 min at
10 000 r.p.m. A measure of 2 ml of supernatant was used
in a final volume of 50 ml for a PCR of 35 cycles with
annealing temperatures of 601C (LPF/LPR; BemF/BemR;
KF/KR; EGF/EGR) or 531C (17-2A/T7). Untransfected
HT1080 cells were used as a negative control.
Gene Therapy
Bacterial transfer into human cells
A Laner et al
1570
Southern hybridization
Genomic DNA of stable cell lines was prepared using
pronase A, salt precipitation of proteins and ethanol
precipitation. Approximately 3 mg of genomic DNA was
digested with HindIII and separated on a 1% agarose gel
at 30 V for 16 h in TBE buffer and probed with the 3.15 kb
PCR fragment obtained with Rsf primer (Table 4)
spanning the BS resistance marker. The PCR product
was labelled using random primed polymerization with
Klenow enzyme (Roche, Mannheim, Germany) and 32PdCTP (Amersham, UK). Hybridization was carried out at
651C overnight in the presence of dextransulphate and
salmon sperm DNA.
FISH analysis
Cells enriched for metaphases using 0.4 mg/ml colcemid
(Roche, Mannheim, Germany) for 4 h were treated with
hypotonic solution at 371C for 40 min in 0.8% (w/v)
sodium citrate. Nuclei were fixed in methanol/acetic
acid (3:1) at 201C for standard chromosomal spreads.
RNase A- (Roche, Mannheim, Germany) and pepsin(Boehringer, Mannheim, Germany) treated chromosome
preparations were dehydrated in ethanol. Chromosomal
DNA and probes were simultaneously denaturated at
721C for 5 min in 50% (v/v) formamide, 2 SSC, 20%
(w/v) dextran sulphate and incubated in a humid
chamber at 371C for 72 h. FISH hybridization was carried
out in the presence of 1 mg/ml salmon testes DNA
(Sigma, St Louis, MO, USA). Posthybridization washes
were carried out as described.23 After blocking with 3%
(w/v) BSA, Cy3.5-conjugated Avidin (Rockland, Gilbertsville, PA, USA) or FITC-conjugated anti-dig antibody (Roche, Mannheim, Germany) was bound in 1%
(w/v) BSA, 4 SSC and 0.2% (v/v) Tween-20. Slides
were washed (4 SSC, 0.2% Tween-20, 421C) and
counterstained with DAPI (40 ,6-diamidino-2-phenylindole; Sigma, St Louis, MO, USA), mounted with antifade
(PPD) and analysed on a Leica DM RXA with a CCD
camera controlled by Q-FISH software (Leica Microsystems, Switzerland). The vector probe was obtained by
amplifying a 3.15 kb fragment with primer Rsf (Table 4)
from pTAT-BS. The product was labelled by PCR
incorporation of biotin-16-dUTP (Roche, Mannheim,
Germany). The centromeric probes cen 5I and cen 17
were amplified using primers 5IF/5IR and 17-1A/17-2A
(Table 4), respectively, from the corresponding PACs.
5IF/5IR amplified a 275 bp region including the CENP-B
box of the 0.34 kb higher-order repeat of alpha satellite
array type I of chromosome 5 (Z5.1, Archidiacano et al41),
and 17-1A/17-2A amplified a 1.9 kb segment of the
2.6 kb higher-order repeats of the alpha satellite DNA
array of chromosome 17.45
RT-PCR analysis
Total RNA was isolated from BS-resistant cell lines using
the RNeasy extraction kit (Qiagen, Hilden, Germany)
according to the manufacturer’s instructions. RT was
carried out using random hexamers and Superscript II
RnaseH-reverse transcriptase (Invitrogen, Paisley, UK) as
described.46 The cDNA obtained was used as a template
in a long RT-PCR to assess expression and correct
splicing of the CGT21 construct. The reaction was
performed between CFTR exon 1 and CGT21 synthetic
fusion of CFTR exon 10-EGFP using primers A1R (CFTR
Gene Therapy
exon 1) and GFP1-AL (EGFP sequence at the CGT21
fusion) (Table 4). The expected size of the correctly
spliced RT-PCR product was 1668 bp. Each reaction
contained 10 ml of cDNA and 1 U of AmpliTaq DNA
Polymerase (Applied Biosystems, Foster city, CA, USA);
1 buffer I (Applied Biosystems); 200 mM of each dNTP
(Amersham Bioscience, Uppsala, Sweden); and 0.2 mM of
each primer in a final volume of 50 ml. In all, 40
amplification cycles were used as follows: denaturation
at 941C for 1 min, annealing at 581C for 1 min and
extension at 721C for 3 min. A final extension at 721C was
carried out for 12 min.
