Download Characterization of CIC transporter proteins Moradi, Hossein

University of Groningen
Characterization of CIC transporter proteins
Moradi, Hossein
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to
cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date:
2009
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Moradi, H. (2009). Characterization of CIC transporter proteins: Functional analysis of clc mutants in
Arabidopsis thaliana Groningen: s.n.
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the
author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately
and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the
number of authors shown on this cover page is limited to 10 maximum.
Download date: 18-06-2017
University of Groningen
Characterization of ClC Transporter Proteins
Functional analysis of clc mutants in Arabidopsis thaliana
Hossein Moradi
I
II
RIJKSUNIVERSITEIT GRONINGEN
Characterization of ClC Transporter Proteins
Functional analysis of clc mutants in Arabidopsis thaliana
PROEFSCHRIFT
ter verkrijging van het doctoraat in de
Wiskunde en Natuurwetenschappen
aan de Rijksuniversiteit Groningen
op gezag van de
Rector Magnificus, dr. F. Zwarts,
in het openbaar te verdedigen op
donderdag 21 september 2009
om 11.00 uur
door
Hossein Moradi
geboren op 28 juni 1968
te Sari, Iran
III
Promotor:
Prof. dr. J.T.M. Elzenga
Copromotor:
Dr. F.C. Lanfermeijer
Beoordelingscommissie:
Prof. dr. B. van Duijn
Prof. dr. J. Hille
Prof. dr. S. Shabala
IV
To the twelfth Imam (Mahdi )
V
The research reported in this thesis was financially supported by a grant from
the Ministry of Science, Research and Thechnology of Islamic Repoblic of Iran,
and were performed in the Laboratory of Plant Physiology, which is a part of the
Center for Ecological and Evolutionary Studies (CEES) of the University of
Groningen, The Netherlands.
Cover design: Farveh Norouzi
Printed: Facilitairbedrijf, RuG, Groningen, The Netherlands
ISBN: 978-90-367-3970-2 (printed version)
ISBN: 978-90-367-3971-9 (digital version)
VI
Contents
Chapter 1
Chloride channels: A general introduction
Chapter 2
Generation and characterization of anion channel mutants in
Arabidopsis thaliana
25
Chapter 3
NO3- and H+ fluxes in Atclcd mutants of Arabidopsis thaliana
43
Chapter 4
Anion channels and root elongation in Arabidopsis thaliana
57
Chapter 5
The role of AtClCa and AtClCd in heavy metal tolerance in
Arabidopsis thaliana
73
Chapter 6
General discussion and conclusion
89
References
93
1
Summary (English)
107
Summary (Dutch)
109
Summary (Persian)
112
Acknowledgements
114
VII
VIII
Chapter 1
Chloride Channels: A General Introduction
Hossein Moradi1,2 Theo Elzenga1 and Frank Lanfermeijer1
1
Department of Plant Biology, University of Groningen, 9750 AA Haren, The Netherlands
2
Department of Agronomy and Plant breeding, Sari Agricultural Sciences and Natural Resources
University, Iran
1
Chapter 1
INTRODUCTION
The physiology of plants strongly depends on solute and water fluxes across the
cell plasma membrane, the tonoplast and other endomembranes. Among the different
transporter systems involved in transport, ion channels represent a large class with
important roles. These proteins facilitate passive fluxes of ions down their respective
electrochemical gradients. The ClC proteins constitute a family of transmembrane
transporters that either function as anion channel or as H+/anion exchanger. Part of the
ClC family members are anion selective ion channels, which provide passive pores
which allow anions to move according to their electrochemical gradient. The others
are anion/proton antitransporters, which couple the transport of two anions with one
proton. The first member of the ClC family, called ClC-0 was isolated from the
Torpedo marmorata electric organ by expression cloning in Xenopus oocytes (Jentsch
et al., 1990). Figure 1 shows the phylogenetic relationship between different members
of ClC family prokaryotes and eukaryotes. The ClC family has been best
characterized in mammals, in which at least nine members have been identified that
can be grouped in three branches (Jentsch et al., 2002). Several studies have
demonstrated the importance of ClC family in human diseases, such as kidney stones,
muscle disorder myotonia, cystic fibrosis, deafness, and the bone disease osteoporosis
(Jentsch et al., 2005). The first plant member of the ClC family was ClC-Nt1 from
Nicotiana tabacum (Lurin et al., 1996), which was cloned by a PCR-based cDNA
library screening approach (Lurin et al., 1996). ClC proteins in the two model plants,
Arabidopsis thaliana and rice, have been shown to encode anion channels and
transporters involved in nitrate homeostasis. ClC proteins in plants participate in
various physiological processes, such as, osmoregulation, stomatal movement, cell
signaling, nutrient uptake and metal tolerance (Barbier et al., 2000). However,
detailed knowledge on the role of ClC proteins in plant cells is still lacking as a result
of the absence of distinctive effects of knock-outs, the unknown intracellular
localization and the co-operation between the different family members.
2
Chloride channels: A general introduction
Figure 3. Neighbor-Joining Consensus tree of ClC proteins of various kingdoms
The tree was calculated using the Geneious program. The branch containing the AtClCe and
AtClCf proteins is indicated with “cyanobacteria, mitochondria, chloroplasts”. Arabidopsis
thaliana: AtClCa: CAA96057.1; AtClCb: CAA96058.1; AtClCc: CAA96059.1; AtClCd:
P92943.2; AtClCe: AAK53390.1; AtClCf: AAK53391.1; AtClCg: P60300.1; Escherichia
coli: EcClC1: P37019.2; Homo sapiens: HsClC1: P35523.2; HsClC2: P51788.1; HsClC3:
P51790.2; HsClC4: P51793.2; HsClC5: P51795.1; HsClC6: P51797.1; HsClC7: P51798.2;
HsClCKa: P51800.1; Neurospora crassa: NcClCx1: EAA33130.2; NcClCx2: EAA28009.2;
NcClCx3: EAA28099.2; Nostoc punctiforme: NpClCx1: YP_001868013.1; NpClCx2:
BAB73778.1; NpClCx3: YP_001866371.1; NpClCx4: YP_001865245.1; NpClCx5:
YP_001865422.1; Saccharomyces cerevisiae: ScClC (GEF1): P37020.1; Salmonella enterica:
SeClC1: AAL19167.1; Synechococcus elongatus: SelClCx1: YP_170743.1; SelClCx2:
YP_400274.1; SelClCx3: YP_400605.1; Torpedo marmorata: TmClC-0: CAA40078
Transport across cell membranes
The important function of the plasma membrane is to isolate the exterior from the
interior of the cell in order to allow the biochemical processes and preservation of
labile biological molecules. However, in order to facilitate the exchange of substrates,
products and waste this isolation can not be absolute. Because only a very small
number of small lipophilic molecules, like O2 and CO2, can traverse the membrane
unmediated, biological membranes contain various systems that allow the controlled
passage of molecules. These systems are hydrophobic proteins that are inserted in the
3
Chapter 1
membrane and create pores or passageways for all kinds of molecules. These systems
can be divided in two major groups: passive transporters and active transporters.
Passive transport
Transport is considered to be passive when the movement of the solute is solely
driven by the concentration gradient that exists between the interior and the exterior of
the cell. In this case there is always a net flux from the compartment with a high to the
compartment with a low concentration. Subsequently, passive transport can be
divided into simple diffusion and facilitated diffusion. Osmosis, in that sense, does not
differ from solute transport. The only difference is that it concerns water transport.
Osmotic water fluxes are also driven by the differences in concentration. The higher
the concentration of dissolved solutes the lower the concentration of water and, thus,
water moves to areas with a high solute concentration and, thus, a low water
concentration (activity).
Simple diffusion
Simple diffusion through the membrane has only been demonstrated for a few
uncharged lipophilic molecules, like for instance O2, CO2 and NH3. However,
transport can be slow and can not be controlled. Hence, most fluxes of molecules are
facilitated by pores, formed by proteins.
Facilitated diffusion
Routes for facilitated diffusion are created by the insertion of hydrophobic
proteins into the membrane. These proteins have a hydrophobic surface, which allow
interaction with, and thus insertion into, the lipophilic membrane. Internally they
either contain a hydrophilic pore or a hydrophilic pathway, which allows the passage
of the solutes. These pores can be highly specific, in the sense that they allow only
passage of one single type of molecule, for instance potassium channels that only
allow the passage of K+ ions. Another group of ion-specific channels are the chloride
channels, they are named chloride channels because this was the first activity of these
channels detected. However, they are able to mediate fluxes of a few anions (Cl-, Br-,
I-, NO3-). Other pores are less specific and allow the passage of various types of
molecules. Fluxes through the channels continue until equilibrium in concentration is
reached (in the case of uncharged molecules) or if the Nernst potential for the ions
4
Chloride channels: A general introduction
transported is established. The Nernst potential considers next to the difference in
concentration also the fact that charges are transported. As soon as for instance K+
flows through a potassium-specific channel it leaves a negative charge behind and
thus a potential difference across the membrane is generated. At a certain moment the
polarization is so large that K+ ions cannot move anymore. The potential at which this
happens is called the Nernst potential for that particular ion.
An important aspect of channel-proteins is that they can be controlled. The
channels can be opened or closed according to the needs of the cell. This phenomenon
is called “gating”. Gating can be controlled by ligands, by membrane potential
(voltage-gated), by post-translational modifications or mechanically. Worth
mentioning in this context is the presence of two CBS domains in the ClC-proteins. It
is suggested that the CBS domains form a sensor that switches transporters between
an inactive and an active state (channels: gating) by interaction of the CBS domains
with the negatively charged membrane surface in response to the ionic strength. This
switching mechanism is an effective means for cells to respond to osmotic shifts,
because an increase in medium osmolality will result in a decrease in cell volume, and
the accompanying increase in cytoplasmic ionic strength will activate the transporter
(Poolman et al., 2006). The presence of these sensors in ClC proteins can be related
with the role of these channels in osmo-regulation, turgor-homeostasis and cell
growth.
Active transport
Cells need to accumulate compounds for different reasons and, thus need to
transport solutes against their concentration gradient. This can be achieved in three
ways. Firstly, the uphill transport of a solute is driven by the release of chemical
energy from the hydrolyzation of ATP or pyrophosphate (PPi), by redox reactions
(respiratory chain) or by light energy (photosynthetic apparatus). Secondly, the uphill
transport of a solute is coupled to the down hill transport of an other solute, and
finally, charged molecules move as a result of membrane potential against their
concentration gradient. The first type of transport is called primary active transport,
the second is a form of secondary active transport and the third is passive transport
down the electro-chemical gradient (but up the chemical gradient).
5
Chapter 1
Primary active transport
While the respiratory chain and the photosynthetic apparatus are special cases,
solute transport is usually energized by the hydrolysis of ATP. Four transport systems
exist which mediate primary active transport of solutes by ATP hydrolysis: P-type
ATPases, V-type ATPases, F0F1-ATPase and ABC-transporters. Important in plant
cell growth are the three primary transporters located in the plasma membrane and
tonoplast. These are the plasma membrane (PM) H+-ATPAse, the tonoplast V-type
H+-ATPase and the tonoplast H+-pyrophosphatase (PPase). Because these primary
transporters generate the proton-motive force across the plasma membrane and
tonoplast, they play an important role in the growth of cells. In that context their
activity is regulated by for instance growth controlling plant hormones like auxins
(Kitamura et al., 1997).
The PM H+-ATPase
The PM H+-ATPase has two roles in the plant cell: firstly it plays a role in
maintance of the cytosolic pH and secondly it generates the proton-motive force
across the PM which is used for the uptake of other solutes. The PM H+-ATPase is a
single-subunit protein and belongs to the P-type ATPases that extrudes H+ from the
cell. This proton pump is able to generate membrane potentials ranging from -120 to 160 mV (negative inside) and a pH gradient of 1.5 to 3 units (acid outside). The
membrane potential and the pH gradient form the proton-motive force which enables
the uptake of other solutes (Sze et al., 1999).
The Tonoplast H+-ATPase and Tonoplast H+-pyrophosphatase
The tonoplast H+-ATPase is a V-type ATPase and, as such, a multimeric complex
encoded by at least 26 genes (Strompen et al., 2004). The tonoplast H+-pumping
pyrophosphatase (H+-PPase) is single subunit proteins. Both these primary
transporters pump H+ into the vacuole. This action results in a pH gradient and a
membrane potential across the tonoplast. The pH of the vacuole is usually in the range
3-6 while membrane potentials up to 60 mV have been measured (positive in the
vacuole). These two primary pumps generated a proton motive force across the
tonoplast, which is used for the accumulation of solutes into the vacuole. These
solutes can be waste or toxic compounds (Na+), however, the majority of these solutes
are accumulated in order to generate a low water potential necessary for water uptake,
6
Chloride channels: A general introduction
turgor and growth. V-type ATPases have also been found in the endoplasmic
reticulum and trans-Golgi network. (Chanson and Taiz., 1985; Strompen et al., 2005
and Dettmer et al., 2005 and 2006), where they play a role in directing the transport
vesicles to their destination.
Secondary active transport
Secondary active transporters or co-transporters couple the uphill transport of
solutes to a downhill transport of another solute. In plants energy is stored in the
proton motive force (PMF) generated by the three major primary proton pumps and
most secondary active transporters use this PMF by coupling the transport of their
solute to the downhill transport of H+. Two distinct types can be distinguished. First
of all there are the symporters, where the transport of the solute is in the same
direction as the co-transported H+. The second type are antiporters in which the
direction of the substrate is opposite to the transport of the H+.
In the large family of ClC membrane proteins, transmembrane movement of Cland NO3- is facilitated by an antiporter mechanism in which a H+ is transported in the
opposite direction (Accardi and Miller 2004; Scheel et al. 2005). A recent
electrophysiological and molecular study demonstrated that ClC homologues are
antiporters in the vacuole of Arabidopsis that, through NO3-/ H+ exchange,
concentrate NO3- in a plant vacuole (De Angeli et al 2006).
Anion transporters
Chloride channel proteins
An important group of anion transporters in plants is the chloride channel (CIC)
family. Since the cloning of first member of the ClC family from the Torpedo electric
organ (ClC-0), these transporter-proteins have been identified in almost all organisms
(Gurnett et al., 1995; Klock et al., 1994). In mammals, ClC proteins form a family of
at least 9 different genes, which can be classified in three subfamilies (Jentsch et al
2005). While more and more individual ClC genes have been identified recently, a
nice synopsis of the presence of this gene family in plants can be obtained from the
complete genome sequencing projects. In the Arabidopsis genome 7 ClC genes are
present (Hechenberger et al 1996). In plants, ClC proteins participate in various
physiological functions, such as, osmoregulation, stomatal movement, cell signaling,
7
Chapter 1
nutritent uptake and metal tolerance (Barbier-Brygoo et al., 2000). Like for all other
organisms, the discussion concerning the real substrates of the ClC proteins in plants
is still continuing. Proteins are designated a chloride channel (ClC) based on the fact
that the cDNA from the prime example, ClC-0, isolated from Torpedo, gave currents
typical for the Torpedo electric organ chloride channel in Xenopus oocytes (Hirono
1987; Gundersen 1984). However, during the last years a dualistic character of these
proteins has surfaced. Some members of this family are indeed functional Clchannels, but recently evidence has come forward showing that other members of this
family mediate fluxes of NO3- and, evenmore surprising, in some cases the transport
the anions is coupled to a proton counterflux, which changes the nature of the channel
into that of an antiporter.
Structural organisation of ClC transporters
The Escherichia coli EcClC and Salmonella typhimurium StClC proteins were the
first ClC proteins to be crystallized and provided the second structure of a
transmembrane channel protein (Dutzler et al., 2002; Dutzler et al., 2003). These
studies revealed that the members of the ClC family share a conserved structural
organization, consisting of a transmembrane channel domain and in many cases of
cytoplasmic regulatory domains, like the two cystathionine-β-synthetase domains
(CBS1 and CBS2) at the carboxyl end (see above). EcClC crystallizes, and probably
functions, as a homodimer with each subunit containing an independent ion
translocation pore. The subunits exhibit an ‘antiparallel architecture’: one subunit
contains two structurally related halves spanning the membrane with opposite
orientations (Dutzler 2006; Dutzler et al., 2002, 2003). This topology shows similarity
to other transporter proteins, namely the presence of broken α-helixes and partly
inserted α-helixes and the anti-parallel architecture. A common topology of ClC
proteins has been presented in Dutzler (2006), in which 18 α-helices are recognized,
8
AT5G40890.2
AT3G27170.1
AT5G49890.1
AT5G26240.1
AT4G35440.1
AT1G55620.1
AT5G33280.1
AtClCa
AtClCb
AtClCc
AtClCd
AtClCe
AtClCf
AtClCg
S
-
-
S
S
P
P
GS/PGIPEa
E to A
K to P
K to P
+
+
+
+
GKEGPb
+
E to T
E to S
+
+
+
+
Glub
270
+
F to Y
F to Y
+
+
+
+
GXFXPb
Presence of structural element
+
-
-
+
+
+
+
564
Tyrc
A -,
no pH gating
A-
A-
H+/Cl-
H+/Cl-
H+/NO3-
H+/NO3-
Predicted
Function
Marmagne et al., 2007
Gaxiola et al., 1998; Lv et
al., 2009
Gaxiola et al., 1998;
Hechenberger et al., 1996;
Lv et al., 2009
De Angeli et al., 2006
Confirmed function by
Table 1: Structural characteristics of the Arabidopsis thaliana ClC proteins and their predicted function, based upon these
characteristics. a: The presence of a proline or a serine at position 2 of the motif is indicated by a “P” or an “S”, respectively. The
absence of the motif in the protein is indicated by “-“. b: The presence of the exact motif is indicated by “+”, If the motif is precent
in a modified form the change is indicated by the one letter amino acid code. c: The presence or the absence of the tyrosine is
indicated by “+” or “-“, respectively.
TIAR code
Protein
9
Chloride channels: A general introduction
Chapter 1
of which 17 are fully or partly inserted into the membrane. If this structure can be also
applied to the plant ClC proteins, remains to be seen. At least AtClCa,b,c,d, and g,
which show a high homology with EcClC and contain clearly the conserved
functional domains (GP/SGIP and GK/REPG), might show this topology (Table 1).
AtClCe and f have a lesser homology with the archetype and for instance lack the
GP/SGIP motif (Table 1) and might therefore differ structurally. If plant ClC proteins
function as homodimers, like their bacterial counterparts, also remains to be
determined. Most bacteria contain only one ClC gene, whereas for instance
Arabidopsis contains seven. If some of these plant ClC proteins are targeted to the
same membrane the formation of heterodimers is a possibility.
The ClC transporter family is an interesting group of transporters, as the overall
structural organization of these proteins allow the members either to function as a
channel or a transporter or even as both. This is not an oddity, but a universal property
of possibly all eukaryotic CLC members (Dutzler, 2006, 2007). Therefore, the
molecular architecture of the protein should be able to support both modes of
transport. In the structure of EcClC, but also present in the amino acid sequences of
the Arabidopsis ClC proteins, several essential motives and amino acids have been
recognized. In the crystal structures of the ClC proteins three Cl- binding sites were
recognized (Dutzler et al., 2002; 2003). The first one is, together with other elements,
created by the 564Tyr residue (numbering for AtClCa) and the serine residue of the
motif GSGIP (Figure 2). This site is referred to as the central binding site (Scen). The
internal (close to the cytoplasm) binding site (Sint) is formed by main-chain amide
nitrogen atoms of less conserved amino acid residues (Figure 2). The third binding
site (Sext; Figure 2), which was only recognized after changing glutamate148
(counting in E.coli) to alanine is formed by residues from conserved motifs GK/REGP
and GXFXP (Dutzler et al., 2000). Together these three sites in the channel protein
form the path along which the Cl- ions travel according their electrochemical
potential.
Recently an important observation was made in relations to the NO3- versus Clspecificity of the transporters. The Arabidopsis AtClCa protein which is a NO3transporter in which the transport of 2 nitrates into the vacuole is tightly coupled to
movement of a proton in the opposite direction, contains, instead of the serine in the
GSGIP motif, a proline. Mutating AtClCa (P to S) and the mammalian ClC-5 (S to P)
at this position, showed the importance of these residues in substrate specificity. In
10
Chloride channels: A general introduction
Figure 2a.The gating mechanism of CLC proteins which function as channels
(see text)
The cartoon displays one monomer. A: Open conformation. B: Closed conformation.
C- and CH; deprotonated and protonated carboxyl group, respectively, of the gating
glutamate (see text). Sext, Scen and Sint indicate the three anion binding sites. The
respective elements forming the binding sites are indicated in the open configuration.
Sint is formed by main-chain amide nitrogen atoms.
Figure 2b. Model of the transport mechanism of ClC proteins which function as
2A-/H+ antiporters
The cartoon displays one monomer cycling through the different conformations. Cand CH: deprotonated and protonated carboxyl group, respectively, of the gating
glutamate (see text). E- and EH: deprotonated and protonated gating glutamate (see
text).The transport cycle: Step 1: All three binding site become occupied by an anion
(in this case a Cl-). The gating glutamate is protonated and in the open conformation.
The proton-donating becomes protonated (can also take place at step 2). Step 2: The
11
Chapter 1
gating glutamate deprotonates and “pushes” the anions through the channel. Two
anions leave the channel. Step 3: The channel becomes blocked between Sint and Scen
(see figure 3) which prevents back flow of anions. A proton is transferred from the
proton-donating glutamate to the gating glutamate and the gates opens and the system
returns at step 1.
AtClCa, the P to S mutation resulted in a Cl-/H+ exchange comparable to NO3-/H+
exchange, while in the wild type protein Cl- transport is negligible. The opposite
change in the mammalian ClC-5 protein, which normally transports Cl- tightly
coupled to H+ and NO3- almost uncoupled, resulted in a coupled NO3- transport
(Bergsdorf et al., 2009). Table 1 shows the distribution of the GS/PGIP variation over
the Arabidopsis CLC proteins.
Two other important residues are the glutamates at positions 203 and 270
(numbering in AtClCa). Glutamate203 is part of the motif GK/REPG and is highly
conserved in the ClC proteins. In Arabidopsis only AtClCg has an alanine at this
position (GKAPG), the other 6 contain this glutamate. In the first structures of the
ClC proteins only two binding sites for chloride were recognized (Sint and Scen)
because of there occupation by chloride ions. The third binding site (Sext) was only
recognized after the respective glutamate in EcClC was mutated, resulting in an
additional halogen anion in the crystal structure (Dutzler et al., 2003). As a
consequence, the gating mechanism of the ClC channels is assumed to be mediated by
this glutamate, which under the proper conditions (pH) mimics a chloride anion and
binds in the Sext binding site and closes the channel. The change to an alanine results
in a channel, which can not be closed (Dutzler et al. 2003; Dutzler, 2006; 2007; Jian et
al., 2004). Recently, also a role of this glutamate in the functioning of the ClC
transporters has been observed. In AtClCa, which in Xenopus shows NO3-/H+
exchange and to a lesser extend Cl-/H+ exchange, mutating 203Glu results in uncoupled
anion conductances, indicating a role of this glutamate in the coupling of the transport
of protons to the anions (Bergsdorf et al., 2009). This effect of this amino acid change
was also observed in other ClC transporters (Accardi and Miller., 2004; Zdebik et al.,
2008).
Changing the 270Glu to an alanine completely abolished the anion currents
mediated by AtClCa in Xenopus-oocytes. However, currents could be restored by the
uncoupling Glu203Ala mutation (Bergsdorf et al., 2009). The idea is that 270Glu,
which is located at the cytoplasmatic site of the membrane, binds protons and hands
12
Chloride channels: A general introduction
them over to the gating 203Glu, which results in the coupling of the anion flux to the
proton flux (Accardi et al., 2005; Dutzler, 2007; Lim and Miller, 2009; Zdebik et al.,
2008).
Based on the structural information, given above, predictions can be made about
the function of the Arabidopsis ClC proteins (Table 1). The model described above
can be applied to AtClCa, b, c, d and g resulting in AtClC a and b being NO3transporters and AtClCc and d being Cl- transporters. The absence of the equivalent
glutamate residue of 203Glu in AtClCg suggests this might be a channel. However, its
anion preference is difficult to deduce. AtClCa has been shown to function as a
H+/NO3- (De Angeli et al., 2006). AtClCc and d are able to complement the chloride
transporting ClC protein in yeast, GEF1. AtClCa was not able to do so. Those
observations in yeast are in agreement with the role of these proteins as chloride
transporter or nitrate transporter, respectively (Gaziola et al., 1998; Hechenberger et
al., 1996). AtClCe and f, on the other hand, are more difficult to label. They show the
lowest homology with EcClC and the other Arabidopsis ClC proteins. They even lack
some critical residues (for instance the 564Tyr) and motifs (GS/PGIP), hence the
function and role of these two ClC proteins based on their sequence is difficult to
predict.
Figure 1 shows the phylogenic tree containing a considerable set of ClC proteins
from all the major kingdoms and the Arabidopsis proteins. As can be observed, 5 of
the Arabidopsis proteins form their own branch. Only AtClCe and f mingle with ClC
proteins from other kingdoms and more particulary with those from cyanobacteria.
This suggests that these ClC proteins are more related to cyanobacterial proteins
which could be explained by the cyanobacterial origine of the chloroplast and, this
indicates that AtClCe and f are located in the chloroplast.
Calculating a phylogenic tree of a large set of plant CLC proteins resulted in
another picture (Figure 3). In this situation the ClC proteins were organized according
to their characteristics as also used in Table 1. First a large branch could be split off in
which the GS/PGIP motif is absent and a modified GKEGP motif was present (the
lysine was replace by a proline, hence: GPEGP). In this group the proton-donating
glutamate is also absent. This branch contains both AtClCe and f and in combination
with the location of these two Arabidopsis proteins in figure 1 this suggests that the
other plant ClC proteins of this branch are also anion channels which function in
chloroplasts or mitochondria. The absence of the GS/PGIP motif has until now not
13
Chapter 1
Figure 3. Neighbor-Joining Consensus tree of plant ClC proteins
The tree was calculated using the Geneious program. Branches are grouped according the
presence of elements in the sequence: GP/SGIPE, GKEGP, GXFXP, “glu” indicates the
proton-donating glutamate (see text). When the respective element has been striked through
this element can not be detected in the protein sequences of the group. Bold and underlined
residues indicate differences between this motif with the other groups or the consensus.
Arabidopsis thaliana: AtClCa: CAA96057.1; AtClCb: CAA96058.1; AtClCc: CAA96059.1;
AtClCd: P92943.2; AtClCe: AAK53390.1; AtClCf: AAK53391.1; AtClCg: P60300.1;
Glycine max: GmClC1: AAY43007.1; Medicago truncatula: MtClCx1: ABE91957.1;
Nicotiana tabacum: NtClC1: CAA64829.1; NtClC2: AAD29679.1; Oryza sativa: OsClC1:
BAB97267.1; OsClC2: BAB97268.1; OsClCx3: NP_001047143.1; OsClCx4:
NP_001047955.1; OsClCx5: NP_001062147.1; OsClCx6: NP_001066692.1; OsClCx7:
NP_001054061.1; Physcomitrella patens: PpClCx1: EDQ80065.1; PpClCx2: EDQ78881.1;
PpClCx3: EDQ52731.1; PpClCx4: EDQ64061.1; PpClCx5: EDQ63773.1; Populus
trichocarpa: PtClCx1: EEE85399.1; PtClCx2: EEE77376.1; PtClCx3: EEF09978.1; PtClCx4:
EEF01954.1; PtClCx5: EEF10085.1; PtClCx6: EEE99668.1; PtClCx7: EEE84906.1; Ricinus
communis: RcClCx1: EEF34561.1; RcClCx2: EEF47977.1; RcClCx3: EEF31629.1;
RcClCx4: EEF33157.1; RcClCx5: EEF50918.1; RcClCx6: EEF45376.1; Solanum
lycopersicum: SlClCx1: CAC36403.1; Solanum tuberosum: StClCx1: CAA71369.1; Vitis
vinifera: VvClCx1: CAO47567.1; VvClCx2: CAO71138.1; VvClCx3: CAO67080.1;
VvClCx4: CAO66848.1; VvClCx5: CAO48998.1; VvClCx6: CAO69292.1; VvClCx7:
CAO46902.1; Zea mays: ZmClCx1: ACN33881.1; ZmClCx2: AAP04392.2
been implicated with a characteristic of these ClC proteins. It is not known whether
this affects ion-specificity or other transport characteristics. The effect of replacing
the lysine next to the gating glutamate with a proline also is unknown, although an
14
Chloride channels: A general introduction
effect on the pKa of the glutamate can be expected and, thus maybe on the
transporters pH-dependence. Hence, these proteins are probably pH-sensitive anion
channels.
A second group, which includes AtClCc, is characterized by the presence of the
two motifs GSGIP and GKEGP and the presence of the proton-donating glutamate.
These proteins are therefore probably H+/Cl- exchangers.
AtClCg is a member of a third group, which is typified by the presence of the
motifs GSGIP and GKAGP. Also the proton-donating glutamate is present in this
branch. As shown in Bergsdorf et al (2009) the engineered combination of the
presence of the proton-donating glutamate and the absence of the gating glutamate in
AtClCa resulted in an uncoupled Cl- and NO3- conductance. Consequently, this branch
probably represents genuine anion channels. However, AtClCa is a H+/NO3exchanger, based on the presence of the motif GPGIP which changes to an anion
channel with a higher conductance for Cl- than for NO3- when the proline is changed
to a serine. How the serine in the GSGIP motif in the branch of AtClCg affects the
characteristics of these ClC proteins is unknown.
The final branch, which can be distinguished, is a branch representing H+/NO3exchangers. The proteins in this branch contain the GPGIP and GKEGP motifs and
the proton-donating glutamate, which are all features in accordance with a H+/NO3exchanger.
