Download Short- and long-range functions of Goosecoid in

RESEARCH ARTICLE 1675
Development 136, 1675-1685 (2009) doi:10.1242/dev.031161
Short- and long-range functions of Goosecoid in zebrafish
axis formation are independent of Chordin, Noggin 1 and
Follistatin-like 1b
Monica Dixon Fox and Ashley E. E. Bruce*
The organizer is essential for dorsal-ventral (DV) patterning in vertebrates. Goosecoid (Gsc), a transcriptional repressor found in the
organizer, elicits partial secondary axes when expressed ventrally in Xenopus, similar to an organizer transplant. Although gsc is
expressed in all vertebrate organizers examined, knockout studies in mouse suggested that it is not required for DV patterning.
Moreover, experiments in Xenopus and zebrafish suggest a role in head formation, although a function in axial mesoderm
formation is less clear. To clarify the role of Gsc in vertebrate development, we used gain- and loss-of-function approaches in
zebrafish. Ventral injection of low doses of gsc produced incomplete secondary axes, which we propose results from short-range
repression of BMP signaling. Higher gsc doses resulted in complete secondary axes and long-range signaling, correlating with
repression of BMP and Wnt signals. In striking contrast to Xenopus, the BMP inhibitor Chordin (Chd) is not required for Gsc
function. Gsc produced complete secondary axes in chd null mutant embryos and gsc-morpholino knockdown in chd mutants
enhanced the mutant phenotype, suggesting that Gsc has Chd-independent functions in DV patterning. Even more striking was
that Gsc elicited complete secondary axes in the absence of three secreted BMP antagonists, Chd, Follistatin-like 1b and Noggin 1,
suggesting that Gsc functions in parallel with secreted BMP inhibitors. Our findings suggest that Gsc has dose dependent effects on
axis induction and provide new insights into molecularly distinct short- and long-range signaling activities of the organizer.
INTRODUCTION
Formation of the vertebrate body plan depends on the organizer.
Originally identified in amphibians (Spemann and Mangold, 1924)
and later in fish (Ho, 1992; Oppenheimer, 1934; Saúde et al., 2000;
Shih and Fraser, 1995), chick (Waddington, 1932) and mouse
(Beddington, 1994), transplantation of dorsal organizer tissue to
ventral regions of a host embryo leads to secondary axis formation.
Whereas the transplanted organizer contributes predominantly to
axial mesoderm, it also has the remarkable capacity to non cellautonomously re-specify host cells from their original fates and
recruit them to compose the remaining tissues of the secondary axis.
In zebrafish, the organizer/shield elicits a secondary axis when
transplanted ventrally (Saúde et al., 2000; Shih and Fraser, 1996).
By convention the shield marks dorsal but, because dorsal and
anterior development are linked, dorsal and anterior tissues arise
from the shield side of the embryo, whereas posterior and ventral
structures arise from non-shield regions (Schier and Talbot, 2005).
The shield contributes to axial mesoderm and makes smaller
contributions to paraxial mesoderm, ventral neural tissue, and skin
(Saúde et al., 2000; Shih and Fraser, 1995; Shih and Fraser, 1996).
In Xenopus and zebrafish, maternal Wnt signaling results in
nuclear accumulation of β-catenin on the presumptive dorsal side of
the embryo, where it activates expression of zygotic organizer genes.
Nodal signaling is also involved in initial organizer formation (Erter
et al., 1998; Feldman et al., 1998), whereas later in development
both Nodal and Wnt are inhibitory to organizer function.
Historically, the organizer was thought to express inducers of dorsal
Department of Cell and Systems Biology, University of Toronto, 25 Harbord Street,
Toronto, ON, M5S 3G5, Canada.
*Author for correspondence (e-mail: [email protected])
Accepted 10 March 2009
cell fates; however, it is now well established that a main function
of the organizer is to repress factors secreted from ventral regions of
the embryo (Niehrs, 2004).
Secreted ventralizing factors of the BMP, Wnt and Nodal families
function in gradients in the early embryo and organizer-derived
molecules attenuate the activity of these factors (Niehrs, 2004).
Ventrally expressed Wnt8 restricts the size of the zebrafish organizer
in the late blastula/early gastrula by regulating the expression of the
transcriptional repressors Vox and Vent, whereas BMP signaling is
required to maintain expression of these genes during late
gastrulation (Ramel et al., 2005; Ramel and Lekven, 2004). Thus,
Wnt and BMP act together to limit the organizer and to promote
ventral development.
A distinctive feature of the organizer is its ability to influence
distant cell fates as well as to generate axial tissues. Surprisingly,
investigation of the interrelationship between these short- and longrange organizer activities has not been a major research focus. It is
known that many genes implicated in organizer activity have highly
overlapping functions, making it difficult to determine the precise
roles that individual genes play. Here we investigate basic questions
about organizer activity, including: its short- and long-range
signaling functions, the extent to which they are linked and the
mechanisms underlying the redundancy of organizer gene activity.