Efficiency of RNA extraction and the RNA levels in
the various samples were controlled by RT-PCR with 2 ml
of each cDNA sample to amplify a 228 bp b-actin
fragment using primers ActS (forward) and ActAS
(reverse) (Table 4) at an annealing temperature of 581C.
To assess the relative levels of transcripts from the
CGT21 construct and from endogenous CFTR, two
additional RT-PCR reactions were performed. The first
of these reactions used primers B3F (CFTR exon 8) and
GFP1-AL (described in Table 4) amplifying a fragment of
471 bp, specific of CGT21 transcripts. For the second
reaction, amplifying a 391 bp fragment specific of
endogenous CFTR, we used primers B3F (CFTR exon
8) and C16D (in region of CFTR exon 10 that is absent in
CGT21, see also Table 4). A measure of 5 ml of each cDNA
sample was added to the PCR reaction mixture, which
was heated at 941C for 5 min, and then subjected to 35
cycles of denaturation at 941C for 1 min, annealing at
601C for 1 min and extension at 721C for 2 min, followed
by a final extension at 721C for 12 min.
The RT-PCR products were analysed by 2% (w/v)
agarose gel electrophoresis. The gel images were
registered on an UV DBT-08 digital analyser (UVItec
Ltd, Cambridge, UK).
Products from the long RT-PCR amplification were
purified using the Jet Quick PCR product purification
spin kit from Genomed (Löhne, Germany) and sequenced with the ABI PRISMt Dye Terminator Cycle
sequencing system V1.1 (Applied Biosystems), according
to the manufacturer’s instructions. Three primers (see
Table 4) were used in different sequencing reactions to
obtain the complete sequence of the long RT-PCR
products, namely: AC1L (reverse primer located in CFTR
exon 6a), CFex5.F (forward primer located in CFTR exon
5) and B2R (forward primer located in CFTR exon 7).
Sequences of these three products were obtained on an
ABI Prismt 3100 capillary electrophoresis automatic
sequencer (Applied Biosystems).
Acknowledgements
This work was supported in part by two grants from
l’association Vaincre la Mucoviscidose in 2002–2003 and
2003–2004, the latter together with the German Association Mukoviszidose e.v. D Schindelhauer was supported
by the Deutsche Forschung Gemeinschaft and MD
Amaral by research Grant POCTI/1999/MGI/35737
from FCT Portugal. AS Ramalho was a recipient of
PhD fellowship SFRH/BD/3085/2000 from FCT, Portugal. We thank C Klein and M Speicher for FISH
equipment.
Bacterial transfer into human cells
A Laner et al
1571
References
1 Shizuya H et al. Cloning and stable maintenance of 300-kilobasepair fragments of human DNA in Escherichia coli using an
F-factor-based vector. Biochemistry 1992; 89: 8794–8797.
2 Ioannou PA et al. A new bacteriophage P1-derived vector for the
propagation of large human DNA fragments. Nat Genet 1994; 6:
84–89.
3 International Human Genome Mapping Consortium. A physical
map of the human genome. Nature 2001; 409: 934–941.
4 Schindelhauer D, Schwarz T. Evidence for a fast, intrachromosomal conversion mechanism from mapping of nucleotide
variants within a homogeneous alpha-satellite DNA array.
Genome Res 2002; 12: 1815–1826.
5 Ebersole TA et al. Mammalian artificial chromosome formation
from circular alphoid input DNA does not require telomere
repeats. Hum Mol Genet 2000; 9: 1623–1631.
6 Harrington JJ et al. Formation of de novo centromeres and
construction of first-generation human artificial microchromosomes. Nat Genet 1997; 15: 345–355.