Moreover, if one considers the few plant species of which a (almost) complete
genome is available, Vitis vinifera, Oryza sativa, Arabidopsis thaliana and Populus,
all branches of the tree contain at least one protein of these species. This suggests an
early diversification of the ClC proteins in plants and a low redundancy of function
between the members of the different branches.
Tissue and intracellular localization
An important indication for the function of proteins is their functional localization.
In this respect both tissue and intracellular localization are important. Those two
levels of localization are mainly regulated in two different ways. Whereas tissuespecific expression and developmental stage-specific expression are controlled at the
gene level, intracellular localization is controlled by sorting peptides present in the
protein. However, the nature of the translation product (different splice forms or
alternative translation initiation), controlled at gene or RNA level, can also affect
15
Chapter 1
intracellular localization (Millar et al., 2009). Tissue expression is studied by geneexpression studies or by promoter fusions. Lv et al., (2009) made a thorough analysis
of tissue-specific AtClC-gene expression by RT-PCR and promoter-driven GUS
expression. In their RT-PCR experiments ubiquitous expression of all ClC genes
throughout the plant was observed with only small variations in the level of
expression amongst the tissues. Such an expression profile suggests that the various
ClC proteins have distinct individual functions and roles and have little or no
redundancy. Interesting in this context, are the more or less inverse expression
profiles of AtClCe and f. While AtClCe is more expressed in leaf, flower and silique,
AtClCf is more expressed in root and stem. As suggested above these two proteins are
probably functioning in either the chloroplast or mitochondrion.
The histochemical study of Lv et al. (2009) also demonstrated that ClC members
have individual functions. There expression patterns overlapped, but they had also
their differences. The largest differences were observed between AtClCa, b, c, d and
g, on the one hand, and AtClCe and f on the other. The temporal and spatial
distribution of AtClCe and f suggest a relation with the presence of functional
chloroplasts. No evident expression was observed for these genes in the root.
Moreover, it has been shown that photosynthesis is disturbed in mutants of AtClCe
(Marmagne et al., 2007).
Another important issue is the subcellular localization of the ClC proteins.
Predictions can be made using the Aramemnon web-based prediction tool (Table 2)
but recently several studies using fusions of the AtClC proteins with fluorescent
passenger proteins (FP) like Green Fluorescent Protein derivatives or Discosoma sp.
Red (DsRed) has been used (De Angeli et al., 2006; Fecht-Bartenbach et al., 2007; Lv
et al., 2009; Marmage et al., 2007) (Table 2). Also, a few ClC proteins of Glycine
max and Oryza sativa have been localized using fusions to fluorescent markers (Li et
al., 2006; Nakamura et al., 2006). However, as Moore and Murphy (2009) state:
“Determining protein localization inevitably is an exercise in imperfection.” They
(Moore and Murphy, 2009) and Millar et al. (2009) discuss the state of the art of
intracellular protein localization, summarize the strengths and weaknesses of the
employed protocols and give guidelines for validation of the localization of proteins.
Amongst the issues they raise are the use of strong, heterologous promoters to
generate aesthetically pleasing images and the positioning of the fluorescent
passenger proteins in an construct. Another important feature, which increases the risk
16
strongly secretory.pathway
weakly secretory.pathway
weakly secretory pathway
secretory pathway
mitochondrion>chloroplast> secretory pathway
mitochondrion > secretory pathway
weakly secretory pathway
AtClCa
AtClCb
AtClCc
AtClCd
AtClCe
AtClCf
AtClCg
tonoplast
golgi
thylakoid
golgi
tonoplast
tonoplast
tonoplast
Experimentally
determined
35S
35S
35S
35S
35S
35S
35S
35S
35S
35S
35S
Promotera
C
C
C
C
C
C
C
C
C
C
C
Location FPb
Fecht-Bartenbach et al., 2007
Lv et al., 2009
Marmage et al., 2007
Lv et al., 2009
Marmage et al., 2007
Lv et al., 2009
Lv et al., 2009
Lv et al., 2009
De Angeli et al., 2006
Lv et al., 2009
Lv et al., 2009
Reference
Table 2: Predicted and experimentally determined localization of the Arabidopsis thaliana ClC proteins
a
: promoter of the fusion protein of the ClC and fluorescent protein, 35S: Cauliflower Mosaic Virus 35S promoter; b: location of the fluorescent
protein, C: C-terminal.
Aramemnon prediction
Protein
17
Chloride channels: A general introduction
Chapter 1
of creating artifacts, is the routing of most proteins through various compartments
before they reach their destination. This movement requires saturable transport and
signaling systems, which can result in missorting (Moore and Murphy, 2009),
especially in the case of over-expression. Moreover, during trafficking the various
stations passed could have different amounts of the trafficking proteins. As a result
higher protein amounts can be present at the intermediate stations and the
fluorescence at these locations could outshine the fluorescence of the protein at the
final destination. Even alternative locations, like the tonoplast or the plasma
membrane could be reached due to congestion of the original route (Moore and
Murphy, 2009). Hence, it can be asserted that in the case of membrane proteins, like
ClC proteins, these artifacts are probable to occur. Membrane proteins have a lower
degree of freedom and have to traffic via membranes.
If we consider the guidelines for validation of the location of proteins as suggested
by Millar et al. (2009), the experiments performed in order to determine the location
of the ClC proteins are not optimal. Some of the major concerns are: 1) all studies use
the Cauliflower Mosaic Virus 35S promoter, which results in an uncharacteristically
high expression, presenting for membrane proteins an even larger ‘congestion’
problem, 2) in those studies the fluorescent passenger protein is attached to only one
location in the protein. In the studies with the Arabidopsis, Glycine ClC proteins the
FPs were all fused to the C-terminus of the proteins (De Angeli et al., 2006; FechtBartenbach et al., 2007; Li et al., 2006; Lv et al., 2009; Marmage et al., 2007). In the
studies with the Oryza proteins the FPs were fused to the N-terminus (Nakamura et
al., 2006). Although the results are in agreement with the ideas of the function of the
ClC protein, this means care must still be taken with the interpretation of the recent
fluorecence data on the localization of the ClC proteins.
For example, the Glycine max ClC1 protein was placed in the tonoplast because of
its co-localization with GmNHX1 (Li et al., 2006). NHX1 is an established tonoplast
protein. However, in this study both proteins were visualized by the use of the strong
Cauliflower Mosaic Virus 35S promoter. Although both proteins display a similar
localization, we are doubtful about the result that shows a tonoplast localization.
Apparently, both proteins accumulate in endomembrane vesicles which either
outshine the proteins in the tonoplast, or are the result of congestion of the transport
systems. Lurin et al. (2000) studied the localization of NtClC1 using fractionation and
Western-blotting and concluded that this protein localizes to mitochondria. The
18
Chloride channels: A general introduction
closest homologue of NtClC1 in Arabidopsis is AtClCc, which is experimentally
located in the tonoplast (Table 2). In spinach a ClC protein was found in the outer
envelope of chloroplast by mass-spectrometry and membrane fractionation (Teardo et
al., 2005). This spinach protein gave three peptides that had sequences identical to the
partial sequences of the AtClCf protein. However, the AtClCf protein is
experimentally located in the Golgi membrane, but predicted to be targeted to the
mitochondria (Table 2).
Differences between patch-clamp and molecular studies
Electro-physiological studies have been performed on plants for at least 60 years.
In the early years only membrane potentials could be measured by impalement of
electrodes into cells and tissues. This is a technique that only allows a general study
of the behavior of the membrane potential of plant cells upon varying conditions.
Presently the high-resolution electro-physiological method, the patch-clamp
technique, allows the study of single conductances in membranes. However, both
patch clamp and the impalement of electrodes are invasive techniques, which require
isolation of cells or protoplasts or wounding of the tissue. Especially, the patch clamp
technique revealed an enormous number of ion-conductances present in plasma
membrane and tonoplast. However, the matching of conductances with proteins and
their corresponding genes is a laborious process. Forward genetics appears difficult,
starting from a current and trying to find a protein, which is responsible for the
current. However, reverse genetics has proved useful in identifying the transporter
proteins, responsible for the conductances observed by patch clamp. A nice example
of such a study is the characterization of the AtClCa protein in the tonoplast of
Arabidopsis thaliana (De Angeli et al., 2006). In this study it is shown that in two
independent knock-out plant lines, in which AtClCa is absent, a certain nitrate current
could no longer be observed in the tonoplast, indisputably matching the nitrate
conductance to the AtClCa protein. Recently, a new electrophysiological technique
has been developed. The Micro-Electrode Ion Flux Estimation (MIFE) technique
allows the noninvasive and simultaneous monitoring of different ion fluxes from
intact tissues with a high spatial and temporal resolution (Shabala et al., 1997;
Newman, 2001; Tegg et al., 2005; Vreeburg et al., 2005; Lanfermeijer et al., 2008).
Without damaging the tissue this technique is able to detect changes in fluxes of
19
Chapter 1
various ions by the use of ion-specific electrodes. However, no studies with this
technique on ClC proteins are known to us.
The physiology of anions
The most abundant anions in plants are nitrate, chloride, sulfate, phosphate and
malate. Carbonate, despite its low concentration, compared with other inorganic
anions, occupies a particular status, as it plays a role in intracellular pH regulation
and is the major carbon input for photosynthesis (Barbier et al., 2000). Most anions
have important metabolic functions and most can be accumulated in the vacuole. In
plant cells relative concentrations of anions vary, depending on the tissue and
physiological and environmental parameters. In plant cells, the highest anion
concentrations are found in the vacuole, while cytosolic levels are maintained in the
millimolar range. Of these, the inorganic ions have to be taken up from the
environment. In higher plants the root system is responsible for the uptake of nutrients
and, thus, most inorganic anions. Subsequently, the anions (and their counter cations)
are transported to the shoot by the transpiration stream. Although, most of the
transport by the transpiration stream can be apoplastic and does not need passage of
membranes, at least at the Casparian strips in the roots the ions have to enter the
symplast. Hence, they have to pass the plasma membrane at least twice. Anion
channels have been reported in the xylem parenchyma cells of barley roots (Wegner
and Raschke., 1994; Kohler and Raschke. 2000; Kohler et al. 2002), root stellar cells
of maize (Gilliham and Tester. 2005) and Arabidopsis root pericycle cells (Kiegle et
al. 2000). Kohler and Paschke (2000) identified fast and slow activating anion
channels in barley xylem parenchyma cells. After the anions have arrived at the sink
tissue (growing leaves, fruits, etc) they have to enter cells. It is hypothesized that the
influx of chloride occurs via H+ /anion symporters or OH- /anion antiporters (Zeiger et
al., 1978).
Anion fluxes in the plant cells
The different cell compartments require all their specific concentrations of
metabolites and minerals. These concentrations are all maintained by transport
systems, which are energized by ion-gradients and potential differences, generated by
the primary pumps. Anion fluxes play an important role in these processes. First of all
20
Chloride channels: A general introduction
in the generation of the proton motive force. They relieve the membrane potential
generated as a consequence of the transmembrane transport of protons. When for each
proton moved an anion is transported in the same direction the membrane protential
does not rise so drastically. This allows more protons to be transported and the proton
gradient to become larger than in the absence of anion fluxes. Although the driving
force on protons is thereby reduced, the power for transport of solutes coupled to
protons is increased. This is the so called shunt-function of anion fluxes.
The second function of anion fluxes is related to the role of anions as osmotically
active solutes. The accumulation of anions and their counter ions in cells drives the
uptake of water into the cells and, subsequently, the generation of cell turgor. Cell
turgor, in its turn drive cell expansion and cell growth.
Their role in water movement and turgor regulation makes anion fluxes also
important in the opening and closing of stomata. Stomata are microscopic pores in the
aerial parts of the plant, which provide a passageway for CO2, that is needed for
photosynthesis, to enter the leaf. Guard cells surround the pore and the swelling and
shrinking of these cells modulate stomatal pore size by coordinating responses to
environmental and physiological factors, including light, temperature, Ca2+, and the
plant hormone abscisic acid. During stomatal opening and closing, chloride and
malate are the major anionic species involved in turgor generation for opening. It has
been known for several decades that guard cells can take up chloride ions during
stomatal opening, but the molecular mechanism of that is still not fully understood.
The role of pH in plant cell growth
Many different physiological events in plant cells are regulated by changes in pH
or depend on proton gradients. In plant cells pH is well characterized as a regulator of
processes, such as modulation of Ca+2 signaling, protein synthesis, and enzyme
activity. In plant cells, according to the plant species and the technique of
measurement used, cytosolic pH values in resting conditions are between 6.8-7.9
(Guern, 1991). In response to osmotic stress and hormone treatment, the cytosolic and
apoplastic pH both fluctuate (Guern., 1991; Tretyn et al., 1991; Nuhse et al., 2000). In
plant cells, the PM H+-ATPase is the primary active transport system and mainly
responsible for generating the membrane potential and the proton gradient and
maintaining the cytosolic pH (Assman and Haubrick., 1996). It is also known that
changes in cytosolic pH can act as a second messenger in plant cells (For review, see
21
Chapter 1
Felle, 1989; Guern et al., 1992; Zimmermann et al., 1999). According to the acid
growth theory (Rayle et al., 1970; Cleland, 1971; Hager et al., 1971) , low pH induces
rapid cell wall loosening and cell elongation. In pea leafs the increased extrusion of
protons by the activated PM H+-ATPase results in the enlargement of the pH gradient
and the hyperpolarization of membrane potential across the plasma membrane, which
result in an increase of the proton-motive force. This stimulates the uptake of nutrients
and osmotically active solutes. Subsequently, water is also absorbed as a result of
osmosis and cell turgor increases (Staal et al., 1994). The extracellularly located
expansins react to the acidification of the cell wall by activation of their cellulose and
hemicellulose degrading properties (Cosgrove, 1998), while Ca2+-pectin cross-links
are broken as a result of displacement of the Ca2+ by H+ (Proseus & Boyer, 2006; den
Os et al., 2007). Both these reactions increase the cell wall elasticity. The increases in
turgor and cell wall elasticity result in cell expansion. But also in roots the elongation
is regulated by acid growth phenomena (Edwards and Scott., 1974; Buntemeyer et al,
1998; Peters and felle, 1999). In Arabidopsis root, changes in root cap pH are required
for the gravitropism (Fasano et al 2001).
Anion and cation channels play an important role in this growth process. The
movement of cations in the opposite direction or an anions in the same direction as the
proton flux, can aid in the generation of the proton gradient (the shunt function; see
above) and increase the extracellular acidification. Changes in the activity of ion
channels can therefore result in changes in the membrane potential and in the pH
gradient (Johannes et al., 1998) and therefore the ability of cells to grow. Secondly,
anions are used as osmotics and a change in the transport capacity of these solutes can
affect growth. The importance of anion fluxes is demonstrated by the fact that in
AtClCd knock out mutants root growth is reduced compared to wildtype at a slightly
alkaline pH of the growth medium (Fecht-Bartenbach et al).
Perspectives
Although their importance in processes like pH homeostasis, growth, abiotic and
biotic stress resistance, osmotic acclimation, nutrient uptake and transport has been
amply demonstrated, the physiological characterization and the knowledge of the
position of ClC proteins in the complex network of membrane transport and solute
fluxes is still incomplete. Mutant analysis, combined with detailed physiological
22
Chloride channels: A general introduction
studies can provide us with much of the data necessary to fill these gaps in our
understanding. In this study we used knock-out mutants to elucidate the role of
members of the AtClC transporter family with the use of the MIFE technique. In this
thesis the role of AtClCa and AtClCd in pH homeostasis and metal-tolerance has been
demonstrated
23
24
Chapter 2
Generation and characterization of anion channel mutants
in Arabidopsis thaliana
Hossein Moradi1,2, Theo Elzenga1 and Frank Lanfermeijer1
1
Department of Plant Biology, University of Groningen, 9750 AA Haren, the Netherlands
2
Department of Agronomy and Plant breeding, Sari Agricultural Sciences and Natural Resources
University (SANRU), Sari, Iran
25
Chapter 2
ABSTRACT
The chloride (Cl-) and nitrate (NO3-) anions are major inorganic constituents
of plant cells. These anions play a role in turgor maintance, signaling (Cl-) and
metabolism (NO3-). An important group of anion transporters are the Chloride
Channel (ClC) proteins, which facilitate the transport of Cl- and NO3- ions. These
proteins are reported in all plant cell membranes and appear to be involved in
various physiological processes such as the control of stomata movements, xylem
loading and plant pathogen interactions.
To study the role of these ClC proteins in plants we obtained three T-DNA
insertion lines for the AtClCa, b, and d genes. In order to characterize the ability
of these genes to complement each other we generated the three double and the
single triple mutants.
Seed germination on media with supplemented with different concentrations
of NaCl, CholineChloride, KCl and KNO3 did not show a difference between the
different genotypes. The Micro-Electrode Ion Flux Estimation technique was
used to monitor and characterize H+ and Cl- fluxes from intact leaf tissue and the
changes in these fluxes induced by changes in the external NaCl concentration.
Although NaCl induces a transient change in the fluxes of chloride and protons,
the responses of the mutant plants were not distinguishable from wild type. Also
morphologically the mutant plants were similar to the wild type. However, when
the pH of the growth medium was increased from 5.8 to 6.2 root growth in
mutant lines, Atclca and Atclcd, the double mutant Atclcad and triple mutant
Atclcabd was reduced.
26
Generation and characterization of anion channel mutants
INTRODUCTION
Although chloride concentrations in plants are considerable, usually the
compound is considered to be an essential micro-nutrient (Broyer et al. 1954).
Chloride is essential for the optimal activity of several enzymes. In photosynthesis
chloride plays a role in the water splitting complex. Chloride also plays an important
role in osmoregulation and growth (Barbier-Brygoo et al. 2000). Cell expansion is
driven by turgor pressure which results from the osmotically driven uptake of water
into the cell. Water enters the cells due to the high concentrations of potassium and
anions, like chloride and malate. During rapid growth, chloride accumulates in the
vacuole of plants cells, where concentrations up to 40 mM can be measured (BarbierBrygoo et al., 2000). A specialized, but closely related, role is the involvement of
chloride in the opening and closing of stomata. Stomata open as a result of an increase
in turgor. This turgor increase results from the uptake of water into the guard cells.
The continuous redistribution of chloride between the guard cells and the surrounding
tissue upon changing conditions, is one of the mechanisms controlling the opening
and closing of the stomata (Pandey et al 2007). Another role of chloride is associated
with the negative charge of the ion. Transport of anions across a membrane can
compensate for the currents, which result from transport of positive ions (like
protons), thereby allowing a steeper concentration gradient of these cations across the
membrane. In this context a role of chloride has been demonstrated in proton transport
by the plasma membrane H+- ATPase and the vacuolar V-type ATPase (Felle 1994).
Other transport processes were chloride is either directly of indirectly involved are for
instance Na+/H+ and HCO3-/ Cl- exchange (Jentsch et al 2002).
Mechanistically, at low external concentrations, Cl- can be taken up via a H+/ Cl- cotransporter, while at high Cl- concentrations the anion might enter passively through
anion channels. Active chloride uptake and transport by roots has been demonstrated
(reviewed by White and Broadley, 2001) and also Cl- transport to the shoot is
controlled by the roots (Sauer, 1968; Downton, 1977; Storey et al., 2003). It is
unknown which systems actually mediate Cl- uptake into the symplast of the root.
Considering the concentration gradient, which exists between the apoplast and the
symplast, the systems involved should be active transporters. Only under high saline
conditions the concentration gradient might be in favor of passive uptake of Clmediated by chloride-specific channels or more non-specific anion channels.
27
Chapter 2
An important group of anion transporting proteins is the Chloride Channel (ClC)
proteins. Seven ClC genes have been identified in the Arabidopsis genome. ClC genes
are present in most organisms: their presence has been shown in fungi, bacteria,
animals, and plants. The ClC protein family has been best characterized in mammals,
in which nine different ClC members are present. These proteins can be divided into
three groups based on their localization in the plasma membrane or intracellular
membranes (Jentsch et al., 2002). The 3D structure of these proteins has been solved
(Dutler et al., 2002; Dutzler et al., 2003) which allows a detailed study of the
structure-function relationship in these proteins. In Arabidopsis the seven members
can be divided into two groups (Lv et al., 2009). This division is based on their
molecular structure and seems to be related to their mode of action. The seven
proteins have been demonstrated as a group to be present in cell membranes where the
different members have their own specific localization (De Angeli et al., 2007;
Marmagne et al., 2007; Lv et al., 2009). They are involved in turgor and
osmoregulation, membrane potential control, vesicle trafficking, nutrient transport,
stomatal movement, and resistance to heavy metals and salt stress (Barbier-Brygoo et
al., 2000; Skerett and Tyerman., 1994; Tyerman et al., 1997).
Despite the key role of chloride in various processes, little is known about the role
of the ClC proteins in Cl- homeostasis and, for instance, salinity stress. Moreover,
interaction and coordination of the activities of the seven ClC proteins can be
expected. In order to address these issues we set out to isolate mutants of ClC genes.
We have identified three Arabidopsis mutants lines which carry a T-DNA insert in the
AtClCa, AtClCb, and AtClCd genes, respectively. We show the absence of transcripts
of these genes in the mutant plants and made the three double mutants and the triple
mutants and performed a preliminary evaluation of those six mutant lines. Under the
conditions we used no obvious phenotypes were observed for the single mutants. We
could only observe a phenotype in the double and triple mutants containing insertions
in both the AtClCa, and AtClCd genes when the plants were grown at a pH higher
than 5.8.
28
Generation and characterization of anion channel mutants
MATERIALS AND METHODS
Plant material and growth conditions
Seeds of Arabidopsis T-DNA insertion lines were obtained from NASC (AtClCa:
WiscDsLox477-480I4; AtClCb: SALK_ 27349; AtClCd: SALK_42895). For in vitro
growth experiments, seeds were surface sterilized with gaseous chlorine (derived from
acidified sodium hypochlorite) and sown on a half-strength Murashing and Skoog
medium (MS/2), supplemented with 1% w/v sucrose and buffered with 10 mM MESTris, pH 5.8 and with 0.8% w/v of agar. For the selection of the mutants 50 μg/ml
kanamycin was added. The dishes were sealed with surgery tape (3M). For the growth
analysis the proper salts and additives were added or the pH was adjusted accordingly.
For growth on soil, seeds were surface sterilized and sown in pots contain an
organic-rich soil (TULIP PROFI No.4, BOGRO B.V., Hardenberg, The Netherlands).
All dishes and pots, were incubated in the dark at 4oC for 3 days. Subsequently, the
dishes were transferred to growth chamber set at a 16h/8h light light/dark cycle, 20±2
o
C temperature at 72% relative humidity while the pots were transferred to the
greenhouse at 20±1 oC during the 16 h day period and 18±1 oC during the night period
at 72% relative humidity and with supplementary light when necessary, or to the
growth chamber with the conditions as described above.
Screening for T-DNA insertion mutants
The T-DNA insertion disrupting AtClCb and AtClCd were identified in the
database at the SALK Institute Genome Analysis Laboratory (Salk-027349 for
AtClCb ,Salk-042895 for AtClCd) and Wiscd Siox 477-480i4 was identified in the
WiscDsLox T-DNA collection for AtClCa. To obtain homozygous mutants lines,
resistance to kanamycin was checked and PCR-based screens with the respective
primers for each T-DNA were performed according to Salk and Wisc protocols (Table
1).
To generate double mutants, single mutant plants were crossed to each other. The
genotypes of F1 plants were checked using a PCR-based screen with respective
primers for each gene (Table 1). All F1 double mutants (Atclcab, Atclcad, and
Atclcbd) were allowed to self-pollinate. Seeds were sown on plates. Plants were
subsequently checked again with the primer sets of the respective T-DNAs (Table 1)
and segregated in the F2 population progeny in a 1:15 ratio. A triple mutant was
29
Chapter 2
created by crossing between two double mutants Atclcad and Atclcbd. F1 progeny
from this cross were allowed to self-pollinate. Seeds were sown and the progeny was
checked and analyzed for their genotypes (Figure 1).
Figure 1. The T-DNA insertion in the three single mutant parental lines Left: The position of
the T-DNA insertions in AtClCa, AtClCb and AtClCd genes. Right: PCR-based markers for
the presence and absence of the T-DNA insertions. Lane 1: Homozygous wild type genotype,
2: Heterozygous genotype 3: Homozygous T-DNA insertion genotype. Indicated on the left
are the sizes of the MW markers in the marker lane and on the right the gene studied is
indicated.
Reverse Transcript PCR
Total RNA from shoots and roots was isolated according to Chomczynski
et al. (1997) using TRIZOL reagent (Invitrogen). First-strand cDNA synthesis
on 3μg of total RNA was done using reverse transcriptase (Fermentas) and a
Oligo(dT) primer according to the suppliers manual. Two microliters from the total 20
μl volume of cDNA was used for PCR amplification using polymerase in a 50 μL
reaction volume according to the following program: 94°C for 2 min, then 32 (AtClCa
and AtClCd) or 35 (AtClCb) cycles consisting of 94°C for 15 s; 54°C for 30 s (AtClCa
and AtClCd), 45°C for 30 s (AtClCb) ;72°C for 1 min and 72°C for 5 min . Table 1
shows the RNA-specific primers for the ClC genes and the control gene, tubelin.
Ion flux measurement in MIFE technique
Net fluxes of H+ and Cl- from leaves were measured using H+- and Cl--selective
microelectrodes with the MIFE technique (Shabala et al., 1997; Newman, 2001;
30
Left primer
5’-CCTACCATGATGTGACCTCCTC
5’-GGAACTGGATTAGCTGCTGTG
AtClCd
5'-AGGCTTGTAGAATGTTGTAT
5’-TTGACTGTTGGAGTTCCACT
5'- ACACCAGACATAGAGCAGAAATCAAG
5'-ACTGCATCTTGGGGCTTT
5’-TTTACACATTAGCTGTAG
5’-GAGCCTTACAACGCTACTCTGTCTGTC
AtClCb
AtClCd
β-Tubelin
Table 1: . The PCR Primers for T-DNA confirmation and gene expression analysis, used in this study.
5'- GAAATGCTTGTAGAATGTTA
5'-ACTGCATTTTGGGTCTTA
AtClCa
31
5’-TGGTTCACGTAGTGGGCCATCG
5’-GTAATCGGTGGAATTCTTGGG
5’-GGAGTTCTGTAGCCCCAGTTG
AtClCb
Gene expression analysis
5’-TGGTTCACGTAGTGGGCCATCG
5’-TGTCAATGCCATTAAGGTAAGC
5’-GCGTGGACCGCTTGCTGCAACT
Left Border primer
5’-CCAGATAAATCTTCACTTTCTGATGG
Right primer
AtClCa
T-DNA insertion
Target
Generation and characterization of anion channel mutants
Chapter 2
Lanfermeijer et al., 2008). Microelectrodes were pulled from borosilicate glass capillaries
(GC150-10; Harvard Apparatus) and silanized with tributylchlorosilane (Fluka 90974). The
H+- selective electrodes were back filled with 15 mM of NaCl plus 40 mM of KH2PO4 and
front filled with Hydrogen Ionophore II (Cocktail A; Fluka 95297). The Cl--selective
electrodes were back filled with 500 mM of KCl adjusted to pH 6 with NaOH and front
filled with Cl− (chloride ionophore I, cocktail A, Fluka 24902). The response of the
electrode was typically 48 mV/decade. This somewhat low response voltage was always
observed and is considered to be the result of a small leakage of ions in the tip of the
electrode. Apparently, the sealing between the silanized glass and the ionophore mix was
not optimal. To avoid potassium ion leakage from the reference electrode, the reference
electrode was placed in a compartment different from the measuring chamber. The two
compartments were electrically connected via a salt bridge, which consisted of 300 mM
(NH4)2SO4 in 2% (w/v) agar.
Leaf material was immobilized on a glass capillary using grease (consisting of 49%
petroleum jelly, 34% bee wax, and 17% lanoline) with the abaxial epidermisless side
exposed to the solution and placed in a measuring chamber with a transparent bottom. The
chamber was filled with 1 ml of basic measuring solution (BMS; 1 mM KCl plus 0.5 mM
CaCl2, pH 5.8), submerging the leaf material. The whole chamber was placed on a Nikon
TMS inverted microscope. The ion-selective microelectrodes were mounted at an angle
between 30° and 40° with the horizontal in a holder (MMT-5; Narishige) on a three-way
piezo-controlled micromanipulator (PCT; Luigs and Neumann) driven by a computercontrolled motor (MO61-CE08; Superior Electric). The electrodes were positioned 10 μm
from the surface of the tissue. During measurements, the distances between the tissue and
the electrodes were changed from 10 to 50 μm at a frequency of 0.1 Hz. The chemical
activities of H+ and Cl- in solution were continuously recorded at the two distances from the
tissue, and from these data, net H+ and Cl- fluxes were calculated according to Newman
(2001). Whereas positioning the material in the MIFE apparatus was performed under light
conditions (150 μmol·m-2·s-1), the measurements were performed in the dark at ambient
room temperature.
32
Generation and characterization of anion channel mutants
RESULTS
Isolation of homozygous knockout lines with PCR-based screen
The obtained three single homozygous T-DNA insertion lines in Arabidopsis
ecotype Columbia in AtClCa, AtClCd and AtClCb were used to generate the three
double and the one triple mutant combinations. The exact locations of the T-DNA
insertions in the loci At5g40890, At3g27170 and At5g26240 were obtained from the
TAIR database (http://www.Arabidopsis.org) (Figure 1a). The correct genetic
conformation of the three parental single mutant lines was confirmed by PCR (Figure
1b).
Tissue specific expression of the AtClCa, b, and d genes
Transcripts of AtClCa, and d could be detected in both the shoot and the root.
