Download Cloning/Hybridization Paper

Cloning/Hybridization Paper
You will write a full paper due on the last day of classes which should include the sections listed below (to be
completed individually). The following sections should be included:
Title
Abstract
Introduction*
Results
Discussion
Literature Cited (minimum of 1 published primary literature source)
* Materials and Methods (M&M) section normally follows the introduction; however you will not need to write
the M&M section for this paper.
The structure is similar to other papers you’ve written in Biology with the addition of the abstract. Your paper
will only cover the cloning and expression pattern of the gene that you chose in the lab, either eve or twist not
both. Your goal is to determine how the gene is expressed over time in early stage embryos (0-4 hrs old) in the
w1118 wildtype strain and the mutant embryo’s eve1/CyO and twi1/CyO (assuming the staining of these strains
worked).
Your target audience is a student at another college who has just finished a genetics class. You do not have to
explain how common techniques work in a generic fashion, for example the polymerase chain reaction (PCR),
but you do want to include to what specific purpose they were used and what you were expecting to see for your
specific experiment. Use the appropriate details of the procedure as you explain how the cloning and ISH was
designed so that the reader can understand and interpret your figures.
Abstract- I recommend writing this section last. It is literally a summary of each section (Introduction.
Materials and Methods, Results, Discussion) written in about 250 words or less. In general, if you summarize
each section in about 1-2 sentences apiece this will come out to the right length. Be specific - include details.
This section is often the only part of your paper that someone will read when deciding if your work will provide
the information they need so it’s important to summarize your whole paper well.
Introduction- You will need to look up specific information about the gene and its resulting protein product in
order to give specific background that sets up the reason for and the relevance of your hypothesis. Keep in mind
that everything done in the cloning and ISH labs was performed ultimately to achieve that one goal and so you
should only have one hypothesis. Carefully consider the information you provide in your introduction. Do not
merely summarize all the information in the handouts for this section and do not provide the specific
experimental details of the procedures performed. The focus should be on the biological topic being studied and
the background information (summary of results/conclusions found by other researchers) relevant to
understanding the hypothesis.
Results- I recommend that you break the Results into multiple sections, one section for each “result”
(figure/table) that you are presenting. Usually each section has its own title; look at the paper you were given
for class homework this week as an example. . Explain the design of each specific experiment so that the reader
understands what (and why) they are looking at in your figure/table. Be sure to tell the reader what you expect
to see based on the design of the experiment and identify/explain your controls. Don’t forget the legend for your
figure/table. If you showed just your figure/table and legend to one of your Biology professors, is there enough
information provided for them to understand what they are looking at and interpret the figure/table correctly?
There should be…
The techniques that you have performed include drosophila genomic DNA isolation, PCR, restriction enzyme
digestion, ligation, bacterial transformation, gel electrophoresis, plasmid isolation (mini prep), and in situ
hybridization (ISH). From this you produced two gels and some pictures of stained embryos. Your results
section should explain the experimental design of the whole experiment, spending more time on the techniques
that give you results which you can analyze and less time on techniques that were merely performed to get to
the next step. Remember that the “step by step” procedure followed to produce your results is given in the
Materials and Methods section which we are not asking you to write (M&M section provides the “how to” not
the “why”). Often, only certain procedural details are needed to explain why a technique or experiment worked
or was performed. Do not forget to talk about controls whenever appropriate. [Results from the controls are
often commented on and explained in the results section.]
Discussion- It helps to state your conclusion(s)/support for each figure/table shown one at a time and in the
same order presented in the Results section. Then explain how the different results and conclusions support
each other or tie in together. Be sure that you keep straight the conclusions that you have direct support for and
the implications that you draw from those conclusions. Focus your writing on the biological significance of the
technique(s) that you are performing, i.e. what information is being provided from the technique or experiment
and not on the technique itself. Develop your discussion so that it tells the reader something about the topic of
the paper, tying it back to the introduction. Compare your results to work done by other researchers- are the
results consistent with the work of others or not. Consider how another technique to look at transcriptional
regulation (that you have utilized previously in the lab) could be useful when combined with ISH. Finally,
develop a specific experiment based on your conclusion
As was explained in a previous handoutOn the lab web page, the ApE files for eve (full gene, accession number M14767) and twist (full gene,
accession number X12506) sequences are provided for you, the wildtype sequences corresponding to the
primers have been marked in uppercase in the file. The primers used for PCR are shown below, where the
nucleotides in lower case letters indicate bases that were altered from the wild-type sequence in order to
provide the new restriction enzyme site. This is how the RE sites were incorporated into the primers used for
PCR. You need to use the information that you have available to you to determine what you expect to see from
each of the cloning steps, and then determine whether or not you were successful by analyzing your results.
Remember, the ApE software is a free download, you can install it on your own computer rather than just use
the lab computers (http://biologylabs.utah.edu/jorgensen/wayned/ape/). When figuring out the sizes of plasmids
and fragments of DNA make sure you are using the same numbering system throughout, from the PCR product
to the recombinant plasmid to the PvuII digestion of the recombinant plasmid. Even if you do not get what you
expect, you should be able to draw conclusions (size, number of PvuII sites for instance) about what you
actually did get and what this may mean and how it may have happened.
eve:
5’ ATCCTCTGAATAAGCttACTTTG 3’ (5’ primer, includes HindIII site)
5’ CTTGGGCTCCGaAtTCACAGTTG 3’ (3’ primer, includes EcoRI site)
twi:
5’ AGCTACAAGCttACACTGCCCAA 3’ (5’ primer, includes HindIII site)
5’ CTCTGAATTCACACGATAGTTG 3’ (3’ primer, includes EcoRI site)
The following sites on the internet can provide useful background information:
http://flybase.bio.indiana.edu/allied-data/lk/interactive-fly/aimain/1aahome.htm
http://flymove.uni-muenster.de/
http://www.fruitfly.org/cgi-bin/ex/insitu.pl (ISH for twist -search for twi)