7 Ikeno M et al. Construction of YAC-based mammalian artificial
chromosomes. Nat Biotechnol 1998; 16: 431–439.
8 Grimes BR, Rhoades AA, Willard HF. Alpha-satellite DNA and
vector composition influence rates of human artificial chromosome formation. Mol Ther 2002; 5: 798–805.
9 Henning KA et al. Human artificial chromosomes generated by
modification of a yeast artificial chromosome containing both
human alpha satellite and single-copy DNA sequences. Proc Natl
Acad Sci USA 1999; 96: 592–597.
10 Schueler MG et al. Genomic and genetic definition of a functional
human centromere. Science 2001; 294: 109–115.
11 Kouprina N et al. Cloning of human centromeres by transformation associated recombination in yeast and generation of
functional human artificial chromosomes. Nucleic Acids Res
2003; 31: 922–934.
12 Meija JE et al. Efficiency of de novo centromere formation in
human artificial chromosomes. Genomics 2002; 79: 297–304.
13 Ohzeki J, Nakano M, Masumoto H. CENP-B box is required for
de novo centromere chromatin assembly on human alphoid
DNA. J Cell Biol 2002; 159: 765–775.
14 Meija JE et al. Functional complementation of a genetic
deficiency with human artificial chromosomes. Am J Hum Genet
2001; 69: 315–326.
15 Grimes BR et al. Stable gene expression from a human artificial
chromosome. EMBO Rep 2001; 21: 910–914.
16 Ikeno M et al. Generation of human artificial chromosomes
expressing naturally controlled guanosine triphosphate cyclohydrolase I gene. Genes Cell 2002; 7: 1021–1032.
17 Wade-Martins R et al. An infectious transfer and expression
system for genomic DNA loci in human and mouse cells. Nat
Biotechnol 2001; 19: 1067–1070.
18 Magin-Lachmann C et al. In vitro and in vivo delivery of intact
BAC DNA – comparison of different methods. J Gen Med 2004; 6:
195–209.
19 Courvalin P, Goussard S, Grillot-Courvalin C. Gene transfer
from bacteria to mammalian cells. CR Acad Sci 1995; 318:
1207–1212.
20 Grillot-Courvalin C et al. Functional gene transfer from
intracellular bacteria to mammalian cells. Nat Biotechnol 1998;
16: 862–866.
21 Narayanan K, Warburton PE. DNA modification and functional
delivery into human cells using Escherichia coli DH10B. Nucleic
Acids Res 2003; 31: e51.
22 Laner A, Schwarz T, Christan S, Schindelhauer D. Suitability
of a CMV/EGFP cassette to monitor stable expression from
human artificial chromosomes but not transient transfer
in the cells forming viable clones. Cytogenet Genome Res 2004;
107: 9–13.
23 Schindelhauer D et al. An engineered genomic CFTR construct is
expressed and correctly spliced in the human lung sarcoma cell
line HT1080. (submitted).
24 Bachmann BJ. Derivations and genotypes of some mutant
derivatives of Escherichia coli K-12. In: Brooks LK, Ingraham JL,
Magasanik B, Neidhardt FC, Schaechter M, Umbarger HE (eds).
Escherichia coli and Salmonella Typhimurium, Cellular and Molecular
Biology. ASM: Washington, 1987, pp 1190–1219.
25 Grillot-Courvalin C, Goussard S, Courvalin P. Bacteria as gene
delivery vectors for mammalian cells. Curr Opin Biotechnol 1999;
10: 477–481.
26 Weiss S, Chakraborty T. Transfer of eukaryotic expression
plasmids to mammalian host cells by bacterial carriers. Curr
Opin Biotechnol 2001; 12: 467–472.
27 Sizemore DR, Branstrom AA, Sadoff JC. Attenuated Shigella as a
DNA delivery vehicle for DNA-mediated immunization. Science
1995; 270: 299–302.
28 Fajac I et al. Recombinant Escherichia coli as a gene delivery
vector into airway epithelial cells. J Control Rel 2004; 97: 371–381.
29 Darji A et al. Oral somatic transgene vaccination using
attenuated S. typhimurium. Cell 1997; 91: 765–775.