Transcripts of AtClCb could only be detected in the root (Figure 2).
In the T-DNA insertion lines only transcripts of the ClC genes, which were not
disrupted, could be detected (Figure 3).
Figure 2. Semi-quantative expression of AtClCa, AtClCb
and AtClCd in different plant tissues. Shown are the amounts
of PCR product resulting from 32 (AtClCa and AtClCd) or
35 (AtClCb) PCR cycles. The Tubulin transcript levels are
shown as a loading control. The used primers for the
respective genes are shown in Table 1.
Figure 3. The absence of expression of the AtClCa, AtClCb
and AtClCd genes in their respective T-DNA insertion lines.
The three genotypes were analysed using the primers shown
in table 1. The Tubulin transcript levels are shown as a
loading control.
33
Chapter 2
Ion fluxes
The MIFE technique allows monitoring of ion fluxes in and out of almost intact
tissues. We explored the potential of this technique to study NaCl induced changes in
ion fluxes in leaf tissue. We focused on H+ and Cl- fluxes because the potential role of
the so-called ClC proteins in Cl- fluxes and the potential linkage between this flux and
the H+ flux (Figure 4). Essential in this figure is the meaning of the graphs. By
convention a positive flux means an influx of the ions, both in the case of cations and
anions (Newman 2001). To relate this to the currents measured in electrophysiology
an influx of cations causes an inward current and a depolarization while an influx of
anions causes an outward current and a hyperpolarization.
Suddenly challenging the leaf tissue with 65/75 mM of NaCl caused the influx of
protons transiently to increase from around 25 μmol·m-2·s-1 to 150 μmol·m-2·s-1. After
20 minutes the proton influx returned to its pre-salinity values and started slowly to
change into a small efflux. Chloride fluxes were zero before NaCl was added but as
soon as 65 mM of Cl- was added this changed to an influx of chloride. However, no
differences in the response to the sudden application of NaCl of the mutants mutually
and wild type could be observed.
Figure 4. Typical changes in
proton and chloride fluxes from
wildtype Arabidopsis thaliana
(upper panel) and the Atclca
genotype (lower panel) leaf tissue
induced by 65 mM of NaCl. The
vertical line indicates the moment
of the addition of 65 mM of
NaCl. When the flux becomes
more positive, this means either
an increase of the influx or a
reduction of the efflux. Typical
experiments of at least three
experiments are shown.
34
Generation and characterization of anion channel mutants
Phenotypical characterization of mutant plants
For none of the mutant lines a difference in their growth and development could
be observed when they were grown on soil (data not shown). The effects on
germination were studied on MS/2 agar media supplemented with different
concentrations (0-300 mM) of NaCl, KCl, KNO3 and cholinchloride (Figure 5). No
differences were observed between the six mutant lines mutually and in comparison
with wild type. However, germination was affected by the presence of different salt
species. Germination was the least inhibited by KCl. A 50% reduction of germination
was obtained at KCl concentrations above 275 mM. For both choline chloride and
NaCl the concentration at which 50% reduction of germination was obtained was
around 250 mM. The largest reduction in germination was observed when seeds were
allowed to germinate on KNO3, in this case 50% germination was already obtained at
200 mM.
In order to study the effect on growth and development plants were allowed to
germinate and grow on vertical plates under a large number of different physiological
conditions, like different salts, different concentrations of these salts and different pHvalues. Whereas, no differences could be observed when plants were grown under
standard conditions and the various salt conditions (data not shown), a difference in
the growth of some plant lines could be observed when the plants were grown on
MS/2 media with a higher pH: pH 6.2 instead of 5.8 (Figure 6). The single mutants
Atclca and Atclcd had a significantly reduced primary root length compared with the
wild type and the Atclcb mutant (Figure 6). Combining the mutations showed that
when AtClCb was also absent the effects of the absence of AtClCa and AtClCd were
reduced. The double mutant Atclcad showed no additive effect of the presence of both
disrupted genes. However, the triple mutant Atclcabd showed the largest reduction in
root elongation (Figure 6).
35
Chapter 2
Figure 5a. Germination of Arabidopsis seeds of the 8 genotypes on a half strenght MS
medium, supplemented with the indicated salts. Upper panel: Concentration dependent
inhibiton of germination. Lines are only drawn through the two outermost datasets.
Datapoints are the average of 3 experiments and the error bars indicate the standard deviation.
Lower pannel: Germination of the 8 genotypes at a single salt concentration. The data are
same data as shown Figure 5a but for clarity shown separately. Datapoints are the average of
3 experiments and the error bars indicate the standard error
36
Generation and characterization of anion channel mutants
Figure 6 Upper panel: Primary root growth of the indicated Arabidopsis genotypes on a
half strenght MS medium at two different pH values. Upper panel; pH 5.8; lower panel: pH
6.2. Length of the reference is 2.5 cm. Lower pannel: Length of the primary root of the
indicated Arabidopsis genotypes on a half strenght MS medium at two different pH values.
Datapoints are the average of 4 experiments and the error bars indicate the standard deviation.
wt indicates wild type; a till adb indicate genotypes Atclca till Atlcabd.
37
Chapter 2
DISCUSSION
ClC proteins are an enigmatic group of proteins in plants. This family was named
based on the annotation of the first protein of this family, which was isolated from
Torpedo marmorata electric organ and characterized as being a chloride channel
(Jentsch et al., 1990). However, it has become oblivious that the function of these
proteins is not as clear cut as the name suggests. Reports have shown that these
proteins can function as channels but also can function as co-transporters and not only
as transporters of chloride but also of nitrate-ions (Bergsdorf et al., 2009).
The MIFE technique has shown to be very useful in assessing fluxes from and out
of almost intact tissues and the effect of various manipulations, which range from
elicitors and hormones to light and solutes (Lanfermeijer et al., 2008; Vreeburg et al.,
2005; Zepeda-Jazo et al., 2008). This technique is the link between electrophysiology
and whole plant physiology. We presently explored the potential of this technique to
study the physiological relevance of the Cl- fluxes in plants. Using a double barreled
configuration we assessed the changes of the H+ and Cl- fluxes when plants were
suddenly exposed to a concentration of 65/75 mM of NaCl. The addition of such a
concentration has two effects. Firstly, the external concentrations of Na+ and Clchange drastically and secondly the external water potential drops. As a result of the
latter water will move osmotically out of the cells resulting in a decrease of the turgor
pressure in the cell. Turgor pressure has been shown to control ion-fluxes, either via
mechano-sensitive channels (Chang et al., 1998) or via the plasma membrane H+ATPase (Sabala and Lew, 2002). We observed a transient increase in the proton efflux
upon NaCl exposure followed by a slow change into a small proton efflux. The time
course of this phenomenon can be compared with the observations of Shabala et al.
(2005) and Cuin et al. (2008), although those were made on roots. Their membrane
potential measurements show a transient depolarization and a partial recovery of the
membrane potential 10 to 15 minutes after the addition of salt. Our observed transient
influx of protons fits well with the transient depolarization and while the partial
recovery could be due to the emerging efflux of protons. However, Shabala et al.
(2005) did not observe this transient efflux of protons, they only observed the
decreasing influx. The increase of chloride influx is caused first of all by the
concentration gradient which favors an influx and, secondly, by the depolarization of
the membrane potential. Our observations are in accordance with those of Shabala et
al. (2005), who observed an increase of the chloride flux from 40 to 100 nmol·m-2·s-1
38
Generation and characterization of anion channel mutants
upon the exposing the barley leaf tissue to 20 mM of NaCl. The slow decrease of the
chloride flux could be ascribed to either the slow recovery of the membrane potential
or to the equilibration of the Cl- ions across the membrane (Figure 4).
We could not observe a difference between the response of the wild type and the
mutants in the MIFE system. Single mutants reacted in an identical manner to a
sudden exposure to 65 Mm NaCl (data not show), which implies that disruption of the
three ClC-proteins studied does not affect the observed fluxes.
Also no effects of the disruption of the ClC genes alone or in combination with the
others could be observed on germination. The effects of the different salt species
show that KCl is the preferred salt for germination. This salt probably is accumulated
rapidly and without any problems and increases the ability of the seedling to take up
water and grow. Sodium can not replace potassium in these experiments due its
toxicity and nitrate can not replace the chloride. Nitrate is probably partly assimilated
and turned into amino acids and proteins, while maybe at higher nitrate concentrations
the nitrate is not fully assimilates and becomes nitrite. Nitrite is toxic and will inhibit
growth. Hence, equivalent amounts of chloride and nitrate can not exert the same
effect on the water potential in growing cells.
Also other experiments failed to show differences between any of the mutants and
the wild type suggesting either delicate roles of the chloride channels, which could not
be observed by our crude observation methods. Moreover, it shows that the role of the
ClC proteins is not that obviously related with chloride and for instance salt and
salinity stress.
The experiments on root growth show an involvement of the ClC proteins with
growth. Two explanations can be given. Firstly, the AtClCa and AtClCd proteins are
involved in establishment of the proton-motive force (PMF). Root and cell growth, in
general, is driven by pH gradient across the cell. The proton motive force resulting
from this gradient across the membrane drives the uptake of solutes necessary from
generation of a low water potential, which subsequently is needed for the osmotically
driven uptake of water and the generation of turgor pressure. When taking the external
pH into account it is more difficult to establish the same PMF at the higher pH. This is
because at higher pH more protons are needed to achieve the same pH gradient. And
more protons transported across the membrane result in a larger membrane potential.
Hence, at higher external pH values it is advantageous to compensate for the positive
charge moved across the membrane when a proton is extruded in order to limit the
39
Chapter 2
polarization of the membrane. Polarization of the membrane impedes the transport of
the positively charged proton. Next to the coordinated influx of potassium ions the
coordinated efflux of chloride-ions can be used for this charge compensation. In this
model removing AtClCa and At ClCd hampers this process, reduces the generation of
the PMF and subsequently inhibits root growth.
Secondly, the AtClCa and AtClCd proteins are required for the accumulation of
the osmotically active anions, Cl- and NO3-, which is needed for cell expansion.
Absence of the transporters limits the uptake of these osmolytes and, thus, reduces
growth.
Recently a study appeared also describing a similar effect of the disruption of the
Atclcd mutation of root growth in relation with pH of the external medium (FechtBartenbach et al., 2007). They also suggested a role of the AtClCd protein in charge
compensation in relation with the establishment of a pH-gradient across the
membrane of a Golgi-derived transport vesicle. However, the AtClCd protein has all
characteristics of being an H+/2A- antiporter and this is difficult to match with a shunt
function of this system. Also AtClCa and AtClCb show characteristics which suggest
that these proteins are also H+/2A- antiporters, however, these proteins are considered
to be localized in the tonoplast membrane (Lv et al., 2009). The root-specific
expression of the three ClC proteins is highly similar, with expression mostly
restricted to maturation zone, and primarily in the vascular tissues (Lv et al., 2009)
although AtClCd seems to have considerable expression in the division zone as well.
In the study of Lv et al. (2009) the expression levels of AtClCa and AtClCd were
comparable, while AtClCb had a lower expression level. Although AtClCa and
AtClCd are localized in two different membranes their effect on root growth could be
similar. Cell growth needs an increase in volume but also an increase in surface or in
other words of plasma membrane area. The increase of volume requires the generation
of a PMF or the uptake of osmotically active solutes. If this is disturbed by disruption
of tonoplast-located AtClCa cells will not grow. The increase of plasma membrane
surface is accomplished by the continuous delivery of plasma membrane material
(lipids and proteins) by golgi-derived vesicles. The trafficking of these vesicles is
controlled by their internal pH. Hence, if the establishment of this pH is interrupted by
for instance the removal of AtClCd the plasma membrane can not increase its surface
area, hence, cells and, thus, roots stop growing.
40
Generation and characterization of anion channel mutants
Our results point to a role of ClC proteins closely related to energizing of the
membrane. Apparantly ClC proteins are important electrical circuits in the membrane
allowing the generation of steep ion gradients in combination with moderate
membrane potentials. As such, these proteins play an important role in the general
physiology of the cell. Further research will investigate the role and involvement of
ClC proteins in growth.
41
Chapter 2
ACKNOWLEDGEMENTS
I would like to thank Bert Venema for his help in the greenhouse.This work was
supported in part by a grant from the Ministry of Science, Research and Technology
of the Islamic Republic of Iran.
42
Chapter 3
NO3- and H+ fluxes in Atclcd mutants of Arabidopsis thaliana
Hossein Moradi1,2, Theo Elzenga1 and Frank Lanfermeijer1
1
Department of Plant Physiology, University of Groningen, 9750 AA Haren, The Netherlands
2
Department of Agronomy and Plant breeding, Sari Agricultural Sciences and Natural Resources
University, Iran
43
Chapter 3
ABSTRACT
In the Arabidopsis genome seven ClC genes have been identified, including
AtClCa and AtClCd that are involved in nitrate accumulation in the vacuole and
cell expansion, respectively. The effect of NO3- on H+ and Cl- fluxes from leaf
tissue of Arabidopsis was determined for wildtype and and AtClCd T-DNA
insertion mutants. When leaf tissue of wildtype plants is exposed to increased
levels of nitrate in the external medium the influx of protons and chloride ions is
decreased. These effects are absent of much smaller in the AtClCd mutant plants
These results are consistent with a function of the AtClCd protein as H+/anion
antiporter.
44
NO3- and H+ fluxes in Atclcd mutants
INTRODUCTION
The protein family of chloride channels and anion transporters (ClC) is widely
distributed in prokaryotes and eukaryotes. They play important roles in cell signaling,
osmo-regulation, nutrient uptake and distribution, and metabolism. In higher plants
the first anion transporter proteins were described in tobacco and their identity was
inferred from homology with the ClC family of voltage-gated chloride channels in
animals (Lurin et al., 1996). Since then the function of only a few of these proteins in
plants has been established. In the Arabidopsis genome seven ClC genes can be
identified (AtClCa-g), and all of them have been isolated (Hechanberger et al., 1996;
Geelen et al., 2000; Lv et al., 2009). The intracellular localization of the respective
proteins was deduced from expression studies with green fluorescent protein (GFP)
fusion proteins (Hechenberger et al., 1996; Lv et al., 2009), but direct evidence for
their transport activity in plant cells is still lacking. GFP fusion protein studies point to
a subcellular localization of AtClCa, -b, -c and -g in the tonoplast, AtClCd and
AtClCf in the Golgi membrane and AtClCe in the thylakoid membrane (De Angeli et
al., 2007; Marmagne et al., 2007; Lv et al., 2009). However, most of these studies
used the 35S promotor, resulting in very high expression levels, possibly resulting in
a-typical localization of the fluorescent protein (see Chapter 1). Lv et al. (2009) found
that the highest expression of AtClCa and AtClCd is in the leaf and the root.
As uptake of Cl- is normally against its electrochemical gradient, which requires an
active mechanism, for instance, through a symporter with H+ as the second ion (the
suggested mechanism in plants (Felle, 1994)). Several mammalian ClCs have been
recognized to function as chloride/proton exchangers (Picollo and Pusch 2005; Scheel
et al., 2005).
In plants the function and mechanism of the different ClCs is still under debate. A
common characteristic of chloride channels is that they are also permeable for nitrate
(Pusch et al., 1995), a feature that in animals is of limited physiological importance.
In contrast, the nitrate transporter function of ClCs in plants could be the most
important one. In Arabidopsis thaliana AtClCa even appears to be much more
selective for NO3-, I- and Br- than for Cl- (De Angeli et al., 2006). As the
concentrations of cytosolic NO3- and Cl- in plant cells are approximately 4 and 10
mM, respectively (Felle, 1994; Miller and Smith, 1996; Lorenzen et al., 2004), plant
membrane potentials range from -150 to -220 mV (negative inside), and in most soils
the concentration of NO3- and Cl- is typically in the low millimolar to micromolar
45
Chapter 3
range (Marschner, 2002), the uptake of nitrate (and of chloride) is only possible by a
co-transporter system. Nitrate uptake in roots of Arabidopsis is mediated by the wellcharacterized transporter proteins NTR1 and NTR2. The absorbed nitrate can either
be reduced by nitrate reductase, a cytosolic enzyme, or be transported to the shoot. In
contrast to the transporters that mediate the uptake into the root, the transporter
proteins that are involved in nitrate distribution in various tissues and in the nitrate
accumulation in the vacuole are less well studied. Mutant characterization studies
indicate that AtClCa (Geelen et al., 2000; De Angeli et al., 2006) and AtClCc (Harada
et al., 2004) are involved in the regulation of nitrate levels in Arabidopsis. FechtBartenbach et al. (2007) showed that AtClCd and V-ATPase support growth in
expanding cells and they suggest a more complex connections between ClC proteins
and the proton gradient. Disruption of AtClCd results in hypersensitivity to
concanamycin A, a specific inhibitor of V-type ATPase (Dettmer et al., 2006). De
Angeli et al., (2006) reported that AtClCa functions as a 2 NO3-/1 H+ antiporter that is
able to accumulate nitrate in vacuole. Lv et al., (2009), based on sequence comparison
with ClCs characterized in other species, postulated that AtClCd, which belongs to the
same subclass as AtClCa, may function as an anion/proton antiporter.
In the present study, the effect of nitrate in the experimental solution on Cl-, H+
and NO3- fluxes in leaf tissue of wildtype and Atclcd mutants was monitored with the
MIFE technique. The aim was to test the hypothesis that anion transporters located in
the tonoplast are essential in cytoplasmic pH homeostasis. Exposure to different
anions should not only lead to modifications in the fluxes of other anions, but also to
changes in the proton fluxes across the plasma membrane.
46
NO3- and H+ fluxes in Atclcd mutants
MATERIALS AND METHODS
Plant material and growth conditions
Arabidopsis thaliana (wild type ecotype Columbia and the AtClCd T-DNA
insertional mutant) seeds were obtained from the Salk collection
(http://signal.Salk.edu/tdna_ protocols.html). For the AtClCd insertional mutant line
the SALK line 42895 was selected. Seeds were surface sterilized with gaseous
chlorine, sown in pots containing an organic-rich soil (TULIP PROFI No.4; BOGRO
B.V. Hardenberg, The Netherlands) and kept in the dark at 4oC for 3 days. The pots
were then transferred to a growth chamber with a 16h/8h light/dark cycle and a
temperature of 20±2oC for 20 days.
Selection and isolation of the T-DNA insertion mutant of Atclcd
The T-DNA insertion disrupting the AtClCd gene was identified in the database at
the SALK Institute Genome Analysis Laboratory. Homozygous mutants lines were
identified by screening for resistance to kanamycin and by a PCR-based screen with
selected primers for the gene and left border primer according to Salk protocol (see
Chapter 2). The plant line with the insertion in this gene is referred to as Atclcd.
Reverse Transcript PCR analysis
Total RNA was extracted from shoots and purified using the Qiagen RNeasy plant
mini kit according to the manufacturer’s protocol. RNA was measured by nano drop
machine and then first strand cDNAs was synthesized from total RNA (2μg) isolated
using reverse transcriptase (Fermentas, USA) and oligo (dT) primer. Tubulin primers
were included, for presence of equal amount of cDNA. For amplification, PCR was
performed at an annealing temperature of 55oC, using 32 cycles.
MIFE measurements
Net fluxes of Cl-, NO3- and H+ were measured non-invasively using the MIFE
(Micro Electrode Flux Estimation) technique essentially as described in Shabala et al.,
(1997), Newman (2001) and Lanfermeijer et al. (2008). Briefly, microelectrodes were
pulled and then dried in an oven at 200oC overnight. To improve the stability of the
liquid ion exchange cocktails (LIX) the electrodes were coated with a hydrophobic
material (tributylchlorosilane 90796; Sigma-Aldrich, Milwaukee) for 10 min in the
47
Chapter 3
same oven under a steel cover. Then the cover was removed and the electrodes were
left to dry at 200oC for another 20 min.
The electrodes were back-filled with 0.5 M KCl in the case of Cl--specific
electrodes, 15 mM NaCl + 40 mM KH2PO4 in the case of H+-specific electrodes and
0.5 M KNO3 + 0.1 M KCl in the case of NO3--specific electrodes. All the back-fill
solutions were adjusted to pH 6 with NaOH. Immediately after back-filling, the
electrode tips were front-filled either with a commercially available LIX, ionophore
24902 for Cl- (Cl- -specific electrodes were used after an overnight ‘maturation’
period) and 95297 for H+ (Fluka; Busch, Switzerland) or with a LIX consisting of
0.5% methyltridodecylammonium nitrate (MTDDA), 0.084% methyl-triphenylphosphonium bromide (MTPPB) and 99.4% n-phenyloctyl ether (NPOE) for the NO3-specific electrodes (Table 1).
Specificitya Responseb
(mV/decade)
Ion-specific
Electrode
Electrode tip fill
Backfill
H+
Ionophore 95297
15 mM NaCl,
H+/Li+=108 51
40 mM KH2 PO4
Cl-
Ionophore 24902
0.5 M KCl
Cl-/I-=10
48
NO3-
0.5% MTDDA NO3-c,0.084%
MTPPBd and 99.4% NPOEe
0.5 M KNO3,
0.1 M KCl
Cl-/I-=8
56
Table 1: Composition of the ion-specific electrodes and their characteristics as used in the
MIFE.experiments. a: specificity ration with the ion which interferes the most with the studied
ion. b:The response value is the change in the measured potential when the pIon (e.g. pH, pCl or
pNO3) changes 1 unit.c: methyltridodecylammonium nitrate; d: methyl-triphenyl-phosphoni
bromide; e: n-phenyloctyl ether
The epidermis was removed from the abaxial side of the leaf. Leaf material was
immobilized on a glass capillary using grease with the abaxial side exposed to the
solution and was placed in a measuring chamber with a transparent bottom. The
chamber was filled with 1 ml of the basic measuring solution (1 mM KCl, 0.5 mM
CaCl2, pH 5.8 for H+ and Cl- measurements or 0.1 mM NH4NO3, 0.2 mM CaSO4, pH
5.8 for NO3- measurements), submerging the leaf material. The whole chamber was
placed on a Nikon TMS inverted microscope. The ion-selective microelectrodes were
mounted at an angle between 30o and 40o with the horizontal in a holder (MMT48
NO3- and H+ fluxes in Atclcd mutants
5Narishige) on a micromanipulator (PCT; Luigs and Neumann) that was driven by a
computer-controlled motor (MO61-CE08; superior Electric). All electrodes were
calibrated before and after use in a series of solutions with concentrations in the
expected range of the ions in the experimental solutions. The medium in the chamber
was continuously replaced using a flow-through system (with a flow rate of
approximately 3 ml/min). A system of taps allowed changes of the medium from
outside the Faraday cage, which enclosed the whole set-up. Net fluxes of Cl-, NO3and H+ were recorded in response to exposure of the leaf material to solutions of
different solute composition (Table 2).
Measurement
Conditions applied
NaCl
CholinCl
Mannitol
KNO3
KCl
H+ Fluxes
+
+
+
+
+
Cl- Fluxes
+
+
+
+
NO3- Fluxes
+
+
Table 2. Osmotic conditions tested on Arabidopsis wild type and mutant plants for
the indicated flux measurements. “+” indicated monitored
49
Chapter 3
RESULTS
Isolation of a homozygous knockout line and gene expression
We obtained one T-DNA insertion line in the Colombia ecotype background from
the Salk collection under number SALK-42895. The exact location of the T-DNA
insertion for the locus At5g26240 was obtained from the TAIR database
(http://www.arabidopsis.org). As shown in figure 1, the T-DNA insertion in Salk42895 was located in the fourth intron of the gene. The location of the T-DNA in the
gene was confirmed by PCR according to the protocol of the SALK consortium. To
study AtClCd gene expression, RT-PCR was performed using gene specific primers.
Figure 1 shows the expression of AtClCd, using tubulin as an internal standard. The
RT-PCR products confirmed that high expression levels of AtClCd are present in the
shoot. RT-PCR also confirmed that in homozygous mutant plants the full transcript of
AtClCd is absent (Figure 1). This suggests that the T-DNA insertion results in a null
allele. Our results confirm an earlier study that showed high expression levels of
AtClCd in root and shoot (Lv et al., 2009).
Figure 1. The T-DNA insertion in the AtClCd gene a: A schematic representation of the position of
the T-DNA insertion in AtClCd gene. b: Tubulin primer experiment showing presence of equal amount
of cDNA. c: The absence of expression in AtClCd gene in its T-DNA insertion lines. The wildtype and
the Atclcd genotype were analysed using the primers shown in table 1 of Chapter 1. The Tubulin
transcript levels are shown as a loading control.
KNO3–induced proton fluxes are different in wildtype and Atclcd mutant plants
Based on the similarity of AtClCa and AtClCd we hypothesize that AtClCd is also
located in the tonoplast, functions as a H+/NO3- antiporter and is involved in nitrate
accumulation in the vacuole. Based on these characteristics we predicted that
increasing the extracellular nitrate concentration would lead to distinct differences
between the Atclcd mutants and wildtype plants: 1. Since in the mutant excess nitrate
50
NO3- and H+ fluxes in Atclcd mutants
cannot be stored efficiently in the vacuole, the cytosolic pH will increase more in the
mutants compared to wildtype. In wildtype plants the cytosolic pH will be kept lower
due to the exchange of nitrate from the cytosol for protons from the vacuole.
Furthermore, the reduction of nitrate in the cytosol will consume one proton per NO3reduced to nitrite and several more when reduced further to ammonia. 2. The influx of
nitrate will affect the chloride influx in the mutants more than in wildtype plants as
accumulation of nitrate in the cytoplasm will likely reduce further uptake of anions. 3.
The increase in the nitrate influx is expected to be transient in both genotypes, but will
be more pronounced in wildtype plants since the capacity to store nitrate is higher.
Addition of nitrate (400 µM and 6 mM KNO3) resulted in an immediate increase in
the influx of nitrate in the leaf tissue (Figure 2). The size of the transient increase of
the nitrate influx did not differ significantly between wild type and AtClCd mutant
plants.
Increasing the nitrate concentration in the external medium resulted in a reduction
of the proton influx in wildtype plants (Figure 3). In Atclcd mutant plants nitrate
increased the proton influx even further. When DCCD was added to the medium the
influx of protons was dramatically reduced, while in wildtype plants the influx
remained at the same low level.
Effect of external KNO3 on chloride flux
In order to check the effects of increasing the external concentration of nitrate on
chloride fluxes, we measured Cl- fluxes before and after nitrate treatment. AtClCa has
been shown to be selective for both NO3- and Cl-. Furthermore, NO3- generally
suppresses Cl- fluxes and accumulation (Bar et al., 1997; Kafkafi et al., 1982; Adler
and Wilcox, 1995) and decreases the Cl- influx, in particular the flux into the vacuole
(Britto et al., 2004). As shown in figure 4 250 μM KNO3 indeed decreased the
chloride influx and induced an efflux. In contrast, in Atclcd mutant plants, addition of
KNO3 only has a transient effect on chloride flux and concentration, as after
approximately 1.5 minute the flux returns to pre-addition values.
51
Chapter 3
Figure 2. Typical changes in nitrate fluxes from wildtype Arabidopsis thaliana (panels A
and B) and the Atclcd genotype (panels C and D) leaf tissue induced by 6 mM (panels A and
C) or 400 μM of KNO3 (panels B and D). The vertical line indicates the moment when the
basal salt medium was slowly replaced by BSM with the supplement. When the flux becomes
more positive, this means either an increase of the influx or a reduction of the efflux. Typical
experiments of at least three experiments are shown.
Figure 3. The effect of DCCD on nitrate induced proton fluxes from wildtype Arabidopsis
thaliana and the Atclcd genotype leaf . The vertical lines indicate the moments when the
medium was slowly replaced by the next medium as indicated. The concentations used were
50 mM KNO3 and 20 µM DCCD. Typical experiments of at least three experiments are
shown.
52
NO3- and H+ fluxes in Atclcd mutants
DISCUSSION
Relation between NO3- and H+ fluxes in Atclcd mutant plants
The physiological characterization of Arabidopsis mutants suggested the
involvement of AtClCa (Geelen et al., 2000; De Angeli et al., 2006) and AtClCc
(Harada et al., 2004) in the regulation of nitrate levels in plants. The bacterial ClC-ec1
protein (Accardi and Miller, 2004) and the human ClC4 and ClC5 proteins (Picollo
and Push, 2005; Scheel et al., 2005) that are located in the membranes of intracellular
vesicles, have been shown to function as proton/chloride exchangers, rather than
passive chloride channels. In plant cells AtClCa functions as a 2 NO3-/1 H+ antiporter
facilitating the accumulation of nitrate in the vacuole (De Angeli et al., 2006), with a
selectivity sequence of NO3- = I- > Cl-. AtClCd has been shown to co-localize in the
trans-Golgi network with VHA-a1, a subunit of the proton transporting V-Type
ATPase (Fecht-Bartenbach et al., 2007).
In plant cells, the plasma membrane H+-pumping ATPase is the primary active
transport system and responsible for generating the membrane potential (Assman and
Haubrick, 1996). Transport of a cation in the opposite direction or an anion in the
same direction is required prevent extreme hyper-polarization of the membrane and
allow the build up a steep proton gradient. Therefore different factors like activation
of anion channels or changes in pH of the medium may lead to changes the membrane
potential and the cytosolic pH. Also plasma membrane anion channels play a central
role in the regulation of the cytosolic pH of plant cells (Johannes et al., 1998). The
results of our experiments show that application of KNO3 leads to an H+ efflux (seen
as a reduction of the influx). This efflux is, as is evident from its sensitivity to the
ATPase inhibitor DCCD, carried by the plasma membrane H+-ATPase. This NO3-induced H+ efflux confirms reports by Garnet et al. (2003) on eucalypt and Segonzac
et al. (2007) on Arabidopsis. In mutant plants the addition of KNO3 has much less of
an impact on the H+ fluxes, demonstrating that the presence of an H+/anion antiporter
is essential for the nitrate-induced effects on the plasma membrane proton pump.
Interactions between uptake of Cl- and NO3- ions in Atclcd mutant plants
Under natural condition, the presence of nitrate in the soil can reduce the toxic
effect of excess Cl- (Bar et al.,1997). Nitrate can reduce the influx Cl- in plant cells
53
Chapter 3
and Cl- accumulation in plant tissue (Glass and Siddiqi, 1985; Adler and Wilcox,
1995). In our experiments the addition of NO3- led to an increase in the Cl- efflux
(decreased Cl- influx) and to a higher external Cl- concentration when wildtype plants
were studied. In the Atclcd mutant plants addition of nitrate resulted in a short,
transient change in the chloride flux, but not in a sustained efflux (Figure 4). These
results are consistent with a function for AtClCd as an H+/anion antiporter that can
transport both nitrate and chloride across the tonoplast.
Figure 4. Typical changes in
chloride fluxes from wildtype
Arabidopsis thaliana and the
Atclcd genotype leaf tissue
induced by 250 μM KNO3. The
vertical line indicates the moment
when the basal salt medium was
slowly replaced by BSM with the
supplement. Typical experiments
of at least three experiments are
shown.
Although the selectivity of the bacterial and the Arabidopsis ClC transporters is
clearly different, (in Arabidopsis NO3-, I- and Br- > Cl- (De Angeli et al., 2006), in
bacteria Cl- > Br-, NO3- and SO4- (Accardi and Miller, 2004)), it is clear that in both
NO3- and Cl- could enter the cells via the ClC transporters. Furthermore, addition of
NO3- decreases the Cl- influx into the vacuole (Britto et al., 2004). These and our data
suggest that in plant cells the accumulation of chloride and nitrate in the vacuole is
based on competition for transporter activity and that the transporter that mediates this
transport might be the AtClCd protein.
54
NO3- and H+ fluxes in Atclcd mutants
ACKNOWLEDGEMENTS
We thank Marten Staal for excellent technical assistance with the MIFE
technique. This work was partially funded by a grant from the Ministry of Science,
Research and Technology of Islamic Republic of Iran.
55
56
Chapter 4
Anion Channels and Root Elongation in Arabidopsis thaliana
Hossein Moradi1,2, Theo Elzenga1 and Frank Lanfermeijer1
1
Department of Plant Biology, University of Groningen, 9750 AA Haren, The Netherlands
2
Department of Agronomy and Plant breeding, Sari Agricultural Sciences and Natural Resources
University, Iran
57
Chapter 4
ABSTRACT
Anion transporting proteins belonging to the chloride channel (ClC) family
are involved in anion homeostasis in a variety of organisms. Progress in the
understanding of their biological functions is limited by the small number of
genes identified so far. Seven chloride channel members could be identified in
the Arabidopsis genome, amongst which AtClCa, AtClCb, and AtClCd are more
closely related to each other than to the other plant ClCs in same subclass.
Chloride channels from Arabidopsis have been shown to participate in nitrate
accumulation and storage. In this study, the physiological role of AtClCa,
AtClCb and AtClCd proteins was investigated. Disruption of the AtClCa,
AtClCb and AtClCd gene by a T-DNA insertion did not yield a phenotype that
was different from wildtype under normal conditions, however, when the pH of
the medium was slightly less acidic (raised from 5.8 to 6.2) the length of the
primary root of plants with a disrupted AtClCa and AtClCd gene was reduced
compared to wildtype and the plant with a disrupted AtClCb gene.
The proton fluxes and pH were measured along the surface of the root at
different positions, from root cap, through the transition zone, and up to the fast
elongation zone, and at different pH’s of the medium. A high proton influx was
found in the apical part of the transition zone. Lower influxes or even small
effluxes were found at the basal part of the elongation zone. At pH 6.2 the influx
of protons in the apical part of the transition zone in the Atclca and Atclcd
mutants was significantly lower than in wildtype and the Atclcb mutant.
Measurement of the distance between root tip and first epidermal cell with
visible root hair bulge indicate that the mutants that are affected in the H+ flux,
the Atclca and Atclcd mutants, also have a reduced cell expansion. A model for
the interaction between endomembrane anion/H+ antiporters, plasma membrane
proton fluxes and cell expansion is discussed.
58
Anion channels and root elongation
INTRODUCTION
Root development is determined by cell division, differentiation and expansion.
Each of these processes is under the control of an intrinsic developmental program
and of external biotic and abiotic factors (Lynch, 1995). A wealth of information is
available on the cellular organization, the differentiation and genetic background of
developmental processes in the root of Arabidopsis, the model system of choice for
plants (Dolan et al. 1993; Schiefelbein et al., 1997; Scheres et al., 2002; Park et al.,
2008). Several groups have explored the mechanisms of cell expansion in the
elongation zone, the zone of maximal cell growth rate (Befey et al., 1993; Hauser et
al., 1995; Verbelen et al., 2001; Swarup et al., 2007; Cnodder et al., 2006). Cell
elongation in roots is sensitive to various endogenous and exogenous factors such as
pH (Rayle and Cleland, 1970), ethylene (Le et al., 2001), auxin (Fujita and Syono,
1996), calcium (Kiegle et al., 2000) and aluminium (Sivaguru et al., 2000). The
primary cell wall of plants consists of long cellulose microfibrils embedded in a crosslinked matrix of polysacharides, largely pectin and glycans (Carpita and Gibeaut,
1993), and a small quantity of structural proteins (Showalter, 1993). The acid growth
theory states that protons are the primary wall-loosening factor, causing the cleavage
of load-bearing bonds in the cell (Rayle and Cleland, 1970; Royle and Cleland, 1992).
Turgor will then cause a cell with a loosened cell wall to expand. In maize, the spatial
profile of growth along the roots has been shown to coincide with the spatial profile of
root-surface acidification (Fan and Neuman, 2004; Peters and Felle, 1999; Pilet et al.,
1983). A more recent version of the acid-growth theory states that a low apoplastic pH
(<5) activates expansins, cell wall-assiociated proteins that break the hydrogen bonds
between the cellulose chains and the cross-linking glycans (Mc Queen-Mason et al.,
1992; Cosgrove, 2000). The apoplastic pH is determined by the H+-efflux through the
plasma membrane H+-ATPase and the H+-influx through the H+-coupled anion
symporters (Taner and Caspari, 1996). Anion fluxes through anion channels may
contribute to the maintenance and regulation of proton gradients across the different
membrane compartments in plant cell. Based on transport studies and structurefunction relationships the AtClCa and AtClCd proteins are very likely to function as
anion/proton antiporters (De Angeli et al., 2007; Lv et al., 2009). In combination
AtClCd and V-ATPase can support expansion growth of cells. This last result
suggests more complex connections between ClC proteins and proton gradients
(Angeli et al., 2006; Jennifer et al., 2007 and Scheel et al., 2005). As shown by GUS
59
Chapter 4
staining, the elongation and maturation zone of the root show high expression levels
of AtClCa and AtClCd (Lv et al., 2009). Although there are enough indications that
ClC proteins are essential in cell expansion in certain tissues and cell types, the
functional relation between AtClC proteins and proton gradient development in
expanding root cells is still unclear. In this study, we tried to elucidate the relationship
between ClC transporter proteins and the proton flux in root cell elongation, by
quantifying the fluxes along the root in wildtype and the Atclca, Atclcb and Atclcd
mutants at different external pH’s.
60
Anion channels and root elongation
MATERIALS AND METHODS
Plant materials and culture conditions
The seeds of Arabidopsis thaliana (ecotype Columbia) were obtained from the
SALK collection (AtClCb: SALK27349; AtClCd: SALK42895) and from the
WiscDsLox T-DNA collection (AtClCa: WiscDsLox477-480I4). Seeds were surface
sterilized with gaseous chlorine and sown in 90 mm petridishes containing with halfstrength Murashige and Skoog media (Duchefa, Haarlem, The Netherlands) with
0.8% w/v micro agar (Duchefa, Haarlem, The Netherlands). The dishes were sealed
with surgical tape and incubated in the dark at 4 0C for 3 days. Subsequently they
were transferred to a growth chamber (set at a 16h/8h light/dark cycle, 20 ± 20C
temperature at 72% relative humidity) and placed on edge, 5 degrees off the vertical,
such that the roots were growing down along the surface of the agar without
penetrating it. About 4-6 days and 14 days old plants were used for MIFE and primary
root measurement, respectively.
Ion flux experiments
Net fluxes of protons were measured non-invasively using vibrating H+-selective
microelectrodes with the MIFE (microelectrode ion flux estimation) technique
(Shabala et al., 1997 ; Newman, 2001; Vreeburg et al., 2005; Lanfermeijer et al.,
2008). Micropipettes (diameter 50 μm) were pulled from borosilicate glass. The
electrodes were silanized with tributylchlorosilane (Fluka 90974) and subsequently
back-filled with 15 mM NaCl and 40 mM KH2PO4 and front filled with Hydrogen
Ionophore II, Cocktail A (Fluka 95297). Only the electrodes with a response between
50 and 59 mV per pH unit and with a correlation coefficient between 0.999 and 1.000
(pH rang 5.1-7.8) were used. The electrodes were calibrated before and after use.
Roots of five days old Arabidopsis seedlings were mounted on glass capillary tubes
with medical adhesive and placed in a measuring chamber with a transparent bottom,
which was filled with BMS solution (1 mM KCl, 0.5 mM CaCl2, pH 5.8 for H+ and
Cl- measurements). The whole chamber was placed on the stage of a Nikon TMS
inverted microscope.
The H+-microelectrode was mounted at an angle between 300 and 400 with the
horizontal in a holder (MMT-5; Narishige) on a micromanipulator (PCT; Luigs and
Neuman) driven by a computer-controlled motor (MO61-CE08). The electrode was
61
Chapter 4
positioned manually at a distance of 10 μm from the root. During the subsequent
measurement, the distance between the electrode and the surface of the root was
switched between 10 μm and 50 μm at a frequency of 0.1 Hz. The chemical activity of
H+ in solution at these two positions was recorded and from these data the H+-flux and
the pH could be calculated.
The absolute pH value could differ (± 0.1-1 pH units) between different MIFE
experiments, but the overall pattern of the pH along the root stayed the same. The first
measuring point was positioned at a root tip and the subsequent sampling points along
the root were 75 μm apart. At each measuring point the ion flux was recorded for 2 min.
The last sampling point was chosen at the beginning of the root hair zone.
Screening for T-DNA insertion mutants
Homozygous mutants lines were identified by resistance to kanamycin and by a
PCR-based screen with the left border primer (LB) according to the Salk protocol and
the respective primers (has been described in chapter 2)
Expression analysis in roots
Total RNA were isolated from roots using a Nucleospin RNA plant kit
(Macherey-Nagel). RNA was measured by the nanodrop machine. Total RNA (3μg)
were used as template for first-strand cDNA synthesis using 200U of RevertAid HMinus M-MuLV reverse transcriptase (Fermentas, www.fermentas.com) and an
Oligo (dT) primer. As a control for equal amounts of cDNA tubulin primers were
included (Figure 1). PCR was performed at an annealing temperature of 55 oC and 32
cycles were used for AtClCa and AtClCd and 35 cycles were used for for AtClCb.
Primers are given in table1 chapter 2.
Figure 1. The absence of expression of the
AtClCa, AtClCb and AtClCd genes in their
respective T-DNA insertion lines. The four
genotypes were analysed using the primers
shown in table 1 of chapter 2. upper panel:
the Tubulin transcript levels of the four
genotypes are shown as a loading control.
MW: lane with the molecular marker, the
size of the essential bands is shown on the
left. lower panels: expression levels of the
AtClCa (left panel), AtClCb, (middle panel)
and AtClCd (right panel) in wildtype and the
respective T-DNA insertion lines.
62
Anion channels and root elongation
Cell imaging in primary root
Images were taken with a Nikon Coolpix 990 digital camera, which was mounted
on an inverted optical microscope (CX41, Olympus, Tokyo, Japan) equipped with
objectives of 20× and 40× magnification. After 7 and 14 days of growth on the
vertical-placed plate the distance between the root tip and the first epidermal cell with
visible root hair bulge (DFEH) and the root length were measured. At least 10
Arabidopsis wildtype and mutant plants were measured for every condition in each
experiment and each experiment was repeated 3 times.
63
Chapter 4
RESULTS
Isolation of homozygous knockout lines
From the seven members of the ClC transporter protein family in Arabidopsis
thaliana tree genes (AtClCa, b and d) that are phylogenetically more closely related to
each other than to any of the other members were selected. Plant ClC proteins are
grouped into two distinct subclasses with significant divergence (Lv et al., 2009). In
subclass 1 AtClCa andAtClCb are the most closely related, while AtClCd although in
another branch of the same subclass, is also rather similar. Of the other proteins in this
family, AtClCc and AtClCg, also belong to subclass 1, while AtClCe and atClCf,
belong to subclass 2 and are more distantly related. Homozygous T-DNA insertion
lines in the Columbia ecotype were selected from Salk and the WiscDsLox T-DNA
collections.
Reverse transcript PCR analysis of gene expression
As shown in figure 1, RT-PCR confirmed high expression levels of AtClCa,
AtClCb and AtClCd in root tissue of wild type plants. This result is in agreement with
an earlier study (Lv et al. 2009) with showed high expression in the root of AtClCa
and AtClCd and moderate expression of AtClCb. In the homozygous mutant plants
transcripts of the respective disrupted genes could not be detected (Figure 1).
Primary root growth of Atclca and Atclcd inhibition at high pH
Since anion transporters are involved in osmo-regulation and in cell expansion, we
measured the primary root length of wildtype and mutant plants growing on agar
plates and exposed to different external pH’s (5.8 till 6.8, buffered with 20 mM Mes).
All genotypes showed the longest root when grown on media with a pH of 5.8, while
no differences could be observed between the genotypes (Figure 2). When the pH of
the medium was raised root growth decreased (Figure 2), however, compared to the
wildtype, root growth in Atclca and Atclcd was more reduced. Atclcb was not
distinguishable from wildtype at all pH values. In all 8-days-old plants exposed to the
highest pH (6.8) the roots of the seedlings had hardly grown at all and the leaves were
yellowing.
64
Anion channels and root elongation
Reduced proton flux on the growth zones of root Atclca and Atclcd
To detemine if the clear difference in root length between wildtype plants and
Atclca and Atclcd mutants at less acidic pH’s, could be correlated to differences in cell
wall acidification, the proton fluxes at the surface of the roots of 8-days-old plants
were measured in wildtype and mutant plants in media with different pH’s. The pH
and H+ flux profile along the root was recorded at 75 μm intervals. The last sampling
point was
Figure 2. The effect of the pH of the growth medium on primary root length of wildtype
Arabidopsis and the three single mutant lines. a: Phenotypes of roots of the wildtype and the
three single mutants grown at different pH-values. The distance between two short lines on
the reference is 1 mm. b: Quantification of primary root length of wildtype and the three
single mutants grown at different pH-values. Datapoints are the average of 4 experiments and
the error bars indicate the standard deviation.
chosen at the onset of the root hair zone. At pH 5.8 the largest influxes were recorded
at a distance of 225 to 250 μm from the root tip, which is the border between the
meristematic zone (MZ) and the transition zone (TZ) (Figure 3). In the transition zone
the influx decreases steeply and remains relatively stable throughout the elongation
zone. At pH 5.8 no differences between wildtype and mutants can be observed
(Figures 3 and 4).
65
Chapter 4
At higher pH’s (in figures 3 and 4 the results for pH 6.2 are shown) the largest net H+
influx is shifted slightly basipetally to 300 μm from the root tip in wildtype and
Atclcb. However, more significant was the almost complete disappearance of the H+
influx in the Atclca and Atclcd mutants.
66
Anion channels and root elongation
Figure 3. The proton flux
profile along the roots of
wildtype and the three single
mutants. Upper panel: proton
fluxes measured at pH 5.8,
lower panel: proton fluxes
measured at pH 6.2. Indicated
are the three zones of the
growing roottip: the
meristematic zone (MZ), the
transition zone (TZ) and the
elongation zone (EZ).
Datapoints are the average of 4
experiments and the error bars
indicate the standard deviation
Difference DFEH between wildtype and Atclc mutant plants
The acid growth theory predicts cell wall loosening and rapid cell elongation at
low pH. In order to check the relation between different pH’s and cell elongation in
the primary root, we measured the distance between root tip and the first epidermal
cell with visible root hair bulge (DFEH). In 8-day-old plants grown at pH 5.8 DFEH
was 1355 ± 15 μm (Figures 4 and 5). At pH 6.2 DFEH was decrease in all plants, but
significantly more so in the Atclca and Atclcd mutants.
67
Chapter 4
DISCUSSION
Expansion of cells is only possible when the yield threshold of the cell wall is low
enough and the turgor, the pressure the cell exerts on the cell wall, high enough. For
both of these parameters a close interaction between transporter proteins is necessary.
The apoplastic pH of root cells will reflect the pH of the medium, but is also
determined by the H+-efflux mediated by the plasma membrane H+-ATPases and the
H+-influx through the H+-coupled anion symporters (Tanner and Caspari, 1996). The
plasmamembrane proton pumping ATPase activity is also one of the main regulators
of the cytoplasmic pH stat. An increase in cytoplasmic pH will necessarily result in
down-regulation of the H+-ATPase activity. Any transport process, also across
endomembranes, that affects the cytoplasmic pH is likely to affect the net proton
fluxes at the cell surface. Hence, the presence or absence of an anion/H+ antiporter
will have such an effect.
Figure 4. Comparison of the peak
values of the proton-flux (upper panel)
and the DFEH (lower panel) at two pH
values. Upper panel: peak values are the
fluxes measured around 250 μM from
the roottip as shown in Figure 3. Lower
panel: DFEH: the distance between root
tip and first epidermal cell with visible
root hair bulge. Datapoints are the
average of 6 experiments and the error
bars indicate the standard deviation.
For the second requirement for cell expansion, the generation of sufficient turgor,
the same anion/H+ antiporter will also have a key role. Accumulation of solutes that
have to provide the low osmotic potential to attract water to enter the cell will have to
be balanced in all cellular compartments. Therefore, the vacuole, being the largest
compartment has to be stocked with a mixture of small organic molecules and nearly
68
Anion channels and root elongation
equal amounts of cations and anions. Under most conditions the accumulation factor
between cytoplasm and vacuole found for anions can thermodynamically not be
explained by simple diffusion down the electrical potential (positive inside the
vacuole). The accumulation of anions is often so high that secondary active transport,
mediated by anion/H+ antiporters is essential. Also plasma membrane anion channels
play a central role in cytosolic pH regulation of plant cells (Johannes et al., 1998).
The link between ClC anion transporters and H+-pumping has been confirmed for the
mammalian ClC3, ClC5 and ClC7 transporters (Jentsch et al., 2002). The prokaryotic
ClC anion channel was shown to mediate a stoichiometrically fixed 2 anions/proton
antiport activity (reviewed in Miller, 2006). In plants, the same function has been
proposed for AtClCa and AtClCd (De Angeli et al., 2006 and De Angeli et al., 2007).
After confirmation that the Atclca, -b and -d mutants we had selected for this study
were homozygous, and indeed lacked a full transcript (Figure 1) we used them to
elucidate the role of endomembrane H+/anion antiporters in Arabidopsis root
elongation.
Proton fluxes and root cell elongation
Changing the pH from 5.8 tot 6.2 reveals three differences between Atclca and
Atclcd on the one hand and wildtype and Atclcb on the other. In Atclca and Atclcd
increasing the pH leads to 1) a more drastic decrease in H+ influx, 2) a stronger
inhibition of primary root growth and 3) to a shortening of the root expansion zone.
From these results we conclude that the AtClCa and AtClCd transporter proteins
are involved in primary root expansion growth. This conclusion is based on the
following considerations: 1) For the different genotypes exposed to a higher pH, the
length of the primary root correlates with the distance between root tip and first
epidermal cell with visible root hair bulge (DFEH) and this indicates that specifically
cell expansion is reduced in the Atclca and Atclcb mutant plants. The length of the
first epidermal cell with a visible root hair bulge (LEH) was previously defined as a
parameter to study root development and the control of elongation on cell level (Le et
al., 2001). This parameter is less useful when cell size measurements are more
difficult to perform, which for instance is the case when the root tips are swollen and
have accumulated pigments, and the epidermal cell walls are obscured. Measuring the
DFEH is easier since it only involves the recognition of the first root hair bulge and
the root tip. Since the epidermal cell exhibiting the first root hair marks the end of the
69
Chapter 4
fast elongation zone and the onet of the differentiation zone in Arabidopsis root (De
Cnodder et al., 2006) the DFEH should therefore give a fairly accurate reflection of
the expansion rate in the distal part of the primary root. This implies that in Atclca and
Atclcb mutants the expansion rate is reduced compared with wildtype and Atclcb
(Figures 4 and 5).
Figure 5. Phenotypes of the roots of the
Arabidopsis wildtype and the three single
mutants when grown on media with
different pH-values. The first epidermal
cell with a visible root hair bulge is
indicated by a arrow. This cell is used to
measure the DFEH (distance between
root tip and first Epidermal cell with
visible root hair bulge). The bar in the
upper left photo indicates 0.5 millimeter.
2) The zone of highest expression of the ClC genes, that show a reduced elongation
rate when mutated, coincides with the elongation zone. By using GUS staining in the
root Lv et al (2009) showed that AtClCa and AtClCd have the highest expression in
the elongation and maturation zone, but that they are absent in the division zone.
3) A function of AtClCd in cell expansion in root growth has been proposed
earlier. Atclcd mutants plant exhibit a reduction in root growth when compared to
wildtype at elevated pH’s of the medium, which is also attributed to low cell
expansion rates (Fecht-Bartenbach et al. 2007). The AtClCd protein is essential for
normal cell expansion of hypocotyls cells in which the V-type ATPase is inhibited or
only partly functional (Fecht-Bartenbach et al., 2007).
The result that the mutants with a more strongly reduced H+ influx, are the most
severely inhibited in root growth, is not immediately consistent with the accepted acid
growth theory for expansion growth. Normally, reduction of H+ influx would result in
70
Anion channels and root elongation
a lowering of the apoplastic pH and, consequently, it would be expected that the
expansion growth is stimulated in this situation. In the literature the indications that
lowering the pH induces cell elongation are many (Taguchi et al., 1999; Vanderhoef
and Dute, 1981; Rayle and Cleland 1992). For instance, part of elongation zone
growth is regulated by acid growth phenomena associated with cellular control over
the cell wall pH (Edwards and Scott, 1974; Buntemeyer et al., 1998; Peters and felle,
1999). Under normal conditions the surface pH along Arabidopsis roots, is highest in
the transition zone, and lowest in the adjacent fast elongation zone (De Cnodder et al.,
2006). Our results thus do not fit with this general model. We find that faster
elongation correlates with higher influx, not with higher efflux. We hypothesize that
for maintaining root growth at higher pH, functional AtClCa and AtClCd proteins are
necessary to drive the accumulation of anions in intracellular compartments,
specifically the vacuole and/or acidic vesicles, and to generate sufficient turgor. This
hypothesis would fit with our results: 1) the increased proton efflux in wildtype is
possibly the result of sustained anion/H+ co-transporter activity in the plasma
membrane and 2) the reduced root length phenotype of the mutants is only obvious at
higher pH values. At these higher pH’s cell wall elasticity is lower and elongation will
only be possible by higher turgor values.
71
Chapter 4
ACKNOWLEDGEMENTS
We would like to thank Ger Telkamp for his help in culturing the plants and
Marten Staal for his expert support with the MIFE measurements. This work was
supported in part by a grant from the Ministry of Science, Research and Technology
of the Islamic Republic of Iran.
72
Chapter 5
The role of AtClCa and AtClCd in heavy metal tolerance in
Arabidopsis thaliana
Hossein Moradi1,2, Theo Elzenga1 and Frank Lanfermeijer1
1
Department of Plant Biology, University of Groningen, 9750 AA Haren, The Netherlands
2
Department of Agronomy and Plant Breeding, Sari Agricultural Sciences and Natural Resources
University, Iran
73
Chapter 5
ABSTRACT
In higher plant cells, anion channels play a role in acclimation of plant cells
to abiotic and biotic environmental stresses, in the control of metabolism and in
the maintenance of electrochemical gradient. A number of studies have
demonstrated that anion channels are present in various cell types of plants.
Seven genes encoding chloride channel (ClC) proteins have been identified in the
Arabidopsis genome. To assess the function of ClCs in Arabidopsis, we obtained
three single mutant plants (Atclca, Atclcb, and Atclcd) with an T-DNA in the
respective genes and we made the three double and the triple mutant plants.
One of the aims of our study was to elucidate the role of anion channels in heavy
metal (i.e. cadmium) resistance and specifically their involvement in the
alleviation of cadmium effects by calcium.
The primary root growth and the morphology of cells between the
meristematic and elongation zone, were significantly affected by exposure to 60
μM Cd+2 in all genotypes. Adding Ca2+ to Cd2+-exposed plants, restored primary
root growth and the normal shape of cells, except in the double mutant Atclcad
and the triple mutant Atclcabd. We propose that both AtClCa and AtClCd
proteins play a role in the detoxification of cadmium by allowing efficient
sequestration of the metal in the vacuole or in acidic intracellular vesicles. Plants
that lack both transporter proteins, therefore have decreased cadmium
resistance.
The role of AtClCa and AtClCd in heavy metal tolerance
INTRODUCTION
Heavy metals are elements that have an atomic weight between approximately 63200 Daltons. Over 50 elements have been classified as heavy metals, 17 of which are
very toxic and relatively accessible. They are naturally occurring minerals that are
found throughout our natural environment. Contamination of soil with heavy metal is
a serious worldwide problem both for human health and agriculture (Gairola et al.,
1992; Mazess and Barden, 1991 and Ryan et al., 1982). Metal toxicity interferes with
cellular activity by several mechanisms: displacement of essential cations, induction
of oxidative stress, and direct interaction with proteins. Cadmium is a toxic heavy
metal that enters the environment, and also the food chain, through industrial
processes and phosphate fertilizers (Pinto et al., 2004). In plants, cadmium is taken up
easily by the roots of many plants species, where it can be loaded into the xylem and
transported to the leaves. Cadmium has a 2-20 times higher toxicity than most of the
other heavy metals (Jagodin et al., 1995). Cadmium toxicity is associated with growth
inhibition and imbalances in many macro and micronutrient levels. Cadmium toxicity
symptoms are more apparent in the root than the shoot, as the accumulation of Cd2+ in
the root is significantly higher than in the shoot (Breckle, 1991). In plants a low
concentration (5-10 μM) of Cd2+ reduces chlorophyll content and the photosynthetic
yield in Brassica napus (Baryla et al., 2001; Larsson et al., 1998), displaces Ca2+ in
the photosystem II (Faller et al., 2005), is negatively affecting in respiration (Greger
and Ogren, 1991; Reese and Roberts, 1985) and inhibits water transport (Barcelo and
Poschenrieder, 1990). Cadmium inhibits almost all enzymes of the Calvin cycle in
pigeon pea and wheat plants (Sheoran et al., 1990; Malik et al., 1992). Cadmium also
induces the generation of reactive oxygen species (ROS), resulting in the unspecific
oxidation of proteins and membrane lipids and DNA damage (Dean et al., 1993;
Ames et al., 1993), inhibits germination (Sarath et al., 2007) and suppresses root cell
elongation (Stohs and Bagchi, 1995; Schutzendubel et al., 2001). Uptake studies
suggest that transport of Cd2+ into the cytoplasm and vacuole might depend on both
active and passive transport systems (Costa and Morel, 1993; Costa and Morel, 1994;
Hall, 2002; Hart et al., 1998; Salt and Wagner, 1993).
Changes in the cytoplasmic calcium concentration are used by the cell as an
almost universal second messenger system for many signals. Disturbance of calcium
75
Chapter 5
homeostasis and displacement of calcium have been suggested as possible
mechanisms of Cd2+, Zn2+, Cu2+, or Al3+ toxicity (Kinraide et al., 2004). For instance,
the vacuolar Ca+2/H+ antiporter CAX2 in Arabidopsis is able to transport Ca2+, Cd2+
and Mn2+ (Hirschi et al., 2000). Cadmium competes with Ca2+ at both the Ca2+channel (Nelson, 1986) and at intracellular Ca2+ binding proteins (Rivetta et al.,
1997). Exposure to cadmium resulted in a decrease of the calcium content in different
plant species (Gussarson et al., 1996; Sandalio et al., 2001). This competition between
calcium and cadmium seems to work both ways: increasing the external calcium
concentration alleviates the effects of cadmium, an effect that is assumed to result
from the competition for transporters between the two ions (Suzuki, 2005).
Anion channels are well documented in various tissues, cell types and membranes
of animals, protists and plants and current evidence supports a central role in cell
signaling, osmo-regulation, nutrient uptake and metal tolerance (Barbier-Brygoo et
al., 2000). Seven ClC genes have been identified in the Arabidopsis genome.
Subcellular localization is still largely putative, but AtClCa-b-c and g are assumed to
function in the tonoplast , AtClCd and AtClCf are localized to the Golgi membrane
and AtClCe is assumed to be targeted to the tylakoide membrane (De Angeli et al.
2007; Marmagne et al., 2007; Lv et al., 2009). Recently, the localization in the
tonoplast of AtClCa and its role as a NO3-/H+ antiporter was demonstrated (De Angeli
et al., 2006).
The aim of this study was to determine the link between Cd2+ toxicity on the one
hand and Ca2+ and ClC transporter-related heavy metal resistance on the other hand.
We show that Cd2+ at concentrations of 60 to 90 μM causes serious damage in the
primary roots of all genotypes. Ca2+ was able to alleviated Cd2+ reduction of root
growth in most genotypes, except in plants that were defective in both the AtClCa and
AtClCd transporter.