30 Dietrich G et al. Delivery of antigen-encoding plasmid DNA into
the cytosol of macrophages by attenuated suicide Listeria
monocytogenes. Nat Biotechnol 1998; 16: 181–185.
31 Paglia P et al. Gene transfer in dendritic cells, induced by oral
DNA vaccination with Salmonella typhimurium, results in
protective immunity against a murine fibrosarcoma. Blood
1998; 92: 3172–3176.
32 Paglia P et al. In vivo correction of genetic defects of monocyte/
macrophages using attenuated Salmonella as oral vectors for
targeted gene delivery. Gene Therapy 2000; 7: 1725–1730.
33 Castagliuolo I et al. Engineered Escherichia coli deliver
therapeutic genes to the colonic mucosa of mice. Gene Therapy
12: 1070–1078.
34 Lipps HJ et al. Chromosome-based vectors for gene therapy. Gene
2003; 304: 23–33.
35 Klink D et al. Gene delivery systems-gene therapy vectors for
cystic fibrosis. J Cystic Fibrosis 2004; 3: 203–212.
36 Narayanan K et al. Efficient and precise engineering of a 200 kb
b-globin human/bacterial artificial chromosome in E. coli
DH10B using an inducible homologous recombinant system.
Gene Therapy 1999; 6: 442–447.
37 Grillot-Courvalin C, Goussard S, Courvalin P. Wild-type
intracellular bacteria deliver DNA into mammalian cells. Cell
Microbiol 2002; 4: 177–186.
38 Rudd MK, Mays RW, Schwartz S, Willard HF. Human artificial
chromosomes with alpha satellite-based de novo centromeres
show increased frequency of nondisjunction and anaphase lag.
Mol Cell Biol 2003; 23: 7689–7697.
39 Zielenski J et al. Genomic DNA sequence of the cystic fibrosis
transmembrane conductance regulator (CFTR) gene. Genomics
1991; 10: 214–228.
40 Brune W, Ménard C, Heesemann J, Koszinowski UH. A
ribonucleotide reductase homolog of cytomegalovirus and
endothelial cell tropism. Science 2001; 291: 303–305.
41 Archidiacano N et al. Comparative mapping of human alphoid
sequences in great apes using fluorescence in situ hybridization.
Genomics 1995; 25: 477–484.
42 Hulsebos TJ et al. Assignment of the beta B1 crystallin gene
(CRYBB1) to human chromosome 22 and mouse chromosome 5.
Genomics 1995; 29: 712–718.
43 Grant SGN, Jessee J, Bloom FR, Hanahan D. Differential plasmid
rescue from transgenic mouse DNAs into Escherichia coli
methylation-restriction mutants. Genetics 1990; 87: 4645–4649.
44 Schindelhauer D, Cooke HJ. Efficient combination of large DNA
in vitro: in gel site specific recombination (IGSSR) of PAC
fragments containing alpha satellite DNA and the human HPRT
gene locus. Nucleic Acids Res 1997; 25: 2241–2243.
Gene Therapy
Bacterial transfer into human cells
A Laner et al
1572
45 Warburton PE, Willard HF. Genomic analysis of sequence
variation in tandemly repeated DNA. Evidence for localized
homogeneous sequence domains within arrays of a-satellite
DNA. J Mol Biol 1990; 216: 3–16.
46 Ramalho AS et al. Methods for RNA extraction, cDNA
preparation and analysis of CFTR transcripts. J Cystic Fibrosis
2004; 3: 11–15.
47 Ramalho AS et al. Five percent of normal cystic fibrosis
transmembrane conductance regulator mRNA ameliorates the
Gene Therapy
severity of pulmonary disease in cystic fibrosis. Am J Respir Cell
Mol Biol 2002; 27: 619–627.
48 Mickle JE et al. A mutation in the cystic fibrosis transmembrane
conductance regulator gene associated with elevated sweat
chloride concentrations in the absence of cystic fibrosis. Hum Mol
Genet 1998; 7: 729–735.
49 Chalkley G, Harris AA. Lymphocyte mRNA as a resource for
detection of mutations and polymorphisms in the CF gene. J Med
Genet 1991; 28: 777–780.