The role of AtClCa and AtClCd in heavy metal tolerance
MATERIALS AND METHODS
Plant material and culture conditions
Plant material and standard culturing conditions used are the similar to those
described in Chapter 2. To determine Cd2+ toxicity, the role of Ca2+ and pH in this,
plants were transferred to new plates with the same solid medium but supplemented
with the appropriate concentrations of CdCl2, ZnCl2, PbCl2, BaCl2, MgCl2 or CaCl2.
Also the pH of the Tris/Mes-buffered medium was adjused when needed.
Screening for T-DNA insertion mutants
Selection for single, double and triple mutants has been described in Chapter 2.
Cell imaging in primary root
Imaging was performed using a Nikon Coolpix 990 digital camera mounted on an
inverted optical microscope (CX41, Olympus, Tokyo, Japan) equipped with
objectives of 20× and 40× magnification. After 15 days of growth (after sowing) on
the vertically placed agar plate the primary root length and the distance between root
tip and first epidermal cell with visible root hair bulge (DFEH) were measured using
the microscope. For every experiment the average of the root length of at least 8
plants was calculated and every experiment was repeated twice.
77
Chapter 5
RESULTS
Reverse transcription PCR analyses
RT-PCR for Atclc single, double and triple mutant plants was carried out with
gene specific primers as described in chapter 2 and the bands were compared with the
tubulin product. RT-PCR confirmed the expression of AtClCa , AtClCb and AtClCd in
root tissue. In all mutant genotypes the absence of transcripts confirmed that the TDNA insertions all resulted in null alleles (Figure 1).
Figure 1. The absence of expression of
the AtClCa, AtClCb and AtClCd genes in
the double and triple mutant lines. The
five genotypes were analysed using the
primers shown in table 1 of chapter 2.
The Tubulin transcript levels of the five
genotypes are shown as a loading
control.
Cd2+, Pb2+ and Zn2+ inhibits primary root growth in Atclc mutant plants
Exposure of 7 days old seedling to 90 μM Cd2+ resulted after 8 days of further
growth in strongly reduced primary roots (Figure 2a). Exposure to 90 μM ZnCl2
(Figure 3) or lower CdCl2 (Figure 2a) concentrations only weakly inhibited primary
and lateral root growth. In all treatments, root growth was not significantly different
between single, double and triple mutant and wildtype plants.
The role of AtClCa and AtClCd in heavy metal tolerance
Figure 2. The inhibition of growth of the primary roots of the wildtype Arabidopsis and the
7 mutant genotypes by Cd2+ and the alleviation of the inhibition by Ca2+. a: Concentration
dependence of Cd2+ inhibition in absence and the presence of 30 mM CaCl2. b: Ca2+
concentration dependence of the alleviation of the inhibition of root growth by 90 μM Cd2+.
Datapoints are the average of 3 experiments and the error bars indicate the standard deviation.
Alleviation of cadmium toxicity by Ca2+ is different between wildtype and
Atclcad double mutants
Based on the results of Suzuki (2005), that increased external Ca2+ reduces the
effects of Cd2+ we tested the effect of 30 mM CaCl2 in plants exposed to toxic levels
of cadmium. The application of CaCl2 to Cd2+-stressed plants, restored the growth of
the primary root in all genotypes, except in two. In the Atclcad double mutant and in
the triple mutant Atclcabd the primary and lateral root was significantly shorter than
in the other genotypes (Figure 2a). The effect of calcium is dose-dependent and with
90 μM Cd2+ the Km for calcium is about 1 mM (Figure 2b). The restoration of root
growth in plants exposed to cadmium seems to be a calcium-specific effect. Addition
of BaCl2, cholinchloride or MgCl2 did not show any positive effect on the root growth
of plants that were treated with 90 μM CdCl2 (Figure 4).
.
Figure 3. Inhibition of root
growth by Zinc and the
absence of allevetation by
Ca2+ in the wildtype
Arabidopsis and the 4
multiple mutant genotypes.
Datapoints are the average of
3 experiments and the error
bars indicate the standard
Deviation
79
Chapter 5
In animal cells a relation between Zn2+-toxicity and anion channel function had
been demonstrated (Duffield et al., 2005 ). To test whether a similar relation exists in
plants, we studied the effects of Ca2+ on Zn2+-treated wildtype and Atclc mutant
plants. Figure 3 shows that, in contrast to Cd2+-treated plants, calcium does not
change the effect of zinc on root growth, nor does the genotype of the plant influence
the extent of the inhibition.
Figure 4. Influence of different cations on the inhibition of root growth in the wildtype
Arabidopsis and the 4 multiple mutant genotypes by Cd2+. The used concentrations of CaCl2,
BaCl2 CholineCl and MgCl2 are 30 mM. Datapoints are the average of 3 experiments and the
error bars indicate the standard deviation.
Effects of Cd2+ on root morphology
In plants exposed to cadmium the morphology and color of the root tip changes
and the shape of the cells in the elongation zone is distorted (Suzuki, 2005). In our
experiments, exposure to 90 μM Cd2+ also leads to deformation of the root tip and a
change in morphology of the cells along the root rip. In cadmium-treated roots the
diameter of the root tip is decreased and the color of the cells much darker (Figure 5).
At lower concentrations of Cd2+ (30-60 μM) the diameter of the primary root also
decreased and initiation of lateral root growth was still higher, but the shape and color
of the cells in the root tip were not different from the controls. The experiment shown
in figure 5 confirms that a high concentration of Cd2+ causes serious damage to the
cells at the border between the elongation and meristematic zone.
The role of AtClCa and AtClCd in heavy metal tolerance
Figure 5. Phenotypes of the roots of the
Arabidopsis wildtype and the four multiple
mutants when grown on media with Cd2+ or Cd2+
and Ca2+. The bar in the upper left photo
indicates 0.5 millimeter.
These effects of cadmium poisoning can also be alleviated by increasing the
external calcium concentration (Figure 5, right panels). In all genotypes the
morphology of calcium-treated roots is not significantly different from the controls.
For comparison we also exposed the plants to a high concentration of lead. 700 μM
Pb2+ does induce changes in the diameter and color of root, but does not affect the
shape of the cells in the tip of the primary root cells in same way as 90 μM Cd2+ does
(data not shown).
Relation between Cd2+, Ca2+ and pH condition in primary root growth
In Chapter 4 we showed that root growth in the Atclca and Atclcb mutants is more
sensitive to pH than in the wildtype plants. Since it is the combination of these same
mutated genes in which Ca2+ has a reduced capability to alleviate cadmium-toxicity
we tested the effect of pH on cadmium toxicity in the different genotypes (Figures 6
and 7).
81
Chapter 5
Figure 6. The pH dependence of Cd2+ inhibition of root growth and the pH dependence of
Ca2+ alleviation of this inhibition in wildtype Arabidopsis and the four multiple mutants. a:
pH of the growth medium was 5.8 b: pH of the growth medium was 6.2. The length of the
reference in the pictures in 2.5 cm.
At pH 5.8 we obtained a result comparable with the data presented in figure 2. At the
higher pH the mutations in both AtClCa and AtClCd genes resulted in a stronger pHinduced reduction of root growth. Curiously, at pH 6.2 the addition of 30 mM CaCl2
resulted in a complete reversal of the effect of Cd2+. At pH 6.2 no statistically
significant difference was found between control, the addition of only Ca2+ and the
The role of AtClCa and AtClCd in heavy metal tolerance
addition of both Ca2+ and Cd2+. The difference between the genotypes was present
also in the control situation, indicating that at pH 6.2 the effect of pH on root growth
of the genotypes is dominating the response.
Figure 7. The pH dependence of Cd2+ inhibition of root growth and the pH dependence of
Ca2+ alleviation of this inhibition in wildtype Arabidopsis and the four multiple mutants.
Plants were grown in the presence of either 90 μM CdCl2, 30 mM CaCl2 or the combination
of both salts. a: pH of the growth medium was 5.8 b: pH of the growth medium was 6.2
83
Chapter 5
DISCUSSION
In order to understand the relationship between heavy metals and anion
transporters in plant cells, we made single, double and triple anion channel mutants in
Arabidopsis thaliana (Figure 1). With these genotypes we show, firstly, specific
effects of cadmium on primary root growth and development, that cannot be
mimicked by the other heavy metals tested (zinc and lead). Secondly, the effects of
cadmium can be reversed by increasing the external calcium concentration. Thirdly,
we show that this effect of calcium depends on the presence of AtClCa or AtClCd.
The effect of cadmium on roots is different from the effect of other heavy metals
In plants exposed to cadmium the accumulation in the roots will be higher than in
the shoot and therefore phytotoxic effects will be more apparent in the root (Breckle,
1991). Although all three heavy metals tested resulted in inhibition of root growth, the
mode of action of cadmium differs from that of zinc and lead. The effects of lead do
resemble those of cadmium, as both result in a narrow root tip and a darkening of the
cells. However, cell deformation of the cells in the root tip that are characteristic for
exposure to sub-lethal concentrations of cadmium, were not observed after exposure
to lead. In Arabidopsis root that cell death first appeared in around meristematic and
then in elongation zone of root, where influx of Cd2+ caused cell death and inhibited
primary root growth (Suzuki, 2005).
While no differences between the genotypes, concerning heavy metal sensitivity,
were observed, a difference was observed when the capability of Ca2+ to alleviate the
Cd2+ reduction of root growth was studied. Ca2+ was unable to alleviate the Cd2+
effects in the mutant plants lacking functional AtClCa and AtClCd. The reduction of
root growth induced by Zn2+ is equal in all genotypes and is insensitive to calcium.
We interpret this effect of calcium as an increased sensitivity of the genotypes Atclcad
and Atclcabd for Cd2+.
Plant cells have developed a variety of mechanisms to protect cells from heavy
metals. One of them is the accumulation of soluble phenolic compounds in the cells,
resulting in protection of tissues against oxidative stress. (Yamamoto et al., 1998;
Schutzendubel et al., 2001; Suzuki, 2005), which is visible as the dark discoloration in
Cd2+ or Cu2+ exposed root tips. Another is exclusion and/or sequestration.
The role of AtClCa and AtClCd in heavy metal tolerance
In effects of calcium on cadmium toxicity: differential effect of Ca2+on Atclcad
double mutants
Cadmium mainly enters the root in the first few 1-1.5 mm behind the root tip and
the influx is significantly less, further up the root (Pineros et al., 1998; Arduini et al.,
1996). This is also the normal pattern of uptake for plant nutrients and several studies
indicate that it is likely that Cd2+ enters the plant, in a competitive way, through the
same transporters that are involved in nutrient uptake. Exposure to cadmium can
result in a decrease in the content of Ca, Zn, Cu, Mn and Fe in pea leaves (RodriguezSerrano et al., 2009). Cadmium uptake could be competitively inhibited by other
cations and by Ca2+-channel blockers (Blazka and Shaikh, 1992; Clemens, 2006).
Active and passive transport systems have been reported for Cd2+ in roots of several
plant species (Cataldo et al., 1981; Godbold, 1991; Gosta and Morel, 1993 and 1994;
Hart et al., 1998). Non-essential heavy metals might be transported via nutrient
transporters or channels that are not completely selective (Clemens et al., 1998). It has
been observed that cadmium not only competes with calcium for calcium transporters,
but also for intracellular Ca2+-binding proteins (Rivetta et al., 1997) and at plasma
membrane (Kinraide, 1998). Alleviation by calcium of Cd2+ toxicity by reducing the
Cd2+ uptake and accumulation, have been reported in radish (Rivetta et al. 1997),
tobacco (Choi et al., 2001), rice roots (Kim et al., 2002) and Arabidopsis seedlings
(Suzuki, 2005). Also, in Arabidopsis thaliana AtHMA1 functions as a Ca2+/ heavy
metal pump (Moreno et al. 2008). Analysis of the interaction between calcium and
cadmium in wildtype and all mutant plants the extent of the effect of Ca2+ on Cd2+toxicity is related the concentrations of Cd2+ and Ca2+. Our results confirm this
conclusion: 30 mM Ca2+ almost completely compensated the toxic effect of 30 and 60
μM Cd2+ (except for AtClCad and AtClCabd in 60 μM Cd2+). But at 90 μM Cd2+ the
alleviation by 30 mM Ca2+ was not complete. Furthermore, in 90 μM Cd2+, 0.5 – 1
mM of Ca2+ reduces toxicity by 1/3 to 2/3 and 2.5-30 mM Ca2+ reduces the effect of
cadmium by more than 2/3 (Figure 2b).
Our results showed that, of the different cations tested (BaCl2, MgCl2 , CaCl2 and
cholinchloride), only addition of CaCl2 alleviated cadmium-induced root growth
inhibition. This rules out that the antagonism between cadmium and calcium depends
on the occupation of extracellular binding sites, as for such a mechanism one would
expect also a positive effect of the other divalent cations.
85
Chapter 5
The most intriguing result in our study is the differential effect of calcium on the
cadmium toxicity in the Atclca and Atclcd mutants. Increasing the calcium
concentration in the double mutant AtClCad and triple mutant AtClCabd treated with
Cd2+, alleviated root growth significantly less than in other mutants and wildtype
plants (Figure 2). Several reports have made a connection between anion transporters
and heavy metal translocation. Heavy metals are transported across cell membranes
by a number of complex mechanisms. In animals metal transport into cells is sensitive
to the anion channel blocker DIDS (Simons, 1986; Lou et al., 1991). For animal cells
it has been proposed that heavy metals can cross the membranes via the anion channel
in the form of anionic complexes with carbonate, bicarbonate, hydroxyl, or chloride
ions (Foulkes, 2000).
Several previous investigations have demonstrated the important role of Ca2+ for
root elongation, even in the absence of metal toxicity (Demidchik et al., 2002;
Hanson, 1984; Kinraide, 1998). In plant guard cells (Schroeder and Hagiwara, 1989;
Hedrich et al., 1990; Allen et al.,1999; Blatt, 1999 and Leonhardt et al., 2004) and in
Arabiopsis thaliana suspension cells (Trouverie et al., 2008) anion channels are Ca2+sensitive and activated by transient increases of [Ca2+]. In Arabidopsis thaliana
hypocotyl protoplasts, activation of anion channels is directly dependent to the
calcium concentration at the cytosolic site of the plasma membrane (Lewis et al.,
1997).
Furthermore, reactive oxygen species (ROS), such as H2O2, are involved in
signaling pathways through the activation of plasma membrane calcium channels (Pei
et al., 2000; Murata et al., 2001, Kwak et al., 2003; Trouverie et al., 2008). One could
hypothesize that activation of the anion current would result from the activation of
calcium channels. Therefore, a simple explanation for the activation of anion channels
by oxidative stress and calcium application would rely on the ability of heavy metalinduced increased ROS concentrations to promote Ca2+ influx. However, the even
simpler hypothesis that cadmium toxicity is prevented by external calcium through
competition for transporters and thus reduction of the intracellular [Cd2+], is a good
possibility.
However, in both explanations the mechanistic role of AtClCa and AtClCd is not
obvious. Here we present a model for the role of these anion transporter proteins in
cadmium-tolerance (Figure 8). AtClCa and AtClCd are located on endomembranes,
have H+/anion antiporter activity and have the highest expression levels in the
The role of AtClCa and AtClCd in heavy metal tolerance
expansion and transition zone of the root (Lv et al., 2009). In yeast, mutants of gef1,
an anion transporter located in the trans-Golgi vesicles, fail to properly regulate pH
and are more sensitive to heavy metals. Heterologous expression of AtClCa, AtClCc
or AtClCd could at least partly complement gef1, and restore heavy metal resistance
(Gaxiola et al. 1998).
Figure 8. Model for the role of ClC transporter proteins in the sequesteration of cadmium in
intracellular compartments (e.g. the vacuole). A: Protons are actively pmped into the vacuole,
resulting in a pH gradient and a tonoplast potential (positive inside), the activity of the ClC
anion/proton antiporters proteins reduces the tonoplast potential and increases the
concentration of anions in the tonoplast. This facilitates the the accumulation of positively
charged Cd2+ in the vacuole. B: When the ClC anion/proton antiporters are either inactive or
absent this leads to an excess of positive charges and an acidic pH in the vacuole. This
situation reduces sequesteration of the Cd2+ in the vacuole.
We propose that in Arabidopsis thaliana AtClCa and AtClCd have a similar
function as a H+- and electrical shunt for the V-type ATPase and the heavy metal
transporter, respectively. Functional AtClCa and AtClCd proteins facilitate a high
accumulation of heavy metal in either the vacuole and/or acidic vesicles. The
observation that only the double mutant is more sensitive implies that AtClCa and
AtClCd have overlapping functionality. One possibility is that both are present in the
membrane of the same compartment and thus are truly redundant. Another option is
that they are localized in different compartments, but that heavy metal sequestration
occurs in both compartments, viz. the acidic trans-Golgi vesicles and the vacuole. In
this model the differential effect of Ca2+ on cadmium toxicity is based on two distinct
mechanisms of heavy metal resistance: exclusion, which is aided by addition of
calcium, and sequestration, which is facilitated by active AtClCa or AtClCd. Neither
gives full protection when exposed to 90 μM Cd2+, but in combination they can
restore full root growth and development.
87
Chapter 5
ACKNOWLEDGEMENTS
This work was supported in part by a grant from the Ministry of Science, Research
and Technology of the Islamic Republic of Iran.
Chapter 6
General discussion and conclusions
Hossein Moradi1,2, Theo Elzenga1 and Frank Lanfermeijer1
1
Department of Plant Biology, University of Groningen, 9750 AA Haren, The Netherlands
2
Department of Agronomy and Plant Breeding, Sari Agricultural Sciences and Natural Resources
University, Iran
89
Chapter 6
Functional redundancy
In the introduction we stated that we want to explore the position of the ClC
proteins in the complex network of membrane transport and solute fluxes. This study
shows that this is a complicated task. First of all, the most important problem seems to
be the absence of obvious phenotypes for single mutants. It requires creativity of the
scientist to generate conditions that evoke phenotypes. However, even the breeding of
double and triple mutants is no easy road to success (Chapter 2). Appearently, the ClC
channels exhibit high functional redundancy.
We started from the rational that the ClC proteins have a clear function in either
Cl- or NO3- homeostasis (Chapter 2 and 3). However, the absence of clear phenotypes
when, for instance, seeds were germinated in the presence of high concentrations of
these anions might indicate that their role in the homeostasis of those ions is limited.
Plants apparently have developed other transporter systems for these functions.
Our results more clearly indicate that ClC proteins play an important role in
energizing the membrane and pH homeostasis. Energizing the membrane and pH
homeostasis depend protons fluxes and currents carried by other ions. For generating
a large [H+] gradient, necessary for a high capacity of secondary active transport of
solutes, the electrical potential difference across the membrane has to be kept low.
The electrical component of the proton pumping ATPase activity therefore has to be
short-circuited. This shorting of the proton pump could be accomplished by any kind
of current. It does not matter if it’s carried by Cl- or NO3- or even K+ (but then in the
opposite direction). Although the ClC proteins can have distinct functions, for
instance being either a Cl- or an NO3- transporter, their electro-physiological
characteristics can still make them redundant as both can act as an electrical shunt in
the generation of the proton-motive force (Chapter 4 and 5). The situation is probably
even more complex as a shunt function can also be performed by a system not related
to the ClC proteins, for instance, by a K+ channel. Hence, this suggests that in order to
study the role of ClC proteins in energizing the membrane, the experiments should be
highly defined and controlled. Composition of experimental media should be simple
and the potential of alternative currents to occur should be limited. All electrophysiological tools should be used and, if possible, ClC-mediated fluxes should be
studied in plants were alternative currents can be excluded.
The second role of ClC proteins for which we found indications, is in the
accumulation in osmotically active solutes. Osmotically active solutes can be any
General discussion and conclusion
soluble ion or compound. A cell can accumulate other solutes if one of the normally
used solutes (Cl- or NO3-) is not available or can not be used (for instance in the
absence of AtClC proteins). Hence, in this case complementation of the function can
also be expected outside the group of ClC proteins: for example by malate or sugar
transporters.
A nice example of this type of redundancy is shown in Chapter 5. In this chapter it
is shown that Ca2+ can not alleviate Cd2+-induced reduction of root growth if AtClCa
and AtClCd are both absent. The currently favored model for explaining our
observation is, that Cd2+ toxicity is countered in two ways: 1) Ca2+ protects the plant
by competing with Cd2+ for essential sites in enzymes and transporters and 2) Cd2+ is
sequestered in internal compartments (vacuole), rendering them harmless. We propose
that in the latter mechanism ClC proteins play a role as shunts by allowing generation
of a PMF across intracellular membranes and the transport of Cd2+ across these
membranes (Chapter 5). In Chapter 1 (Table 1) it is suggested that AtClCa is a
H+/NO3- and AtClCd is a H+/Cl- antiporter. The fact that you need to remove both
transporters demonstrates that both proteins can be used as a shunt and complement
each other. If one of the two ClC proteins is missing, either the Cl- or the NO3- ions
can still be used to compensate the movement of positive charges (H+) by the primary
proton pumps. Thus, only in the case where both ClC proteins are removed, there are
apparently no transporters (or their charged substrates) present that can take over the
function as shunt. It would be interesting to study the effect of Ca2+ on Cd2+ toxicity
when the various genotypes are grown either on low Cl- or low NO3- media.
Root growth as studied in Chapters 2, 3 and 4 showed also that the main functions
of the ClC proteins are electrical circuits, which allow the generation of a PMF to
drive the uptake of osmotically active solutes or stimulate the capacity to acidify the
apoplast and thus facilitate cell expansion.
Intracellular localization of the ClC proteins
Although we do not need the exact localization of the ClC proteins in the model
proposed in Chapter 5. It remains an important issue for understanding the roles of
these proteins. And, as proposed above, if ClC proteins can functionally be replaced
by proteins that are not related to them, localization can become an important issue.
As suggested by the articles of Moore and Murphy (2009) and Millar et al. (2009)
localization studies are difficult and need a careful approach. Presently only the paper
91
Chapter 6
of De Angeli et al. (2006) seem to meet some of the proper standards. In that study
localization experiments on AtClCa are convincingly combined with physiological
measurements aimed at elucidating the function (patch clamp measurements).
Final conclusions
The study of ClC proteins is a complicated one. They seem to play a role in
different processes (osmo-regulation, detoxification, cell expansion, and maybe
more). Roles that are so important in plant cells, that several protein systems exists
which can fulfill these roles next to the ClC proteins. Functional studies on these
proteins require, next to creativity of the researcher, very specific conditions in the
experiments (for instance Ca2+ alleviation of Cd2+ effects) to observe phenotypes.
Several important issues remain to be studied: the role of the two CBS domains and
the role of ATP binding in the functioning of ClC proteins as shunts and osmoregulators. Also important for plants is the strictness of the duality of ClC proteins as
specific Cl- or specific NO3- transporters and the strictness of the duality as channels
or H+-cotransporters. The study of the ClC protein family will remain a challenge for
researchers in the coming years and, very likely, will yield unforeseen and surprising
results.
References
93
References
Accardi, A. and Miller, C. (2004) Secondary active transport mediated by a prokaryotic
homologue of ClC Cl- channels. Nature., 427, 803-807.
Accardi, A., Kolmakova-Partensky, L., Williams, C. and Miller, C. (2004) Ionic currents
mediated by a prokaryotic homologue of ClC Cl- channels. Journal Gen. Physiology., 123,
109-119.
Adler, P.R. and Wilcox, C.E (1995) Ammonium increases the net rate of sodium influx and
parttioning to the leaf of muskmelon. Journal of Plant Nutrition. 18, 1951-1962
Allaway, W.G. (1973) Accumulation of malat in guard cells of Vicia faba during stomatal
opening. Planta., 110, 63-70.
Allen, G.J, Kutchisu, K, Chu, S.P, Murata, Y. and Schroeder, J.I. (1999) Arabidopsis abi1 and abi-2 phosphatase mutations reduce abscisic acid-induced cytoplasmic calcium rises
in guard cells. Plant Cell, 11, 1785-1798.
Ames, B, Shigenaga, M. and Hagen, T. (1993) Oxidants, antioxidants, and the degenerative
diseases of ageing. Proceedings of the National Academy of Sciences, USA. 90, 7915-7922.
Amtmann, A. and Sanders, D. (1999) Mechanisms of Na uptake by plant cells. Advances in
Botanical Research., 29, 75-112.
Arduini, I, Godbold, D.L. and Onnis, A. (1996) Influence of copper on root growth and
morphology of pinus pinea L. and Pinus Pinaster Ait. Seedling. Tree physiology, 15, 411415.
Aronson, P.S. (1985) Kinetics properties of the plasma membrane Na+/H+ exchanger. Annu.
Rev. Physiol. 47, 545-560.
Askerlund P, Sommarin M. (1996) Calcium efflux transporters in higher plants. In:
Smallwood M, Knox JP, Bowles DJ, editors. Membranes: Specialized Functions in Plants.
Oxford: BIOS Scientific Publishers., 281–299.
Assmann,S.M. and Haubrick, L.L. (1996) Transport proteins of the plant plasma
membrane. Curr Opin Cell Biol., 8, 458-467.
Axelsen, K.B. and Palmgren, M.G. (1998) Evolution of substrate specificities in the P-type
ATPases superfamily. J Mol Evol.,46,84–101.
Bar, Y. Apelbaum, A. Kafkafi, U. and Goren, R. (1997) Relationship between chloride and
nitrate and its effect on growth and mineral composition of avocado and citrus plants.
Journal of Plant Nutrition. 20, 715-731.
Bar, Y. Apelbaum, A. Kafkafi, U. and Goren, R. (1997) Relationship between chloride and
nitrate and its effect on growth and mineral composition of avocado and citrus plants.
Journal of Plant Nutrition. 20, 715-731.
Barbier-Brygoo, H, Vinauger, M, Colcombet, J, Ephritikhine, G, Frachisse, J. and
Maurel, C. (2000) Anion channels in higher plants: functional characterization, molecular
structure and physiological role. Biochim. Biophys. Acta, 1465, 199-218.
Barcelo, C.and Poschenrieder. (1990) Plant water relations as affected by heavy metal
stress: a review. J. Plant Nutr, 13, 1-37.
Baryla, A., Carrier, P., Franck, F., Coulomb, C., Sahut, C. and Havaux, M. (2002) Leaf
chlorosis in oilseed rape plants (Brassica napus) grown on cadmium-polluted soil: causes
and consequences for photosynthesis and growth. Planta, 212, 696-709.
Beffagna, N., Romai, G., Meraviglia, G. and Pallini, S. (1997) Effects of abscisic acid and
cytoplasmic pH on potassium and chloride efflux in Arabidopsis thaliana seedligs. Plant
Cell Physiol., 38, 503-510.
Benfey, N.B., Linstead, P.J., Roberts, K., Schiefelbein, J.W., Hauser, M.T. and
Aeschbacher, R.A. (1993) Root development in Arabidopsis: four mutants with
dramatically altered root morphogenesis. Development. 119, 57-70
Bergsdorf, E.Y., Zdebik, A.A and Jentsch., T.J (2009). Residues important for
nitrate/proton coupling in plant and mammalian CLC transporters. J. Biol. Chem. 284,
11184-11193
Besson-Bard, A., Gravot, A., Richaud P., Auroy, P., Duc, C., Gaymard, F., Taconnat, L.,
Renou, J.P., Pugin, A. and Wandehenne, D. (2009) Nitric oxide contributes to cadmium
toxicity in Arabidopsis by promoting cadmium accumulation in roots and by up-regulating
genes related to iron uptake. Plant Physiology, 149, 1302-1315.
References
Blatt, M.R. (1999) Reassessing roles for Ca2+ in guard cell signalling. J. Exp. Bot, 50, 989999.
Blazka, M.E. and Shaikh, Z.A. (1991) Differences in cadmium and mercury uptake by
hepatocytes: role of calcium channel. Toxicol Appl Pharmacol, 110, 355-363.
Blazka, M.E. and Shaikh, Z.A. (1992) Cadmium and mercury accumulation in rat
hepatocytes. Toxicol Appl Pharmacol, 113, 118-125.
Blumwald, E., Aharon, G.S. and Apse, M.P. (2000) Sodium transport in plant cell.
Biochim. Biophys. Acta., 1465, 140-151.
Bowling, D.J.F. (1976) Malate-switch hypothesis to explain the action of stomata. Nature.,
262, 393-394.
Brandt, P.C.and Vanaman, T.C. (1998) Calmodulin and ion flux regulation. In: Van Eldik
L, Watterson DM, editors. Calmodulin and Signal Transduction. San Diego: Academic
Press., 397–471.
Breckle, S. (1991) Growth under stress. Heavy metals. In: Plant Poots: The Hidden Half,
Eds.Y. Waisel, A. Eshel and U. Kafkafi, M. Dekker, Inc, New York, 351–373.
Britto, D.T. Ruth, T.J. Lapi, S. and Kronzucker, H.J. (2004) Cellular and whole- plant
chloride dynamics in barley: insights into chloride-nitrogen interaction and salinity
responses. Planta. 218, 615-622.
Buntemeyer, K., Luthen, H. and Bottger, M. (1998) Auxin-induced changes in cell wall
extensibility of maize roots. Planta., 204, 515-519.
Carpita, N. and Gibeaut, D.M. (1993) structural model of primary cell walls in flowering
plants: consistency of molecular structure with the physical properties of the walls during
growth. The Plant Journal. 3, 1-30.
Cataldo, D.A., Garland, T.R. and Wildung, R.E. (1981) Cadmium uptake kinetics in intact
soybean plants. Plant Physiology and Biochemistry, 73, 844-848.
Chang, G., Spencer, R.H Lee, A.T ., Barclay, M.T. and Douglas C. Rees, D.C. (1998)
Structure of the MscL Homolog from Mycobacterium tuberculosis: A Gated
Mechanosensitive Ion Channel. Science., 282, 2220 – 2226.
Chanson, A. and Taiz, L. (1985) Evidence for an ATP-dependent proton pump on the Golgi
of corn coleoptiles. Plant physiology., 78, 232-240.
Cho, M.H. and Spalding, E.P. (1996) An anion channel in Arabidopsis hypocotyls activated
by blue light. Proceedings of the National Academy of Sciences., 93, 8134-8138.
Choi, Y.E., Harada, E., Wada, M., Tsuboi, H., Morita, Y., Kusano, T. and Sano, H.
(2001) Detoxification of cadmium in tobacco plant: formation and active excretion of
crystals containing cadmium and calcium through trichomes. Planta, 213, 45-50.
Clemens, S. (2006) Toxic metal accumulation, responses to exposure and mechanisms of
tolerance in plants. Biochimie, 88, 1707-1719.
Clemens, S., Antosiewicz, D.M., Ward, J.M., Schachtman, D.P. and Schroeder, J.I.
(1998) The plant cDNA LCT1 mediates the uptake of calcium and cadmium in yeast. Proc.
Natl. Acad. Sci USA, 95, 12043-12048.
Cocombet, J., Lelievre, F, Thomine, S.and Barbier-Brygoo, H. (2005) Distinct pH
regulation of slow and rapid anion channels at the plasma membrane of Arabidopsis
thaliana hypocotyls cells. J. Exp. Bot ., 56, 1897-1903.
Cohen, J. and Schulten, K. (2004) Mechanism of anionic conduction across ClC.
Biophysical Journal., 86, 836-845.
Colcombet, J., Lellevre, F., Thomine, S. and Barbier-Brygoo, H. (2005) Distinct pH
regulation of slow and rapid anion channels at the plasma membrane of Arabidopsis
thaliana hypocotyl cells. Journal of Experimental Botany., 56, 1897-1903.
Cosgrove, D.J. (1997) Relaxation in a high-stress environment: the molecular bases of
extensible cell walls and cell enlargement. Plant Cell. 9, 1031-1041.
Cosgrove, D.J. (1999) Enzymes and other agents that enhance cell wall extensibility. Ann.
Rev. Plant Mol. Biol. 50, 391-417.
Cosgrove, D.J. (2000) Loosening of plant cell walls by expansins. Nature. 407, 321-326.
95
References
Cosson,P., Curtis,I., Pouyssegur,J., Griffiths,G. and Davoust,J.(1989) Low cytoplasmic
pH inhibits endocytosis and transport from the trans-Golgi network to the cell surface.
Journal Cell Biology.,108,377-387.
Costa, G. and Morel, J.L. (1993) Cadmium uptake by Lupinus albus (L.): cadmium
excretion, a possible mechanism of cadmium tolerance. J. Plant Nutr, 16, 1921-1929.
Costa, G. and Morel, J.L. (1994) Efficiency of H+ ATPase activity on cadmium uptake by
four cultivars of lettuce. J. Plant Physiology, 17, 627-637.
De Angeli, A. Monachello,D. Ephritikhine, G. Frachisse, J.M. Thomine,S. Gambale, F.
and Barbier-Brygoo, H. (2006) The nitrate/proton antiporter AtCLCa mediates nitrate
accumulation in plant vacuoles. Nature. 442, 939-942.
De Angeli, A., Thomine, S., Frachisse, J.M., Ephritikhine, G., Gambale, F. and BarbierBrygoo, H. (2007) Anion channels and transporters in plant cell membranes. FEBS Letters,
581, 2367-2374.
De Cnodder, T., Verbelen, J.P. and Vissenberg, K. (2006) The control of cell size and rate
of elongation in the Arabidopsis root. Plant Cell Monogr. 5, 249-269.
De Michelis, M.I. and Spanswick, R.M. (1986) H+-pumping driven by the vanadatesensitive ATPase in membrane vesicles from corn roots. Plant Physiology. 81, 542-547.
Dean, R.T., Gieseg, S. and Davies, M. (1993) Reactive species and their accumulation on
radical-damaged proteins. Trends in Biological Sciences, 18, 437-441.
Deanne-Drummond, C.E. (1986) A comparison of regulatory effects of chloride on nitrate
uptake and nitrate on chloride uptake into Pisum sativum seedling. Physiologia Plantarum.,
66, 115-121.
Demidchik, V., Bowen, H.C., Maathuis, F.J.M., Shabala, S.N., Tester, M.A., White P.J.
and Davies J.M.Arabidopsis thaliana root non-selective cation channels mediate calcium
uptake and are involved in growth. The Plant Journal, 32, 799-808
Dettmer, J. Hong-Hermesdorf, A. Stierhof, Y.D. and Schumacher, K. (2006) Vacuolar H+
-ATPase activity is required for endocytic and secretory trafficking in Arabidopsis. The
Plant Cell. 18, 715-730.
Dettmer, J., Schubert, D., Calvo-Weimar, O., Stierhof, Y.D., Schmidt, R. and
Schumacher, K. (2005) Essential role of the V-ATPase in male gametophyte
development. Plant Journal., 41, 117-124.
Dietrich, P. and Hedrich, R. (1998) Anions permeate and gate GCACl, a voltage-dependent
guard cell anion channel. The Plant Journal., 15, 479-487.
Dolan, L., Janmaat, K., Willemsen, V., Linstead, P., Poethig, S., Roberts, K. and
Scheres, B. (1993) Cellular organization of the Arabidopsis thaliana root. Development,
119, 71-84.
Donald, P. Briskin and Margaret, C. Cawienowski. (1996) Role of the plasma Membrane
H+-ATPase in K+ transport'. Plant Physiol. 111 , 1199-1207.
Downton, W.J.S. (1977) Influence of rootstocks on the accumulation of chloride, sodium and
potassium in grapevines. Australian Journal of Agricultural Research. 28, 879-889.
Doyle, D.A., Cabral, J. M., Pfuetzer, R.A., Kuo, A., Gulbis, J.M., Cohen, S.L., Chait,
B.T. and Mackinnon, R. (1998) The structure of the potassium channel: molecular basis
of K+ conduction and selectivity. Science., 280, 69-77.
Dube, F., Dufresne, L., Coutu, L. and Clotteau, G. (1991) protein phosphorylation during
activation of surf clam oocytes. Dev Biol., 146, 473-482.
Duffield,M.D., Rychkov, G.Y., Bretag, A.H. and Roberts, M.L. (2005) Zinc inhibits
human ClC-1 muscle chloride channel by interacting with its common gating mechanism. J
Physiol, 568,5–12
Dutzler, R., Campbell, E. B. & MacKinnon, R. (2003). Gating the selectivity filter in ClC
chloride channels. Science., 300, 108-12.
Dutzler, R., Compbell, E.B., Cadene, M., Chait, B.T. and Mackinnon,R. (2002) X-ray
structure of a ClC chloride channel at 3.0 A reveals the molecular basis of anion selectivity.
Nature., 415, 287-294.
References
Edminds, B.T., Murray, J. and Condeelis, J. (1995) pH regulation of the F-actin binding
properties of Dictyostelium elogation factor 1. Journal Cell Biology., 270, 15222-15230.
Edwards, K.L. and Scott, T.K. (1974) Rapid growth responses of corn root segments: Effect
of pH on elongation. Planta., 119, 27-37.
Elzenga, J.T.M., Prins, H.B.A. and Van Volkenburgh, E. (1995) Light induced membrane
potential changes of epidermal and mesophyll cells in growing leaves of pisum sativum
arg. Planta., 197,127-134.
Elzenga, J.T.M. and Van Volkenburgh, E. (1997) Characterization of a light-controlled
anion channel in the plasma membrane of mesophyll cells of Pea. Plant Physiology., 113,
1419-1426.
Evans, D.E. (1994) Calmodulin-stimulated calcium pumping ATPases located at higher plant
intracellular membranes: a significant divergence from other eukaryotes Physiol
Plant.,90,420–426.
Evans, D.E. and Williams, L.E. (1998) P-type calcium ATPases in higher plants:
biochemical, molecular and functional properties. Biochim Biophys Acta..,1376,1–25.
Fahlke, C., Yu, H.T., Beck, C.L., Rhodes, T.H. and Georege, A.L. (1997) Pore-forming
segments in voltage-gated chloride channels. Nature., 390, 529-532.
Faller, P., Kienzler, K. and Krieger-Liszkay, A.( 2005) Mechanism of Cd toxicity: Cd
inhibits photoactivation of photosystem II by competitive binding to the essential Ca site.
Biochim, Biophys. Acta, 1706, 158-164.
Fan, L.and Neumann, P.M. (2004) The spatially variable inhibition by water deficit of
maize root growth correlates with altered profiles of proton flux and cell wall pH. Plant
Physiology, 135, 2291-2300.
Fasano, J.M., Swanson, S.J., Blancaflor, E.B., Dowd, P.E., Kao, T.H. and Gilroy, S.
(2001) Changes in root cap pH are required for the gravity response of the Arabidopsis
root. The Plant Cell., 13, 907-921.
Faundez, V. and Hartzell, H.C. (2004) Intracellular chloride channels: determinants of
function in the endosomal pathway. Science STKE.,. 2004, 1-7.
Fecht-Bartenbach, J.V.D. Bogner, M. Krebs, M. Stierhof, Y.D. Schumacher, K. and
Ludewig,U. (2007) Function of the anion transporter AtCLC-d in the trans-Golgi network.
The Plant Journal. 50, 466-474
Feijo, J.A., Sainhas, J., Hackett, G.R., Kunkel, J.G. and Hepler, P.K. (1999) Growing
pollen tubes possess a constitutive alkaline band in the clear zone and a growth-dependent
acidic tip. Journal Cell Biology., 144, 483-496.
Felle, H. (1994). The H+-/Cl - symporter in root hair cells of Sinapis alba. Plant Physiol., 106,
1131-1136
Felle, H., Boss, W.F. and Morré, D.J (1989) pH as a second messenger in plants. Second
messengers in plant growth and development. Alan R. Liss, New York.145-166.
Felle, H.H. (1994) The H+/Cl- symporter in root-hair cells of Sinapsis alba. Plant Physiology.,
106, 1131-1136.
Flower, T.J. and Yeo, A.R. (1995) Breeding for salinity resistance in crop plants. Aus.J.
Plant Physiology., 22, 875-884.
Folta, K.M. and Spalding, E.P. (2001) Unexpected roles for cryptochrome 2 and
phototropin revealed by high-resolution analysis of blue light-mediated hypocotyl growth
inhibition. Plant Journal., 26, 471-478.
Foulkes, E.C. (2000) Transport of toxic heavy metals across cell membranes. Society for
Experimental Biology and Medicine, 234-240.
Frachisse, J.M., Colcombet, J., Guern, J. and Barbier-Brygoo, H. (2000) Characterization
of a nitrate-permeable channel able to mediate sustained anion efflux in hypocotyl cells
from Arabidopsis thaliana. The Plant Journal., 21, 361-371.
Fujita, H.and Syono, K. (1996) Genetic analysis of the effects of polar auxin transport
inhibitors on root growth in Arabidopsis thaliana. Plant Cell Physiology. 37, 1094-1101.
Fujita, N., Mori, H., Yura,T. and Ishihama,A. (1994) Systematic sequencing of the
Escherichia coli genome: analysis of the 2.4-4.1 min (110, 917-193, 643 bp) region.
Nucleic Acids Res., 22, 1637-1639.
97
References
Fukuda, A., Nakamura, A., Tagiri, A., Tanaka, H., Miyao, A., Hirochika, H. and
Tanaka, Y. (2004) Function, intracellular localization and the impotance in salt tolerance
of a vacuolar Na+/H+ antiporter from rice. Plant Cell Physiology., 45, 146-159.
Gairola, C.G., Wagner, G.J. and Diana, J.N.(1992) Tobacco, Cd and health. J Smoking
Rel.Dis,3, 3-6.
Garnett, T.P. Shabala, S.N. Smethurst, P.J. and Newman, I.A. (2003) Kinetics of
ammonium and nitrate uptake by eucalypt root and associated proton fluxes measured
using ion selective microelectrodes. Functional Plant Biology. 30, 1165-1176.
Gaxiola R.A., Yuan, D.S., Klausner, R.D. and Fink, G.R. (1998) The yeast CLC chloride
channel functions in cation homeostasis. Proc. Natl. Acad. Sci. USA
Geelen, D. Lurin, C. Bouchez, D. Frachisse, J.M. Leliever, F. Courtial, B. BarbierBrygoo, H. Guern, J. and Maurel, C. (2000) Disruption of putative anion channel gene
AtCLC-a in Arabidopsis suggests a role in the regulation of nitrate content. The Plant
Journal. 21, 259-269.
Geisler, M., Axelsen, K., Harper, J.F. and Palmgren, M.G. (2000) Molecular aspects of
higher plant P-type Ca2+-ATPases. Biochim Biophys Acta.,1465,52–78.
Gilliham, M. and Tester, M. (2005) The regulation of anion loading to the maize root
xylem. Plant Physiology., 137, 819-828.
Godbold, D.L. (1991) Cadmium uptake in Norway spruce. Tree physiology, 9, 349-357.
Graves, A.R., Curran, P.K., Smith, C.L. and Mindell, J.A. (2008) TheCl-/H+ antiporter
ClC-7 is the primary chloride permeation pathway in lysosomes. Nature., 453, 788-792.
Green, J.R., Brown, N.H., DiDomenico, B.J., Kaplan,J. and Eide, D.J. (1993) The GEFl
gene of Asccharomyces cerevisiae encode an integral membrane protein: mutation in which
have effects on respiration and iron-limited growth. Molecular Genetic., 241, 542-553.
Greger, M. and Bertell, G. (1992) Effect of Ca2+ and Cd2+ on the carbohydrate metabolism
in sugar beet (beta vulgaris). J. Exp. Bot, 43, 167-173.
Greger, M. and Ogren, E. (1991) Direct and indirect effects of Cd on the photosynthesis and
CO2-assimilation in sugar beet (Beta Vulgaris), Physio. Pant, 83, 129-135.
Gue,F.Q., Young,J. and Crawford, N.M.(2003) The nitrate transporter AtNRT1.1 (CHL1)
functions in stomatal opening and contributes to drought susceptibility in Arabidopsis.
Plant Cell., 15,107-117.
Guern, J. (1991) Regulation of intracellular pH in plant cells. International Review of
Cytology., 127, 111-173.
Guern, J., Mathieu, Y., Thomine, S., Jouanneau, J.P. and Beloeil, J.C. (1992) Plant cells
counteract cytoplasmic pH changes but likely use these pH changes as secondary
messenges in signal perception. Curr Top Plant Biochem Physiology., 11, 249-269.
Guo, F.Q., Young, J. and Crawford, N.M. (2003) The nitrate transporter AtNRT1.1
(CHL1) functions in stomatal opening and contributes to drought susceptibility in
Arabidopsis. Plant Cell., 15, 107-117.
Gussarson, M., Asp, H., Adalsteinsson, S. and Jensen, P. (1996) Enhancement of Cd
effects on growth and nutrient composition of birch (Betula pendula) by buthionine
sulphoxinine. J. Exp Bot, 47, 211-215.
Hafke,J.B., Hafke,Y., Smith, J.A., Luttge,U. and Thiel,G. (2003) Vacuuolar malate uptake
is mediated by an anion selective inward rectifier. Plant Journal., 35,116-128.
Hall, J.L. (2002) Cellular mechanisms for heavy metal detoxification and tolerance. J. Exp.
Bot, 366, 1-11.
Hanson, J.B. (1984) The function of calcium in plant nutrition. Advances in Plant nutrition,
1, 149-208.
Harada,H. Kuromori, T. Hirayama, T. Shinozaki. and K. Leigh, R.A. (2004) Quantitative
trait loci analysis of nitrate storage in Arabidopsis leading to an investigation of the
contribution of the anion channel gene, AtCLC-c, to variation in nitrate levels. Journal of
Experimental Botany. 55, 2005-2014.
Hart, J.J., Welch, R.M., Norvell, W.A., Sullivan, L.A. and Kochian, L.V. (1998)
Characterization of cadmium binding, uptake, and translocation in intact seedlings of bread
and durum wheat cultivars. Plant Physiology, 116, 1413-1420.
References
Hasegawa, P.M., Bressean, R.A., Zhu, J.K. and Bohnert, H.J. (2000) Plant cellular and
molecular response to high salinity. Annu. Rev. Plant Physiol. Plant Mol. Biol., 51, 463499.
Hauser, M.T., Morikami, A. and Benfey, P.N. (1995) Conditional root expansion mutants
of Arabidopsis. Development. 121, 1237-1252
Hechenberger, M. Schwappach, B. Fischer, W.N. Frommer, W.B. Jentsch, T.J. and
Steinmeyer, K. (1996) A family of putative chloride channels from Arabidopsis and
functional complementation of a yeast strain with a CLC gene disruption. Journal of
Biological Chemistry. 271, 33632-33638.
Hedrich, R. and Kurkdjian, A. (1988) Characterization of an anion-perme-able channel
from sugar beet vacuoles: effect of inhibitors. EMBO Journal., 7, 3661-3666.
Hedrich, R., Busch, H. and Raschke, K. (1990) Ca2+ and nucleotide dependent regulation of
voltage dependent anion channels in the plasma membrane of gurd cells. EMBO J, 9, 38893892.
Higgins, C.F. (1995) The ABC of channel regulation, Cell., 82, 693-696.
Hille, B. (1992) Ionic channels of Excitable Membranes, 2nd Ed. Sinauer Associates,
Sunderland, MA.
Hirsichi, K.D., Korenkov, V.D., Wilganowski, N.L. and Wagner, G.J. (2000) Expression
of Arabidopsis CAX2 in tobacco. Altered metal accumulation and increased manganese
tolerance. Plant Physiology, 124, 125-133.
Hoekenga, O.A., Maron, L.G., Pineros, M.A., Cancado, G.M., Shaff, J., Kobayashi, Y.,
Ryan, P.R., Dong, B., Delhaize, E., Sasaki, T., Matsumoto, H., Yamamoto, Y.,
Koyama, H. and Kochian, L.V. (2006) AtALMT1, which encodes a malate transporter, is
identified as one of several critical genes for aluminum tolerance in Arabidopsis. Proc.
Natl. Acad. Sci. USA., 103, 9738-9750.
Hurth, A., Suh, S., Kretzscmar, T., Geis, T., Bregante, M., Gambale, F., Martinoia, E.
and Neuhaus, E. (2005) Impaired pH homeostasis in Arabidopsis lacking the vacuolar
dicarboxylate transporter and analysis of carboxylic acid transport across the tonoplast.
Plant physiology., 137, 901-910.
Jagodin, B., Govorina, V., Vinogradova, S., Zamaraev, A. and Chapovskaja G. (1995)
Cadmium and lead accumulation in some agricultural crops, grown in podzolic soils.
Izvestija TSHA, 2, 85–99 (in Russ.).
Jentsch, T.J. Poet. M. Fuhrmann, J.C. and Zdebik, A.A. (2005) Physiological function of
CLC Cl-channels gleaned from human genetic disease and mouse models. Annu. Rev.
Physiology. 67, 779-807.
Jentsch, T.J. Stein. V. Weinreich, F. and Zdebik, A.A. (2002) Molecular structure and
physiological function of chloride channels. Physiol. Rev. 82, 503-568.
Jentsch, T.J.(1996) Chloride channels: a molecular perspective, Curr.Opin. Neurobiolo., 6,
303-310.
Jentsch, T.J., Friedrich, T., Schriever, A. and Yamada, H. (1999) The ClC chloride
channel family. Journal physiology., 437, 783-795.
Jentsch, T.J., Gunter, W., Pusch, M. and Schwappach, B. (1995) Properties of voltagegated chloride channels of the ClC gene family. Journal Physiology., 482, 198-258.
Jentsch, T.J., Maritzen, T. and Zdebik, A.A. (2005) Chloride channel diseases resulting
from impaired transepithelial transport or vesicular function. The Journal of Clinical
investigation. Rev., 115, 2039-2046.
Jentsch, T.J., Stein, V., Weinreich, F, and Zdebik, A.A. (2002) Molecular structre and
physiological function of chloride channel. Plant Physiology, 82, 503-568.
Jentsch, T.J., Steinmeyer, K.and Schwarz, G. (1990) Primary structure of Torpedo
marmorata chloride channel isolated expression cloning in Xenopus oocytes. Nature., 348,
510-514.
Johannes, E., Crofts, A. and Sanders, D. (1998) Control of Cl- efflux in Chara coralline by
cytosolic pH, free Ca2+, and phosphorylation indicates a role of plasma membrane anion
channels in cytosolic pH regulation. Plant Physiology., 118, 173-181.
99
References
Kafkafi, U. Valoras, N. and Letey, J (1982) Chloride interaction with nitrate and
phosphoate nutrition in tomato (Lycopersicon esculentum L). Journal of Plant Nutrition. 5,
1369-1385.
Keller, B.U., Hedrich, R. and Raschke, k. (1989) Voltage-dependent anion channels in the
plasma membrane of guard cells. Nature., 341, 450-453.
Kiegle, E., Gilliham, M., Haseloff, J. and Tester, M. (2000) Hyperpolarisation-activated
calcium currents found only in cells from the elongation zone of Arabidopsis thaliana
roots. Plant Journal., 21, 225-229.
Kim, Y., Yang, Y.Y. and Lee, Y. (2002) Pb and Cd uptake in rice roots. Physiology Plant,
116, 368-372.
Kinraide, T.B. (1998) Three mechanisms for the calcium alleviation of mineral toxicities.
Plant Physiology, 118, 513-520.
Kinraide, T.B., Perler, J.F. and Parker, D.R. (2004) Relative effectiveness of calcium and
magnesium in the alleviation of rhizotoxicity in wheat induced by copper, zinc, aluminium,
sodium, and low pH. Plant and Soil, 259, 201-208.
Klimyuk,V.I,. Carroll, B.J,. Thomas, C.M, and Jones, J.D. (1993) Alkali treatment for
rapid preparation of plant material for reliable PCR analysis. The Plant Journal., 3, 493494.
Köhler,B. and Raschke,K. (2000) The delivery of Salts to the Xylem. Three Types of Anion
Conductance in the Plasmalemma of the Xylem Parenchyma of Roots of Barley. Plant
Physiol., 122, 243-254.
Köhler,B., Wegner, L.H., Osipov. and V., Raschke, K. (2002) Loading of nitrate into the
xylem: apoplastic nitrate controls the voltage dependence of X-QUAC, the main anion
conductance in xylem-parenchyma cells of barley root. Plant Journal., 30, 133-142.
Kwak, J.M., Mori, I.C., Pei, Z.M., Leonhardt, N., Torres, M.A., Dangl, J.L., Bloom,
R.E., Bodde, S., Jones, J.D. and Schroeder, J.I. (2003) NADPH oxidase AtrbohD and
Atrbohf genes function in ROS-dependent ABA signalling in Arabidopsis. EMBO J. 22,
2623-2633.
Lanfermeijer, F.C. , Staal, M., Malinowski, R., Stratmann, J.W., Elzenga, J.T.M. (2008)
Micro-Electrode Flux Estimation Confirms that the Solanum pimpinellifolium cu3 Mutant
Still Responds to Systemin. Plant Physiol., 146, 129-139.
Larsson, E.H., Bornman, J.F. and Asp, H. (1998) Influence of UV-B radiation and Cd on
chlorophyll fluorescence, growth and nutrient content in Brassica napus. J. Exp. Bot. 323,
1031-1039.
Le, J., Vandenbussche, F., Van Der Straeten, D. and Verbelen, J.P. (2001) In the early
response of Arabidopsis root to ethylene, cell elongation is up and down regulated and
uncoupled from differentiation. Plant Physiology. 125, 519-522.
Leonhardt, N., Kwak, J.M., Robert, N., Waner, D., Leonhardt, G. and Schroeder, J.I.
(2004) Microarray expression analyses of Arabidopsis guard cells and isolation of a
recessive abscisic acid hypersensitive protein phosphatase 2C mutant. Plant Cell, 16, 596615.
Leonhardt, N., Vavasseure, C. and Forestier, C. (1999) ATP binding cassette modulators
control abscisic acid regulated slow anion channels in guard cells. Plant Cell., 11, 11411152.
Lewis, B.D., Karlin-Neumann, G., Davis, R.W. and Spalding, E.P. (1997) Ca2+ -activated
anion channels and membrane depolarizations induced by blue light and cold in
Arabidopsis seedlings. Plant Physiology, 114, 1327-1334.
Li, J., Yang, H., Peer, W.A., Richter, G., Blakeslee, J., Bandyopadhyay, A.,
Titapiwantakun, B., Undurraga, S., Khodakovskaya, M., Richards, E.L., Krizek, B.,
Murphy, A.S., Gilroy, S. and Gaxiola, R. (2005) Arabidopsis H+-Ppase AVP1 regulates
auxin-mediated organ development. Science., 310, 121-125.
Lisal, J and Maduke, M (2008) The ClC-0 chloride channel is a 'broken' Cl-/H+ antiporter.
Nat Struct Mol Biol, . 15, 805-810.
Lorenzen, I. Aberle, T. and Plieth, C. (2004) Salt stress-induced chloride flux: a study using
transgenic Arabidopsis expressing a fluorescent anion prob. Plant Journal. 38, 539-544.
References
Lou, M., Garay, R. and Alda, J.O. (1991) Cadmium uptake through the anion exchanger in
human red blood cells. J. Physiology, 443, 123-136.
Lu, Y.P., Li, S.Z.and Rea, P.A. (1997) AtMRP1 gene of Arabidopsis encodes a glutathione
S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette
transporter gene. Proc. Natl. Acad. Sci. USA., 94, 8243-8248.
Luan, S. (2008) The CBL-CIPK network in plant calcium signalling. Trends in Plant
Science, 14, 37-42.
Lurine, C. Geelen, D. Barbier-Brygoo, H. Guern, J. and Maurel, C. (1996) Cloning and
functional expression of plant voltage-dependent chloride channel. The Plant Cell. 8, 701711.
Lv, Q.D. Tang,R.J. Liu, H. Gao, X.S. Li, Y.Z. Zheng, H.Q. and Zhang, H.X. (2009)
Cloning and molecular analyses of the Arabidopsis thaliana chloride channel gene family.
Plant Science. 176, 650-661.
Lynch, J. (1995) Root architecture and plant productivity. Plant physiology 109, 7-13
Maathuis, F.J. and Sanders, D. (1994) Mechanism of high-affinity potassium uptake in
roots of Arabidopsis thaliana.Cell Biology., 91, 9272-9276.
Maclennan, H., Beevers, H. and Harley, J.L. (1963) Compartmentation of acid in plant
tissues. Biochem. Journal., 89, 316-327.
Malayev, A. and Nelson, D.J. (1995) Extracellular pH modulates the Ca+2 current activated
by depletion of intracellular Ca+2 stores in human macrophages. Journal Membrane
Biology., 146, 101-111.
Malik, D., Sheoran, I. and Singh, R. (1992) Carbon metabolism in leaves of cadmium
treated wheat seedling. Plant Physiology. Biochem, 30, 223-229.
Marigo, G., Bouyssou, H.and Belkoura, M. (1985) Vacuolar efflux of malat and its
influence on nitrate accumulation in Catharanthus roseus cell. Plant Science., 29, 193-213.
Marmagne, A., Vinauger-Douard, M., Monachello, D., De Longevialle, A.F., Charon, C.,
Allot, M., Rappaport, F., Wollman, F.A., Barbier-Brygoo, H. and Ephritikhine, G.
(2007) Two members of the Arabidopsis CLC (chloride channel) family, AtCLCe and
AtCLCf, are associated with thylakoid and Golgi membranes, respectively. Journal of
Experimental Botany, 14, 1-9.
Mazess, R. and Barden, H. (1991) Bone density in premenopausal women; effect of age,
dietary intake, physical activity, smoking and birth control pills. Am.J. Clin. Nutr, 53, 132142.
McQueen-Mason, S., Durachko, D.M. and Cosgrove, D.J. (1992) Two endogenous
proteins that induce cell wall extension in plants. Plant Cell. 4, 1425-1433.
Meyer, S., Savaresi, S., Forster, I.G. and Dutzler, R. (2007) Nucleotide recognition by the
cytoplasmic domain of the human chloride transporter ClC-5. Nat. Struct. Mol. Biol., 14,
60-67.
Meyer, S., Savaresi, S., Forster, I.G. and Dutzler, R. (2007) Nucleotide recognition by the
cytoplasmic domain of the human chloride transporter ClC-5. Nat. Struct. Mol. Biol., 14,
60-67.
Miller, A.J.and Smith,S.J. (1996) Nitrate transport and compartmentation in cereal root
cells. Journal of Expriental Botany. 47, 843-845.
Miller, C. (2006) ClC chloride channels viewed through a transporter lens. Nature., 440, 484488.
Mindell, J.A. (2008) The chloride channel’s appendix. Nature Structural & Molecular
Biology 15, 781-783.
Mitsuda, N., Enami, k., Nakata, M., Takeyasu, K. and Sato, M.H. (2001) Novel type
Arabidopsis thaliana H+-PPase is localized to the Golgi apparatus. FEBS Lett., 488, 29-35.
Moreno, I., Norambuena, L., Maturana, D., Toro, M., Vergara, C., Orellana, A., ZuritaSilva, A. and Ordenes, V.R. (2008) AtHMA1 is a thapsigargin sensitive Ca2+/ heavy
metal pump. American Society for Biochemistry and Molecular Biology, 1-21.
Murata, Y., Pei, Z.M., Mori, I.C. and Schroeder, J.I. (2001) Abscisic acid activation of
plasma membrane Ca2+ channels in guard cells requires cytosolic NAD(P)H and is
101
References
differentially disrupted upstream and downstream of reactive oxygen species production in
abi1-1 and abi2-1 protein phosphates 2C mutants. Plant Cell, 13, 2513-2523.
Nelson, M.T. (1986) Interactions of divalent cations with single calcium channels from rat
brain synaptasomes. J. Gen. Physiol, 87, 201-222.
Newman, I. A. (2001) Ion transport in roots: measurement of fluxes using ion-selective
microelectrodes to characterise transporter function. Plant, Cell &
Nguitragool, W and Miller, C. (2006) Uncoupling of a ClC Cl−/H+ exchange transporter by
polyatomic anions. Journal of Molecular Biology, 362, 682-690
Nuhse, T.S., Peck, S.C., Hirt, H. and Boller, T. (2000) Microbial elicitors induce activation
and dual phosphorylation of the Arabidopsis thaliana MAPK 6. Journal of Biological
Chemistry., 275, 7521-7526.
Nurnberger, T., Nennstiel, D., Jabs, T., Sacks, W.R., Hahlbrock, K. and Scheel, D.
(1994) High affinity binding of fungal oligopeptide elicitor to parsley plasma membranes
triggers multiple defense resposes. Cell., 78, 449-460.
O’Neill, R.A. and Scott, T.K. (1983) Proton flux and elongation in primary roots of barley
(Hordeum vulgar L.). Plant Physiology., 73, 199-201.
O’Neill,R.A. and Scott,T.K. (1983) Proton flux and elongation in primary roots of barley
(Hordeum vulgar L.). Plant Physiology., 73, 199-201.
Orlowski, J. and Grinstein, S. (1997) Na+/H+ exchangers of mammalian cells. J. Biol.
Chem., 272, 22373-22376.
Østergaard, L.and Yanofsky, M.F. (2004) Establishing gene function by mutagenesis in
Arabidopsis thaliana. The Plant Journal., 39, 682-696.
Pandey, S., Zhang, W. and Assmann, S.M. (2007) Roles of ion channels and transporters in
guard cell signal transduction .FEBS Letters., 581, 2325-2336.
Park, S., Rancour, D.M. and Bednare, S.Y (2008) In planta analysis of the cell cycledependent localization of AtCDC48A and Its critical roles in cell division, expansion, and
differentiation. Plant Physiology 148, 246-258.
Patrick, J.W. and Offler, C.E. (2001) Compartmentation of transport and transfer events in
doveloping seeds. J. Exp. Bot., 52, 551-564.
Pei, Z.M., Kuchitsu, K., Ward, J.M., Schwarz, M. and Schroeder, J.I. (1997) Differential
abscisic acid regulation of guard cell anion channels in Arabidopsis wild-type and abi1 and
abi2 mutants. Plant Cell., 9, 409-423. .
Perlin, D.S. Kasamo, K. Brookers, R.J. and Slayman, C.W. (1984) Electrogenic H+
translocation by the plasma membrane ATPase of Neurospora. Journal of Biological
Chemistry. 259, 7884-7892.
Peters, W.S. and Felle, H.H. (1999) The correlation of profiles of surface pH and elongation
growth in maize roots. Plant Physiology., 121, 905-912.
Picollo, A. and Pusch, M. (2005) Chloride/proton antiporter activity of mammalian ClC
proteins ClC-4 and ClC-5. Nature., 436, 420-423.
Pilet, P.E., Versel, J.M. and Mayor, G. (1983) Growth distribution and surface pH patterns
along the maize roots. Planta. 158, 398-402.
Pineros, M.A., Shaff, J.E. and Kochian, L.V. (1998) Development, characterization, and
application of a cadmium-selective microelectrode for the measurement of cadmium fluxes
in roots of Thlaspi species and wheat. Plant physiology. 116, 1393-1401.
Pinto, A.P., Mota, A.M., De Varennes, A. and Pinto, F.C. (2004) Influence of organic
matter on the uptake of Cd, Zinc, copper and iron by sorghum plant. Sci Tot Environ, 326,
239-274.
Plan, P.J., Gelli, A. and Blumwald, E. (1994) Vacuolar chloride regulation of an anionselective tonoplast channel. The Journal of Membrane Biology., 140, 1-12.
Purdy, M.D., Wiener, M.C. (2000) Expression, purificatio, and initial structural
characterization of YadQ, a bacterial homolog of mammalian ClC chloride channel
proteins. FEBS Lett., 466, 26-28.
Pusch, M. Ludewig, U. Rehfeldt, A. and Jentsch, T.J. (1995) Gating of the voltagedependent chloride channel ClC-0 by the permeant anion. Nature. 327, 527-531
References
Putnam, R. (1998) Intracellular pH regulation. In N Sperelakis, ed, Cell physiology Source
Book. Academic Press, San Diego, 293-305.
Qi, Z., Kishigami, A., Nakagawa, Y., Iida, H. and Sokabe, M. (2004) A mechanosensitive
anion channel in Arabidopsis thaliana mesophyll cells. Plant Cell Physiology., 45, 17041708.
Rayle, D. and Cleland, R.E. (1970) Enhancement of wall loosening and elongation by acid
solution. Plant Physiology. 46, 250-253.
Rayle, D. and Cleland, R.E. (1992) The acid growth theory of auxin-induced cell elongation
is alive and well. Plant physiology. 99, 1271-1274.
Rea, P.A., Li, Z.S., Lu, Y.P, Drozdowicz, Y.M. and Martinoia, E. (1998) From vacuole
GS-X pumps to multispecific ABC transporters. Annu. Rev. Plant Physiology. Plant Mol.
Biol., 49, 727-760.
Rivetta, A., Negrini, N. and Cocucci, M. (1997) Involvement of Ca2+ -calmodulin in Cd2+
toxicity during the early phases of radish (Raphanus sativus L.) seed germination. Plant
Cell Environ, 20, 600-608.
Rodriguez-Serrano, M., Romerro-Puertas, M.C., Pazmino, D.M., Testillano, P.S.,
Risueno, M.C., Del-Rio, L.A. and Sandalio, L.M. (2009) Cellular response of pea plants
to cadmium toxicity: cross-talk between reactive oxygen species, nitric oxide and calcium.
Plant Physiology Preview, 108, 1-37.
Romero, J.M., Maronon, T. and Murillo. (1994) Long term responses of Melilotus
segatalis to salinity. П Nutrient absorption and utilization. Plant Cell Environment., 17,
1249-1255.
Romero-Aranda, R., Moya, J.L., Tadeo, F.R., Legaz, F., Primo-Millo, E, and Talon,
M.(1998) Physiological and anatomical disturbances induced by chloride salt in sensitive
and tolerant citrus: beneficial and detrimental effects of cations. Plant Cell and
Environment, 21, 1243-1253.
Rubio, F., Gassmann, W. and Schroeder JI. (1995) Sodium-driven potassium uptake by the
plant potassium transporter HKT1 and mutations conferring salt tolerance.
Science.270,1660–1663.
Ryan, J.A., Pahren, H.R, and Lucas, J.B. (1982) Controlling cadmium in the human food
chain: a review and rationale based on health effects. Environ. Res, 28, 251-302.
Salinas, T., Duchene, A.M., Delage, L., Nilsson, S., Glaser, E., Zaepfel, M. and
Marechal-Drouard, L. (2006) The voltage-dependent anion channel, a major component
of the tRNA import machinery in plant mitochondria. Plant Biology., 103, 18362-18367.
Salt, D.E. and Wagner, G.J. (1993) Cadmium transport across tonoplast of vesicles from oat
root. Evidence for a Cd2+/ H+ antiport activity, J. Biol. Chem, 17, 12297-12302.
Sanchez-Fernandez, R., Aldiles-Diaz, W., Van Montagu, M., Inze, D. and May, M.J.
(1998) Cloning and expression analyses of AtMRP4, a novel MRP-like gene from
Arabidopsis thaliana. Mol. Gen. Genet., 258, 655-662.
Sandalio, L.M., Dalurzo, H.C., Gomez, M., Romero-Puertas, M.C. and Del-Rio, L.A.
(2001) Cd-induced changes in the growth and oxidative metabolism of pea plants. J. Exp.
Bot, 52, 2115-2126.
Sanders, D., Brownlee, C. and Harper JF. Communicating with calcium. (1999) Plant
Cell.;11:691–706.
Sarafian, V., Kim, Y., Poole, R.J. and Rea, P.A. (1992) Molecular cloning and sequence of
cDNA encoding the pyrophosphate-energized vacuolar membrane proton pump of
Arabidopsis thaliana. Proc Natl Acad Sci U S A., 89, 1775-1779.
Sarath, G., Hou, G., Baird, L.M. and Mitchell, R.B. (2007) Reactive oxygen species, ABA
and nitric oxide interactions on the germination of warm season C4-grasses. Planta, 226,
697-708.
Sauer, M.R. (1968) Effects of vine rootstock on chloride concentration in Sultana scions.
Vitis., 7, 223-226.
Scheel, C., Zdebik, A.A., Lourdel, S. and Jentsch, T.J. (2005) Voltage-dependent
electrogenic chloride/proton exchange by endosomal CLC proteins. Nature. 436, 424-427.
103
References
Scherese, B., Benfey P. and Dolan L. (2002) Root development. The Arabidopsis book. 118.
Schiefelbein, J.W., Masucci, J.D., Wang, H. (1997) Building a root: the control of
patterning and morphogenesis during root development. Plant Cell. 9, 1089-1098.
Schmidt, C. and Schroeder,J.I. (1994) Anion selectivity of slow anion channels in the
plasma membrane of guard cells. Plant Physiology., 106, 383-391.
Schmidt-Rose, T.and Jentsch, T.J. (1997) Transmembrane topology of a ClC chloride
channel. Proc Natl Acad Sci USA., 94, 7633-7638.
Schroeder, J.I. (1995) Anion channels as central mechanisms for signal transduction in
guard-cells and putative functions in roots for plant-soil interactions. Plant Moecular
Biology., 28, 353-361.
Schroeder, J.I. and Hagiwara, S. (1989) Cytosolic calcium regulates ion channels in the
plasma membrane of Vicia faba gurd cells. Nature, 338, 427-430.
Schroeder, J.I. and Keller, B.U. (1992) Two types of anion channel currents in guard cells
with distinct voltage regulation. Proceedings of the National Academy of Sciences., 89,
5025-5029.
Schutzendubel, A., Schwanz, P., Teichmann, T., Gross, K., Langenfeld-Heyser, R.,
Godbold, D.L.and Polle, A. (2001) Cadmium-induced changes in antioxidative systems,
hydrogen peroxide content, and differentiation in Scots pine roots. Plant Physiology, 127,
887-898.
Scott,A.C. and Allen,N.S. (1999) Changes in Cytosolic pH within Arabidopsis root
Columella cells play a key role in the early signaling pathway for root gravitropism. Plant
Physiology.,121,1291-1298.
Segonzac, C. Boyer, J.C. Ipotesi, E. Szponarski, W. Tillard, P. Touraine, B. Sommerer,
N. Rossignol, M. and Gibrat, R. (2007) Nitrate efflux at the root plasma membrane:
identification of an Arabidopsis excretion transporter. The Plant Cell. 19, 3760-3777.
Serrano, R., Mulet, J.M., Rios, G., de Marquez, J.A., Larrinoa, I., Leube, M.P.,
Mendizabal, I., Pascual-Ahuir, A., Proft, M., Ros, R. and Montesinos, C. (1999)
Aglimpse of the mechanisms of ion homeostasis during salt stress. J. Exp. Bot., 50, 10231036.
Shabala , S, Shabala, L. and Van Volkenburgh, E.(2003) Effect of calcium on root
development and root ion fluxes in salinised barley seedlings. Funct Plant Biol., 30, 507514.
Shabala, L., Cuin, T.A. and Newman, I.A.(2005) Salinity-induced ion flux patterns from
the excised roots of Arabidopsis sos mutants.Planta., 222, 1041-1050.
Shabala, S.N. and Lew, R.R. (2002) Turgor Regulation in Osmotically Stressed Arabidopsis
Epidermal Root Cells. Direct Support for the Role of Inorganic Ion Uptake as Revealed by
Concurrent Flux and Cell Turgor Measurements. Plant Physiol, 129, 290-299.
Shabala, S.N. and Newman I.A. (1997) Proton and calcium flux oscillations in the
elongation region correlate with root nutation. Physiol Plant. 100, 917-926
Sheoran, I., Singal, H. and Singh, R. (1990) Effect of cadmium and nickel on
photosynthesis and the enzymes of the photosynthetic carbon reduction cycle in pigeon pea
(Cajanus cajan L.). Photosynthesis Research, 23, 345-351.
Showalter, A.M. (1993) Structure and function of plant cell wall proteins. Plant Cell. 5, 9-23.
Sidler, M., Hassa, P., Hassan, S., Ringli, C. and Dudler, R. (1998) Involvement of an ABC
transporter in a developmental pathway regulating hypocotyls cell elongation in the light.
Plant Cell. 10, 1632-1636.
Simons, T.J.B. (1986) The role of anion transport in the passive movement of lead across the
human red blood cell membrane. J. Physiology, 378, 287-312.
Sivaguru, M., Fujiwara, T., Samaj, J., Baluska, F., Yang, Z., Osawa, H., Maeda, T.,
Mori,T., Volkmann, D. and Matsumoto,H. (2000) Aluminium-induced 1-3-β-D-glcan
inhibits cell to cell trafficking of molecules through plasmodesmata. A new mechanism of
aluminium toxicity in plants. Plant Physiology. 124, 991-1005.
Spalding, E.P. (2000) Ion channels and the transduction of light signals. Plant, Cell,
Environment., 23, 665-674.
References
Staal, M., Elzenga, J.T.M., Van Elk, A.G., Prins, H.B.A. & Van Volkenburgh, E. (1994)
Red and blue light-stimulated proton efflux by epidermal leaf cells of the argenteum
mutant of Pisum sativum. J. Exp. Bot. 45: 1213-1218.
Stein, W.D. (1990) Channel, carriers and pumps, An introduction to membrane transport.
Academic press, San Diego
Storey, R., Schachtman,D.P. and Thomas, M.R. (2003) Root structure and cellular
chloride, sodium and potassium distribution in salinized grapevines. Plant, Cell &
Environment., 26, 789-800.
Stosh, S.J. and Bagchi, D. (1995) Oxidative mechanisms in the toxicity of metal ions. Free
Radic. Biol. Med, 18, 321-336.
Strompen, G., Dettmer, J., Stierhof, Y.D., Schumacher, K., Jurgens, G. and Mayer, U.
(2004) Arabidopsis vacuolar H+ -ATPase subunit E isoform 1 is required for Golgi
organization and vacuole function in embryogenesis. The Plant Journal., 41, 125-132.
Su, G.H., Magen, H., Tarchitzky, J. and Kafkafi, U. (2000) Advances in chloride nutrition
of plants. Advances in Agronomy., 68, 97-150.
Suh, S.J., Wang, Y.F., Frelet, A., Leonhardt, N., Klein, M., Forestier, C., MuellerRoeber,B., Cho, M.H., Martinoia, E. and Schroeder,J.I. (2007) The ATP Binding
Cassette Transporter AtMRP5 Modulates Anion and Calcium Channel Activities in
Arabidopsis Guard Cells. Cell death and differentiation.,. 282, 1916-1924.
Suru, S.M. (2008) Onion and garlic extracts lessen cadmium-induced nephrotoxicity in rats.
Biometals, 21, 623-633.
Suzuki, N. (2005) Alleviation by Calcium of Cd-induced root growth inhibition in
Arabidopsis seedling. Plant Biotechnolo, 22, 19-25.
Swanson, S.J. and Jones, R.L. (1996) Gibberellic acid induces vacuolar acidification in
barley aleuron. Plant Cell., 8, 2211-2221.
Swarup, R., Paula Perry, P., Hagenbeek, D., Der Straeten, D.V., Beemster, G.T.S.,
Sandberg, G., Bhalerao, R., Ljung, K. and Malcolm J. Bennett, M.J. (2007) Ethylene
upregulates auxin biosynthesis in Arabidopsis seedlings to enhance inhibition of root cell
elongation. The Plant Cell 19, 2186-2196.
Sze, H., Li, X. and Palmgren, M.G. (1999) Energization of plant cell membranes by H+ pumping ATPases: regulation and biosynthesis. The Plant Cell., 11, 677-689.
Tanner, W. and Caspari. (1996) Membrane transport carriers. Annu Rev. Plant physiology:
Plant Mol. Bio. 47, 595-627.
Tapper,H. and Sundler,R. (1995) Protein-Kinase-C and intracellular pH regulate zymosaninduced lysosomal-enzyme secretion in macrophages. Journal Leukocyte Biology., 58,485494.
Termat, A, and Munns, R. (1986) Use of concentrated macronutrient solutions to separate
osmotic from NaCl- specific effects on plant growth. Australian Journal of Plant
Physiology., 13, 509-522.
Thomine, S., Zimmermann, S., Guern, J. and Barbier-Brygoo, H. (1995) ATP-dependent
regulation of an anion channel at the plasma membrane of protoplasts from epidermal cells
of Arabidopsis hypocotyls. Plant Cell., 7, 2091-2100.
Tommasini, R., Vogt, E., Fromenteau, M., Hortensteiner, S., Matile, P., Amrhin, N. and
Martinoia, E. (1998) An ABC-transporter of Arabidopsis thaliana has both glutathioneconjugate and chlorophyll catabolite transport activity. Plant J. 13, 773-780.
Tretyn, A., Wagner, G. and Felle, H. (1991) signal transduction in Sinapis alba root hairs:
auxin as external messenger. Journal of Plant Physiology., 139, 187-193.
Trewavas, A. (1999) Le calcium, c'est la vie: calcium makes waves. Plant Physiol.,120,1–6.
Trouverie, J., Vidal, G., Zhang, Z., Sirichandra, C., Madiona, K., Amir Zahia, Prioul,
J.L., Jeannette, E., Rona, J.P. and Brault, M. (2008) Anion channel activation and
proton pumping inhibition involved in the plasma membrane depolarization induced by
ABA in Arabidopsis thaliana suspension cell are both ROS dependent. Plant Cell
Physiology. 49, 1495-1507.
105
References
Vahisalu, T., Kollist, H., Wang, Y.F., Nishimura,N., Chan, W.Y., Valerio,G.,
Lamminmäki,A., Brosché,M., Moldau,H., Desikan,R., SchroederJ.I & Kangasjärvi,J.
(2008) SLAC1 is required for plant guard cell S-type anion channel function in stomatal
signalling. Nature. 452, 487-491.
Van der Leij, M., Smith, S.J.and Miller, A.J. (1998) Remobilisation of vacuolar stored
nitrate in barley root cells. Planta., 205, 64-72.
Vara, F. and Serrano, R. (1982) Partial purification and properties of the protontranslocating ATPase of plant plasma membranes. Journal of Biological Chemistry. 257,
12826-12830.
Verbelen, J.P., Vissenberg, K., Kerstens, S. and Le, J. (2001) Cell expansion in the
epidermis: microtubules, cellulose orientation and wall loosening enzymes. J.of Plant
Physiology., 158, 537-543.
Vreeburg, R.A.M., Benschop, J.J., Peeters, A.J., Colmer, T.D., Ammerlaan, A.H., Staal,
M., Elzenga,J.T.M., Staals, R.H.J., Darley, C.P., McQueen-Mason SJ. and Voesenek,
L.A. (2005) Ethylene regulates fast apoplastic acidification and expansin A transcription
during submergence-induced petiole elongation in Rumex palustris. Plant J. 43, 597–610.
Wagner, L.H. and Raschke. (1994) Ion channels in the xylem parenchyma of barley roots.
A procedure to isolste protoplasts from this tissue and a patch clamp exploration of salt
passages into xylem vessels. Plant Physiology., 105, 799-813.
Ward, J.M., Pei, Z.M., Schroeder, J.I. (1995) Roles of ion channels in initiation of signal
transduction in higher plants. Plant Cell., 7, 833-844.
Wellhauser, L., Kuo, H.H., Stratford, F.L., Ramjeesingh, M., Huan, L.J., Luong, W., Li,
C., Deber, C.M. and Bear, C.E. (2006) Nucleotides bind to the C-terminus of ClC-5.
Biochem. J. 398, 289-294.
Wellhauser, L., Kuo, H.H., Stratford, F.L., Ramjeesingh, M., Huan, L.J., Luong, W., Li,
C., Deber, C.M. and Bear, C.E. (2006) Nucleotides bind to the C-terminus of ClC-5.
Biochem. J. 398, 289-294.
White, P.J. and Broadley, M.R. (2001) Chloride in soil and plants. Annuals of Botany., 967988.
Woll, K.H., Leibowitz, M.K., Neumcke, B. and Hill, B. (1987) A high-conductance anion
channel in adult amphibian skeletal muscle. European Journal of Physiology, 410, 632640.
Yamamoto, Y., Hachia, A., Hamada, H. and Matsumoto, H. (1998) Phenylpropanoids as a
protectant of aluminium toxicity in cultured tobacco cells. Plant Cell Physiology, 39, 950957.
Yin, J., Kuang, Z., Mahankali, U. and Beck, T.L. (2004) Ion transit pathways and gating in
ClC chloride channels. Proteins: Structure, Function, and Bioinformatics., 57, 414-421.
Zeiger, E., Bloom, AJ. and Hepler PK (1978) Ion transport in stomatal guard cells. A
chemiosmotic hypothesis. What's new. Plant Physiol., 9, 29-32.
Zepeda-Jazo, I., Shabala, S., Chen, Z. and Pottosin, I.I. (2008) Na+-K+ transport in roots
under salt stress. Plant Signal Behav. 3., 401–403.
Zhang, W.H., Walker, N.A., Patrick, J.W. and Tyerman, S.D. (2004) Pulsing Cl- channels
in coat cells of developing bean seeds linked to hypo-osmotic turgor regulation. J. Exp.
Bot., 55, 993-1001.
Zhu, J.K. (2002)Salt and drought stress signal transduction in plants. Annu. Rev. Plant
Biology., 53, 247-273.
Zhu, J.K., Liu, J. and Xiong, L. (1998) Genetic analysis of salt tolerance in Arabidopsis
thaliana: evidence of a critical role for potassium nutrition. Plant Cell., 10, 1181-1191.
Zimmermann, S., Ehrhardt, T., Plesch, G. and Muller-Rober, B. (1999) Ion channels in
plant signaling. Cell Mol Sci., 55, 183-203.
Zimmermann, S., Frachisse, J.M., Thomine, S., Barbier-Brygoo, H. and Guern, J. (1998)
Elicitor induced chloride influx and anion channels in tobacco cell suspensions. Plant
Physiology and Biochemistry., 36, 665-674.
SUMMARY
In higher plants anion channels, present in various tissues and cell types, play
importants roles in signaling pathways leading to the adaptation of plant cells to
abiotic and biotic stresses, in the control of metabolism, and in the maintenance of the
electrochemical gradients across membranes. One of the an protein families with
anion channel function, is the Chloride Channel (ClC) family. First characterized in
Torpedo marmorata, these proteins appear now to be ubiquitously present. Seven ClC
genes are identified in the Arabidopsis genome. The main aim of this research was to
physiologically characterize Arabidopis thaliana ClC proteins and to acquire
knowledge on the position of ClC proteins in the complex network of membrane
transport and solute fluxes. We used a reverse genetics approach with T-DNA knockout mutants of three of the 7 ClC-genes that are present in the genome of Arabidopsis
thaliana: AtClCa, AtClCb and AtClCd.
In chapter 1 we review the current state of the art on ClC transport proteins and
relate the knowledge obtained from bacterial and non-plant systems with the
Arabidopsis ClC proteins. Predictions and remarks, concerning function and
localization of plant ClC transporters, are made.
In chapter 2 the protocol of obtaining the three double mutants and the single
triple mutant that can be made with the three single knock-out mutants, is described.
The seven mutants are preliminary characterized by testing the effect of the mutation
on seed germination, vegetative growth and ion fluxes in root and leaf tissue as
measured by the Micro-Electrode Ion Flux Estimation (MIFE).
In chapter 3 the MIFE technique was expanded with a flow-through system
which allowed a controlled and gentle exchange of the measuring solution during an
experiment. Ion fluxes from Atclcd mutant plants, which lack the AtClCd protein,
were compared with those from wildtype plants. The results of these experiments
indicate that AtClCd functions as an anion/H+ antiporter and might be involved in the
accumulation of both Cl- and NO3- in the vacuole.
In chapter 4 a root growth phenotype is described for mutant plants in which
either AtClCa or AtClCd are knock-out by a T-DNA insertion. At pH 6.2 root growth
in those mutant plants is impaired, compared with wildtype and the Atclcb mutant
107
plants. We measured the proton fluxes along the root from root tip till the first root
hairs at different pH values. Additionally root growth was characterized and
quantified. A model for the interaction between endomembrane anion/H+ antiporters,
plasma membrane proton fluxes and cell expansion is discussed.
In chapter 5 we study the effect of heavy metal treatments on the 7 mutant plants
(single, double and triple mutants). No differences were observed between the root of
the mutants and wildtype for cadmium, zinc and lead. Cadmium toxicity could be
alleviated by increasing the external calcium concentration. This effect of high
external calcium is not observed in the plants lacking both AtClCa and AtClCd. The
double mutant Atclcad and the triple mutant Atclcabd therefore seem to be more
sensitive to cadmium toxicity. Based on these results a role of AtClCa and AtClCd in
cadmium detoxification is suggested and a mechanism is proposed.
In chapter 6 all our result are placed in the context of the earlier published
functions and localization of ClC transporter proteins. It is suggested that the main
role of the ClC proteins is to function as electrical short circuits, which plays an
important role in energizing the membranes. A role in NO3- and Cl- homeostasis
seems of minor importance. Another important issue is the intracellular localization of
these proteins. Knowledge on the whereabouts of these proteins in the cell has
important implications on their functions. Although the results, published in the
present literature are in agreement with the ideas of the function of the ClC proteins,
care must still be taken with the interpretation of the fluorescence data on the
localization of the ClC proteins. The published data seems to lack important controls.
SAMENVATTING
Anion-kanalen komen voor in praktisch alle cel- en weefseltypen van hogere
planten. Zij hebben verschillende, belangrijke functies: in signalerings-routes die
leiden tot aanpassing aan abiotische of biotische stress factoren, in het metabolisme en
in het handhaven van elektrochemische gradiënten over membranen. Eén van de
eiwitfamilies met een anion-kanaalfunctie is de Chloride Channel (ClC) familie. Het
eerste lid van deze familie werd gevonden in het elektrische orgaan van de
Gemarmerde Sidderrog (Torpedo marmorata), maar blijkt nu alom vertegenwoordigd
in dieren, planten en bacterien. In het genoom van de Zandraket (Arabidopsis
thaliana) zijn zeven ClC genen geïdentificeerd. Het doel van dit onderzoek was om de
ClC eiwitten in Arabidopsis fysiologisch te karakteriseren en om kennis te vergaren
omtrent de positie van ClC eiwitten in het complexe netwerk van membraantransport
en ionstromen. We hebben een ‘reverse genetics’ benadering gebruikt met T-DNA
knock-out mutanten van drie van de zeven ClC genen die aanwezig zijn in het
genoom van Arabidopsis: AtClCa, AtClCb en AtClCd.
In hoofdstuk 1 bespreken we de huidige stand van zaken omtrent de ClC
transporteiwitten en wordt de kennis vergaard uit bacteriële en niet-plant systemen
gerelateerd aan de ClC eiwitten in Arabidopsis. De mogelijke functies en de
lokalisatie van de ClC transporteiwitten in planten worden behandeld.
In hoofdstuk 2 wordt het protocol waarmee de drie dubbel-mutanten en de ene
drie-dubbel mutant verkregen kunnen worden uit de drie enkele knock-out mutanten
(AtClCa, AtClCb en AtClCd) beschreven. In een globale karakterisering werden de
effecten van de mutaties in deze zeven mutanten getest op de ontkieming en
vegetatieve groei. Verder werden de ionstromen in wortel- en bladweefsel bepaald
middels de Micro-Electrode Ion Flux Estimation (MIFE) techniek.
In hoofdstuk 3 werd de MIFE techniek uitgebreid met een zogeheten doorstroomsysteem waarmee de meetoplossing op een gecontroleerde en subtiele manier
uitgewisseld kon worden tijdens het experiment. Ionenstromen van Atclcd mutanten,
waarin het AtClCd eiwit ontbreekt, werden vergeleken met wildtype planten. De
resultaten van deze experimenten geven aan dat AtClCd functioneert als een anion/H+
109
antiporter en wellicht betrokken is bij de ophoping van zowel Cl- als NO3- in de
vacuole van plantencellen.
In hoofdstuk 4 wordt het fenotype van de wortel beschreven voor gemuteerde
planten waarin zowel AtClCa of AtClCd middels een T-DNA insertie zijn
uitgeschakeld. Bij een pH van 6.2 wordt wortelgroei bij deze mutanten geremd
vergeleken met het wildtype en de AtClCb mutant. We hebben de protonenstroom
langs de wortel, van het wortelmutsje tot de eerste wortelhaar, gemeten bij
verschillende pH waarden. Uit kwantificatie van verschillende aspecten van de
wortelgroei kan worden afgeleid dat de mutaties de strekkingsgroei van de cellen
beinvloeden. Een model voor de interactie tussen endomembraan anion/H+
antiporters, protonenstroom over het plasmamembraan en celexpansie worden
bediscussiëerd.
In hoofdstuk 5 behandelt het effect van blootstelling aan zware metalen in de
zeven mutanten (de enkele, dubbele en driedubbele mutanten). Er werden geen
verschillen waargenomen tussen de wortelgroei van de mutanten en het wildtype
behandeld met cadmium, zink en lood. Cadmium toxiciteit kon worden verminderd
door de externe calcium concentratie te verhogen. Dit effect van een verhoogde
externe calcium concentratie werd niet waargenomen in planten waarin zowel AtClCa
als AtClCd ontbreken. De dubbele mutant Atclcad and the triple mutant Atclcabd
lijken daardoor meer gevoelig te zijn voor cadmium. Gebaseerd op deze resultaten
wordt een rol van AtClCa en AtClCd in de detoxificatie van cadmium gesuggereerd
en een mechanisme wordt voorgesteld.
In hoofdstuk 6 worden al onze bevindingen geplaatst in de context van eerder
gepubliceerde functies en lokalisaties van de ClC transporteiwitten. Een belangrijke
rol van de ClC eiwitten is het kortsluiten van de elektrische component van de
protonenpomp in de tonoplast, waardoor deze de mogelijkheid krijgt om een sterk
gradiënt op te bouwen in de protonen concentratie aan weerzijde van de tonoplast.
Een rol in de NO3- en Cl- homeostase van de cel lijkt van minder groot belang. Kennis
over de de intracellulaire lokalisatie van deze eiwitten in de cel heeft belangrijke
implicaties voor hun functies. De ideeën die in dit proefschrift over de functies van de
ClC eiwitten worden beschreven, zijn grotendeels in overeenstemming met de
resultaten die al eerder gepubliceerd zijn. Echter, voor wat betreft de lokalisatie van
deze eiwitten lijkt dat niet het geval. De studies waarin transporteiwitten worden
geassocieerd aan een specifieke membraan in de cel zijn tot nu toe niet adequaat
uitgevoerd. Definitieve conclusies zullen pas kunnen worden getrokken wanneer bij
lokalisatie studies de controle of artefacten serieus plaatsvindt en wanneer ze worden
gecombineerd met fysiologische metingen aan de betrokken membranen.
111
‫ﭼﮑﻴﺪﻩ‬
‫در ﮔﻴﺎهﺎن ﻋﺎﻟﯽ‪ ،‬ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮ در ﺑﺨﺸﻬﺎﯼ ﻣﺨﺘﻠﻒ ﮔﻴﺎهﺎن وﻏﺸﺎ هﺎﯼ‬
‫ﻣﺨﺘﻠﻒ ﺳﻠﻮﻟﯽ دﻳﺪﻩ ﺷﺪﻩ اﺳﺖ‪ .‬اﻳﻦ ﭘﺮوﺗﺌﻴﻨﻬﺎ ﺑﺎ اﻳﻔﺎ ﻧﻘﺶ در ﭼﺮﺧﻪ ﺳﻠﻮﻟﯽ از ﻃﺮﻳﻖ ﮐﻨﺘﺮل‬
‫ﻣﺘﺎﺑﻮﻟﻴﺴﻢ ﺳﻠﻮﻟﯽ وﺣﻔﻆ ﺷﻴﺐ اﻟﮑﺘﺮوﺷﻴﻤﻴﺎﻳﯽ‪1‬اﻃﺮاف ﺳﻠﻮل ﺑﺎﻋﺚ ﺳﺎزﮔﺎرﯼ ﺳﻠﻮﻟﻬﺎﯼ ﮔﻴﺎهﯽ‬
‫ﺑﻪ اﺳﺘﺮﺳﻬﺎﯼ زﻧﺪﻩ‪ 2‬و ﻏﻴﺮزﻧﺪﻩ‪ 3‬ﻣﯽ ﮔﺮدﻧﺪ‪ .‬ﮐﻠﺮاﻳﺪ ﮐﺎﻧﺎﻟﻬﺎ‪ 4‬ﻳﮑﯽ از ﻣﻬﻤﺘﺮﻳﻦ ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ اﻳﻦ‬
‫ﺧﺎﻧﻮادﻩ ﺑﻪ ﺷﻤﺎرﻣﯽ روﻧﺪ ﮐﻪ دراﻧﺘﻘﺎل ﺁﻧﻴﻮن ﺑﻪ ﺳﻠﻮل ﻧﻘﺶ دارﻧﺪ‪.‬اوﻟﻴﻦ ﻣﻄﺎﻟﻌﺎت در اﻳﻦ‬
‫ﭘﺮوﺗﺌﻴﻨﻬﺎ ﺑﺮ روﯼ ﻧﻮﻋﯽ ﻣﺎهﯽ ) ﺗﺮﭘﺪﻣﺎرﻣﺮات‪ (5‬اﻧﺠﺎم ﮔﺮدﻳﺪ وﺑﺪﻧﺒﺎل ﺁن در ﺟﺎﻧﻮران وﮔﻴﺎهﺎن‬
‫ﺷﻨﺎﺳﺎﻳﯽ وﻣﻄﺎﻟﻌﻪ ﺷﺪ‪.‬‬
‫هﺪف اﺻﻠﯽ دراﻳﻦ ﺗﺤﻘﻴﻘﺎت‪ ،‬ﺑﺮرﺳﯽ وﻣﻄﺎﻟﻌﻪ ﻣﻮﻟﮑﻮﻟﯽ وﻓﻴﺰﻳﻮﻟﻮژﻳﮑﯽ ﺁﻧﻴﻮن ﮐﺎﻧﺎﻟﻬﺎ در‬
‫ﮔﻴﺎﻩ ﻣﺪل ژﻧﺘﻴﮑﯽ ﺁراﺑﻴﺪﺑﺴﻴﺲ‪ 6‬وﻧﻘﺶ ﺁﻧﻬﺎ درﺷﺒﮑﻪ اﻧﺘﻘﺎل ﻳﻮﻧﻬﺎ وﻣﻮاد دراﻃﺮاف ﺳﻠﻮل ﺗﻌﺮﻳﻒ‬
‫ﮔﺮدﻳﺪ‪ .‬دراﻳﻦ ﺗﺤﻘﻴﻘﺎت از روش ژﻧﺘﻴﮏ ﻣﻌﮑﻮس‪ 7‬وﺑﺎ اﺳﺘﻔﺎدﻩ از اﻧﺘﻘﺎل دﯼ ان اﯼ ﺑﺎﮐﺘﺮﯼ‪ 8‬ﺑﻪ‬
‫‪10‬‬
‫داﺧﻞ ژﻧﻮم ﮔﻴﺎﻩ ﻣﻴﺰﺑﺎن‪ ،‬درﮔﻴﺎهﺎن ﺟﻬﺶ‪ 9‬اﻳﺠﺎد ﮔﺮدﻳﺪ‪ .‬ﺳﭙﺲ ﺑﺎ اﺳﺘﻔﺎدﻩ ازﮔﻴﺎهﺎن ﺟﻬﺶ ﻳﺎﻓﺘﻪ‬
‫ﮐﻪ ﻓﺎﻗﺪ ژﻧﻬﺎﯼ ﻣﻮردﻧﻈﺮﺑﻮدن‪ ،‬ﻧﻘﺶ اﻳﻦ ژﻧﻬﺎ در ﭼﺮﺧﻪ ﺳﻠﻮﻟﯽ ﺑﺮرﺳﯽ ﺷﺪ‪.‬‬
‫ﻓﺼﻞ اول‪ -‬ﺑﺎ ﻣﺮورﯼ ﺑﺮ اﻧﻮاع ﺗﺮاﻧﺴﭙﻮرﺗﺮهﺎ درﻏﺸﺎئ ﺳﻠﻮﻟﯽ‪ ،‬ﺳﺎﺧﺘﻤﺎن ﮐﺮﻳﺴﺘﺎﻟﯽ‬
‫وﻣﻮﻟﮑﻮﻟﯽ ﺗﻮام ﺑﺎ ﮐﺎرﮐﺮد ﭘﺮوﺗﺌﻴﻨﻬﺎ ﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮﯼ در ﺑﺎﮐﺘﺮﻳﻬﺎ وﺟﺎﻧﻮران ﻣﻮرد‬
‫ﻣﻄﺎﻟﻌﻪ و ﺑﺮرﺳﯽ ﻗﺮار ﮔﺮﻓﺖ‪ .‬ﺑﺮاﺳﺎس اﻳﻦ ﻣﻄﺎﻟﻌﺎت ﺑﺮﺧﯽ از وﻇﺎﻳﻒ ‪ ،‬ﻣﺤﻞ ﻗﺮار ﮔﻴﺮﯼ اﻳﻦ‬
‫ﭘﺮوﺗﺌﻴﻨﻬﺎ در ﮔﻴﺎهﺎن وﺗﻘﺴﻴﻢ ﺑﻨﺪﯼ ﮔﻴﺎهﺎن ﺑﺮاﺳﺎس ﺳﺎﺧﺘﻤﺎن ﻣﻮﻟﮑﻮﻟﯽ ﺁﻧﻬﺎ ﭘﻴﺶ ﺑﻴﻨﯽ‪ 11‬ﮔﺮدﻳﺪ‪.‬‬
‫ﻓﺼﻞ دوم‪ -‬ﺟﻬﺖ ﺑﺮرﺳﯽ وﻇﺎﻳﻒ ﺑﺮﺧﯽ از ﺗﺮاﻧﺴﭙﻮرﺗﺮهﺎﯼ ﺁﻧﻴﻮﻧﯽ در ﮔﻴﺎهﺎن از ﻃﺮﻳﻖ‬
‫ژﻧﺘﻴﮏ ﻣﻌﮑﻮس اﺑﺘﺪا ﮔﻴﺎهﺎن ﺳﻴﻨﮕﻞ‪ ،12‬دﺑﻞ‪13‬و ﺗﺮﯼ ﭘﻞ‪ 14‬ﻣﻴﻮﺗﻦ اﻳﺠﺎد ﮔﺮدﻳﺪ‪ .‬ﺳﭙﺲ ﺁزﻣﺎﻳﺸﺎﺗﯽ‬
‫در راﺑﻄﻪ ﺑﺎ اﺛﺮ ﻓﻘﺪان اﻳﻦ ژﻧﻬﺎ درﮔﻴﺎهﺎن ﺟﻬﺶ ﻳﺎﻓﺘﻪ ﺑﺮ روﯼ ذﺧﻴﺮﻩ ﺁﻧﻴﻮﻧﻬﺎ درﮔﻴﺎهﺎن ‪ ،‬ﺟﻮاﻧﻪ‬
‫زﻧﯽ ﺑﺬر‪ ،‬ﻣﺮاﺣﻞ ﻣﺨﺘﻠﻒ رﺷﺪﯼ ﮔﻴﺎﻩ وﺟﺮﻳﺎن اﻧﺘﻘﺎل ﻳﻮﻧﻬﺎ دراﻃﺮاف ﺳﻠﻮﻟﻬﺎﯼ رﻳﺸﻪ وﺑﺮگ ﺑﺎ‬
‫اﺳﺘﻔﺎدﻩ ازﺑﺮﺧﯽ اﻧﺪازﻩ ﮔﻴﺮﻳﻬﺎﯼ ﻣﻴﮑﺮواﻟﮑﺘﺮودﯼ ﻧﻈﻴﺮ دﺳﺘﮕﺎﻩ ﻣﺎﻳﻒ‪15‬ﻣﻮرد ﻣﻄﺎﻟﻌﻪ ﻗﺮار‬
‫ﮔﺮﻓﺖ‪.‬‬
‫ﻓﺼﻞ ﺳﻮم‪ -‬ﺑﺎ اﻧﺠﺎم ﺁزﻣﺎﻳﺸﺎت اﻟﮑﺘﺮوﻓﻴﺰﻳﻮﻟﻮژﻳﮑﯽ ﺑﺮ روﯼ ﻳﮑﯽ ازژﻧﻬﺎﯼ ﻣﻬﻢ از ﺁﻧﻴﻮن‬
‫ﮐﺎﻧﺎﻟﻬﺎ در ﺁراﺑﻴﺪﺑﺴﻴﺲ ‪،‬ﺑﻪ ﻧﺎم ﭘﺮوﺗﺌﻴﻦ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮ دﯼ‪16‬وﺑﺎ ﺗﻐﻴﻴﺮ و ﺗﺤﻮل در ﺳﻴﺘﻢ ﺛﺎﺑﺖ‬
‫اﻧﺪازﻩ ﮔﻴﺮﯼ ﻳﻮﻧﻬﺎ دراﻃﺮاف ﺳﻠﻮل ﮔﻴﺎهﯽ ﺑﻪ ﺳﻴﺘﻢ درﺣﺎل ﮔﺮدش ﻣﺤﻠﻮل دراﻃﺮاف ﺳﻠﻮل‪،‬‬
‫ﺑﺮﺧﯽ ازﮐﺎرﮐﺮدهﺎﯼ اﻳﻦ ﭘﺮوﺗﺌﻴﻦ درﺳﻠﻮل ﮔﻴﺎهﯽ ﻣﺸﺨﺺ ﮔﺮدﻳﺪ‪.‬ﺑﻪ ﻃﻮرﻳﮑﻪ ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ ﺁﻧﻴﻮن‬
‫ﮐﺎﻧﺎل دﯼ در ﮔﻴﺎﻩ ﺁراﺑﻴﺪﺑﺴﻴﺲ ﺑﻪ ﻋﻨﻮان ﻳﮏ ﺁﻧﺘﯽ ﭘﺮﺗﺮ‪ 17‬ﺟﻬﺖ ﺗﺒﺎدل ﺁﻧﻴﻮن ﺑﺎ ﭘﺮوﺗﻮن ﻣﻌﺮﻓﯽ‬
‫ﮔﺮدﻳﺪ ﮐﻪ در ذﺧﻴﺮﻩ ﻳﻮﻧﻬﺎﯼ ﮐﻠﺮاﻳﺪ وﻧﻴﺘﺮات در واﮐﻮﺋﻞ ﺳﻠﻮﻟﯽ ﻣﺸﺎرﮐﺖ ﻣﯽ ﮐﻨﺪ‪.‬‬
‫ﻓﺼﻞ ﭼﻬﺎرم‪ -‬ﺟﻬﺖ ﻣﻄﺎﻟﻌﻪ اﺛﺮ ﻣﺘﻘﺎﺑﻞ ﺁﻧﺘﯽ ﭘﺮﺗﺮهﺎ )ﺁﻧﻴﻮن‪ /‬ﭘﺮوﺗﻮن ( درﻏﺸﺎهﺎﯼ داﺧﻠﯽ ﺳﻠﻮل‬
‫وﭘﻤﭙﻬﺎﯼ ﭘﺮوﺗﻮﻧﯽ درﻏﺸﺎئ ﺳﻠﻮﻟﯽ ﺑﺎ اﻓﺰاﻳﺶ اﻧﺪازﻩ ﺳﻠﻮﻟﯽ‪ ،‬ورود وﺧﺮوج ﭘﺮوﺗﻮﻧﻬﺎ ﺑﻪ ﺳﻠﻮل‬
‫در ﻗﺴﻤﺘﻬﺎﯼ ﻣﺨﺘﻠﻒ رﻳﺸﻪ ﮔﻴﺎهﺎن ﺟﻬﺶ ﻳﺎﻓﺘﻪ وﮔﻴﺎهﺎن ﺷﺎهﺪ‪18‬اﻧﺪازﻩ ﮔﻴﺮﯼ ﺷﺪ‪.‬‬
‫ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ ازاﻳﻦ ﺁزﻣﺎﻳﺸﺎت ﻣﻨﺠﺮﺑﻪ اراﺋﻪ اﻟﮕﻮﯼ ﺟﺪﻳﺪﯼ درراﺑﻄﻪ ﺑﺎ اﺛﺮات ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ ﺁﻧﻴﻮن‬
‫ﺗﺮاﻧﺴﭙﻮرﺗﺮﯼ ﺑﺮﺗﻐﻴﻴﺮات ﺣﺠﻢ ﺳﻠﻮل ﮔﺮدﻳﺪ‪.‬‬
‫ﻓﺼﻞ ﭘﻨﺠﻢ‪ -‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﻧﺘﺎﻳﺞ اﺧﻴﺮارﺗﺒﺎط ﺁﻧﻴﻮن ﮐﺎﻧﺎﻟﻬﺎ ﺑﺎ ﻓﻠﺰات ﺳﻨﮕﻴﻦ‪19‬در ﺟﺎﻧﻮران‪ ،‬اﺛﺮ‬
‫ﺑﺮﺧﯽ ﻓﻠﺰات ﺳﻨﮕﻴﻦ ﻧﻈﻴﺮ ﮐﺎدﻣﻴﻢ‪ ،‬روﯼ وﺳﺮب ﺑﺮ روﯼ ﮔﻴﺎهﺎن ﻓﺎﻗﺪ ﺑﺮﺧﯽ از ژﻧﻬﺎ ﯼ ﺁﻧﻴﻮن‬
‫ﮐﺎﻧﺎﻟﯽ ﻣﻮرد ارزﻳﺎﺑﯽ ﻗﺮار ﮔﺮﻓﺖ ‪.‬ازﻣﻴﺎن ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ ازﺁن‪ ،‬ﻣﻬﻤﺘﺮﻳﻦ ﻧﺘﺎﻳﺞ ﺷﺎﻣﻞ‪:‬‬
‫اﺳ ﺘﻔﺎدﻩ از ﮐﻠ ﺴﻴﻢ ﺑ ﺴﺘﻪ ﺑ ﻪ ﻣﻴ ﺰان ﻏﻠﻈ ﺖ ﺁن ﺳ ﺒﺐ ﮐ ﺎهﺶ اﺛ ﺮات ﺳ ﻤﯽ ﺣﺎﺻ ﻞ از ﮐ ﺎدﻣﻴﻢ در‬
‫ﺳﻠﻮل ﮔﻴﺎﻩ ﻣﯽ ﮔﺮدد ﺗﺎﺣﺪﯼ ﮐﻪ از ﮐﺎهﺶ رﺷﺪ رﻳﺸﻪ ﺟﻠﻮﮔﻴﺮﯼ وﻳﺎ ﺟﺒﺮان ﻣﯽ ﮐﻨﺪ‪.‬‬
‫از ﻣﻴ ﺎن ژﻧﻬ ﺎﯼ ﻣﺨﺘﻠ ﻒ ﺁﻧﻴ ﻮن ﮐﺎﻧﺎﻟﻬ ﺎ ‪ ،‬ژﻧﻬ ﺎﯼ اﯼ‪ 20‬ودﯼ ﻧ ﺴﺒﺖ ﺑ ﻪ دﻳﮕﺮژﻧﻬ ﺎ در ﭼﺮﺧ ﻪ‬
‫اﺛﺮات ﮐﺎدﻣﻴﻢ ﺑﻴﺸﺘﺮﻳﻦ ﻧﻘﺶ را اﻳﻔﺎ ﻣﯽ ﮐﻨﻨﺪ‪ .‬ﺑﻪ ﻃﻮرﻳﮑﻪ ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ از ﺳ ﻤﻴﺖ زداﻳ ﯽ ﮐﻠ ﺴﻴﻢ‬
‫ﺑﺮﺳ ﻤﻴﺖ ﮐ ﺎدﻣﻴﻤﯽ در ﮔﻴﺎه ﺎن ﺟﻬ ﺶ ﻳﺎﻓﺘ ﻪ دﺑ ﻞ ﻣﻴ ﻮﺗﻦ اﯼ دﯼ‪21‬و ﺗﺮﻳﭙ ﻞ ﻣﻴ ﻮﺗﻦ اﯼ ﺑ ﯽ‬
‫دﯼ‪22‬ﻧﺴﺒﺖ ﺑﻪ دﻳﮕﺮ ﮔﻴﺎهﺎن ﺟﻬﺶ ﻳﺎﻓﺘﻪ وﮔﻴﺎهﺎن ﺷﺎهﺪ‪ ،‬اﺧ ﺘﻼف ﻣﻌﻨ ﯽ دارﯼ ﻧ ﺸﺎن داد‪ .‬ﺑﻨ ﺎﺑﺮا‬
‫ﻳ ﻦ ﺑﺮﺧ ﯽ ازوﻇ ﺎﻳﻒ اﻳ ﻦ دو ژن در ﭼﺮﺧ ﻪ ﺳ ﻤﻴﺖ زداﻳ ﯽ ﮐ ﺎدﻣﻴﻢ در ﺳ ﻠﻮل ﮔﻴ ﺎهﯽ ﻣ ﺸﺨﺺ‬
‫ﮔﺮدﻳﺪ‪.‬‬
‫ﻓﺼﻞ ﺷﺸﻢ‪ -‬ﺑﺎ ﺟﻤﻊ ﺑﻨﺪﯼ ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ از ﻓﺼﻮل ﻗﺒﻠﯽ‪ ،‬ﻧﺘﺎﻳﺞ ﻧﻬﺎﻳﯽ در راﺑﻄﻪ ﺑﺎ وﻇﺎﻳﻒ‬
‫وﻣﺤﻞ ﻗﺮارﮔﻴﺮﯼ ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮﯼ اراﺋﻪ ﮔﺮدﻳﺪ‪ .‬ﺑﻪ ﻃﻮرﻳﮑﻪ ﭘﻴﺸﻨﻬﺎد ﮔﺮدﻳﺪ‬
‫ﮐﻪ ﻧﻘﺶ اﻳﻦ ﭘﺮوﺗﺌﻴﻨﻬﺎ در اﻳﺠﺎد اﻧﺮژﯼ ﭘﺘﺎﻧﺴﻴﻞ ﻣﻮرد ﻧﻴﺎز در اﻃﺮاف ﺳﻠﻮل ﻧﺴﺒﺖ ﺑﻪ اﻧﺘﻘﺎل‬
‫ﻳﻮﻧﻬﺎﯼ ﻧﻴﺘﺮات وﮐﻠﺮاﻳﺪ در ﺳﻠﻮل ﻣﻬﻤﺘﺮ اﺳﺖ‪ .‬هﻤﭽﻨﻴﻦ اﻳﻦ ﭘﺮوﺗﺌﻴﻦ هﺎ در ﻏﺸﺎ هﺎﯼ داﺧﻠﯽ‬
‫ﺳﻠﻮل درﻣﻘﺎﻳﺴﻪ ﺑﺎ ﻏﺸﺎئ ﭘﻼﺳﻤﺎﺋﺊ ﻧﻘﺶ ﻣﻮﺛﺮﺗﺮﯼ اﻳﻔﺎ ﻣﯽ ﮐﻨﻨﺪ‪.‬‬
‫‪1- Electrochemical gradients‬‬
‫‪2- Biotic stress‬‬
‫‪3- Abiotic stress‬‬
‫)‪4- Chloride Channel(ClC‬‬
‫‪5- Torpedo marmorata‬‬
‫‪6- Arabidopsis thaliana‬‬
‫‪7- Reverse genetics‬‬
‫‪8- T-DNA‬‬
‫‪9- Mutation‬‬
‫‪10- Mutant‬‬
‫‪11- Predictions‬‬
‫‪12- Single mutant‬‬
‫‪13- Double mutant‬‬
‫‪14- Triple mutant‬‬
‫)‪15- Micro-Electrode Ion Flux Estimation (MIFE‬‬
‫‪16- AtClCd‬‬
‫‪17- Anti porter‬‬
‫‪18- Wildtype‬‬
‫‪19-Heavy metal‬‬
‫‪20- AtClCa‬‬
‫‪21- Atclcad‬‬
‫‪22- Atclcabd‬‬
‫‪113‬‬
ACKNOWLEDGEMENTS
First and above all, I praise God, the almighty for providing me this opportunity
and granting me the capability to proceed successfully. This thesis appears in its
current form due to the assistance and guidance of several people. I would therefore
like to offer my sincere thanks to all of them.
Theo Elzenga, my esteemed promoter, my cordial thanks for accepting me as a Ph.D
student, your warm encouragement, thoughtful guidance, critical comments, and
correction of the thesis.
I want to express my deep thanks to my esteemed copromotor Frank Lanfermeijer
for the trust, the insightful discussion, offering valuable advice, for your support
during the whole period of the study, and especially for your patience and guidance
during the writing process.
I would like to thank the members of the reading committee, Prof. dr. Jacques Hille,
Prof. dr.Bert van Duijn and Prof. dr. Sergey Shabala for their excellent advises and
detailed review during the preparation of this thesis.
I thank Ger, for his advices and his friendly assistance with various problems all the
time, especially for his help with the paperwork, translation of many Dutch letters and
his help outside the lab.
Mohamed and Fatma, I greatly appreciate your excellent assistance and your
spiritual supports for me and my family during my PhD study. I will never forget the
time that we were together and discussed about religion and politics. Mohamed, I am
pleased that you accepted to be my paranymf.
Wouter, Thank you for translating the summary into Dutch and you accepting to be
my paranymph.
Marten, thanks for your excellent technical assistance in the Lab, particularly for
MIFE technique, and your kindly answers to my general questions.
I am grateful to the secretary Jannie, for assisting me in many different ways and
handling the paperwork.
Thanks also to all the members of plant physiology, Luit, Ineke , Marten, Cordula,
Fatma, Jan Henk, Hamid , Wouter, Jacquline, Ika, Muhammad, Aleksandra,
Desiree, Ana, Bep, and Freek, for providing a good atmosphere in our department
and for useful discussions.
My roommates, Jacquline and Ika, thank you very much for making the atmosphere
of our room as friendly as possible.
Jacques, Paul, Marcel, Bert, Reza, Ijaz, Eelco, Kamran, Sujeeth, and Jos, thank
you for allowing me to use your facilities at the department of Molecular Biology and
for useful suggestions.
I also appreciate the financial support of the Iranian Ministry of Science, Research
and Technology, during my Ph.D study, particularly Abdollahi and Nazemi as the
scientific representatives of the Iranian government in the Schengen countries.
Thanks to all my close friends and Iranian community of Ph.D student and their
esteemed families, Abdollah bigi, Eslami, Najafi, Ramzani, Ryazi, Sohani and
Shyrzadian for the joyful gatherings and all their supports.
Els Prins, Although we have lived far from our relatives, but communication with
you, provided emotional atmosphere for us. Hereby, I would like to thank you for
everything.
I cannot finish without thanking my family.
.
I warmly thank and appreciate my parents and my mother and father-in-law for
their material and spiritual support in all aspects of my life.
I also would like to thank my brothers, sister, and brothers and sisters-in-law, for
they have provided assistance in numerous ways.
I want to express my gratitude and deepest appreciation to my lovely sweet daughter,
Narges, for her great patience and understandings and for being a nice Muslim girl.
And finally, I know that you did not want to be named, a person that moved with me
to the Netherlands and she lost her job because of it, My lovely wife, Dear Farveh,
without your supports and encouragements, I could not have finished this work, it was
you who kept the fundamental of our family, and I understand it was difficult for you,
therefore, I can just say thanks for everything and may Allah give you all the best in
return.
Hossein Moradi
September 2009, Groningen, the Nederlands
115
‫اﺳﺎﺗﻴﺪ راهﻨﻤﺎ ‪:‬‬
‫ﭘﺮوﻓﺴﻮر دﮐﺘﺮ ﺗﺌﻮ اﻟﺰﻧﮕﺎ‬
‫دﮐﺘﺮ ﻓﺮاﻧﮏ ﻻﻧﻔﺮﻣﺎﻳﺮ‬
‫ﮐﻤﻴﺘﻪ داوران‪:‬‬
‫ﭘﺮوﻓﺴﻮر دﮐﺘﺮ ژاﮐﻮس هﻴﻠﻪ‬
‫ﭘﺮوﻓﺴﻮر دﮐﺘﺮ ﺳﺮﺟﯽ ﺷﺎﺑﺎﻻ‬
‫ﭘﺮوﻓﺴﻮر دﮐﺘﺮ ﺑﺮت وان دوﺋﻦ‬
‫ﭘﮋوهﺸﻬﺎﯼ ﻣﻨﺪرج در اﻳﻦ رﺳﺎﻟﻪ ﺑﺎ ﺣﻤﺎﻳﺖ ﻣﺎﻟﯽ وزارت ﻋﻠﻮم‪،‬ﺗﺤﻘﻴﻘﺎت و‬
‫ﻓﻨﺎورﯼ ﺟﻤﻬﻮرﯼ اﺳﻼﻣﯽ اﻳﺮان در دﭘﺎرﺗﻤﺎن ﻓﻴﺰﻳﻮﻟﻮژﯼ ﮔﻴﺎهﯽ ودﭘﺎرﺗﻤﺎن‬
‫زﻳﺴﺖ ﻣﻮﻟﮑﻮﻟﯽ ﮔﻴﺎهﯽ داﻧﺸﮕﺎﻩ ﮔﺮوﻧﻴﻨﮕﻦ هﻠﻨﺪ‪،‬اﻧﺠﺎم ﺷﺪﻩ اﺳﺖ‪.‬‬
‫‪117‬‬
‫داﻧﺸﮕﺎﻩ ﮔﺮوﻧﻴﻨﮕﻦ هﻠﻨﺪ‬
‫داﻧﺸﮑﺪﻩ رﻳﺎﺿﻴﺎت وﻋﻠﻮم زﻳﺴﺘﯽ‬
‫رﺳﺎﻟﻪ دﮐﺘﺮﯼ در ﻋﻠﻮم زﻳﺴﺘﯽ‬
‫ﺗﺤﺖ ﻋﻨﻮان‬
‫ﻣﻄﺎﻟﻌﻪ ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮ‬
‫ﺑﺮرﺳﯽ ﮐﺎرﮐﺮدهﺎﯼ ﻣﻴﻮﺗﻨﻬﺎﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮﯼ در ﺁراﺑﻴﺪﺑﺴﻴﺲ‬
‫در ﺟﻠﺴﻪ دﻓﺎﻋﻴﻪ ﻣﻮرخ‬
‫دوﺷﻨﺒﻪ ‪ 30‬ﺷﻬﺮﻳﻮر ‪1388‬‬
‫ﺳﺎﻋﺖ ‪11‬‬
‫ﺣﺴﻴﻦ ﻣﺮادﯼ‬
119