We focused on the first organizer gene discovered, goosecoid
(gsc), which encodes a homeobox transcription factor (Blumberg et
al., 1991). gsc is expressed in all vertebrate organizers examined,
suggesting a fundamental role in organizer function (Blum et al.,
1992; Blumberg et al., 1991; Izpisua-Belmonte et al., 1993; SchulteMerker et al., 1994; Stachel et al., 1993). gsc has been most studied
in Xenopus, where gain-of-function experiments demonstrated that
Gsc induces secondary axes, similar to an organizer transplant (Cho
et al., 1991; Niehrs et al., 1993; Sander et al., 2007). However,
secondary axes were often incomplete, lacking head and notochord.
Loss-of-function experiments using dominant-negative and
DEVELOPMENT
KEY WORDS: Goosecoid, Chordin, Noggin, Follistatin-like, Axis formation, DV patterning, Zebrafish, Organizer
1676 RESEARCH ARTICLE
MATERIALS AND METHODS
Zebrafish
Wild-type AB and chordintt250 (chdtt250) embryos were obtained from the
Zebrafish International Resource Center (ZIRC, Eugene, OR, USA). Adult
chdtt250 were a gift from M. Mullins (University of Pennsylvania,
Philadelphia, PA, USA). Embryos obtained by natural spawning were staged
as described (Kimmel et al., 1995). Animals were treated in accordance with
the policies of the local animal care committee.
Constructs and morpholinos
gsc and follistatin-like 1b (fstl1b) ORFs were cloned from cDNA into pCS2+
(Rupp et al., 1994). mRNAs were transcribed using the SP6 mMESSAGE
mMACHINE Kit (Ambion, Austin, TX, USA). mRNAs from chordinpCS2+ and noggin1-pCS2+ (nog1-pCS2+) were prepared as described (DalPra et al., 2006; Miller-Bertoglio et al., 1997).
Morpholino (MO) sequences (5⬘ to 3⬘):
gsc-MO: CAAGCGAAAAGATGTGTGAGATTTG (Open Biosystems,
Huntsville, AL, USA) (Seiliez et al., 2006);
chd-MO: ATCCACAGCAGCCCCTCCATCATCC (Gene Tools,
Philomath, OR, USA);
nog1-MO: GCGGGAAATCCATCCTTTTGAAATC (Gene Tools) (DalPra et al., 2006);
fstl1b-MO:
CCATATTACAACTCACCTGGACTGG
(Open
Biosystems); and
standard control: CCTCTTACCTCAGTTACAATTTATA (Gene Tools).
gsc constructs
The gsc homeobox and 3⬘ sequence (codons 126 to 241) were cloned into
pVP16-N and pENG-N (Kessler, 1997) to generate VP16-gsc (VP-gscHD)
and engrailed-gsc (eng-gscHD), respectively. A Xenopus construct
consisting of the Xenopus gsc ORF with two minimal VP16 domains at the
C-terminus was a gift from J. Smith (Latinkic and Smith, 1999). To create a
zebrafish version (gsc-VP2), Xenopus gsc was removed and replaced with
the zebrafish gsc ORF.
Microinjections
Initial gsc microinjections were done double blind. Approximately 4 pl of
mRNA was injected into a single cell of 8-cell stage embryos as described
(Bruce et al., 2003). gsc mRNA (12, 24 or 48 pg) and chd mRNA (200, lower
concentrations had little effect, or 664 pg) were injected. gfp mRNA doses
ranged from 130 to 340 pg. gsc constructs were injected at the following
doses: 660 pg VP-gscHD, 24 pg eng-gscHD and 200-520 pg gsc-VP2. For
subthreshold experiments gsc was injected at 4 pg and gsc-VP2 at 100 pg.
Approximately 100 pl of gsc, chd, nog1, fstl1b, and control MOs were
injected into the yolk at the 1- to 2-cell stage. gsc-MO (330 pg) was injected
and nonspecific phenotypes, which were not rescued by coinjection of gsc
mRNA, included mild head necrosis and general developmental delay. The
presence of the MO target site was confirmed by PCR and sequencing. chdMO injected at 22 pg produced no phenotype and chd-MO injected at 100
pg ventralized embryos. nog1- and fstl1b-MOs (3 ng) were injected,
producing results as described (Dal-Pra et al., 2006). Dal-Pra et al. observed
a range of phenotypes falling into three phenotypic classes, whereas we
observed phenotypes that fell predominantly into one class. This is likely to
be due to the fact that we injected into the chd mutants, whereas Dal-Pra et
al. primarily employed chd-MO.
Morpholino rescue experiments
Xenopus chd mRNA (Sasai et al., 1994) was used to rescue the effects of the
chd-MO, as described (Nasevicius and Ekker, 2000). Other mRNAs were
generated from constructs that either did not contain the MO binding site
(gsc, fstl1b) or contained four silent mutations to prevent MO binding
(nog1).
Genotyping
Genotyping of embryos from chdtt250 heterozygous parents was performed
as described by Oelgeschläger (Oelgeschläger et al., 2003) and ZIRC.
Time-lapse
Shield stage embryos were mounted in 3% methylcellulose. Volocity
(Improvision, Lexington, MA, USA) was used to acquire DIC and
fluorescent images at 5-minute intervals.
In situ hybridization
In situ hybridizations were performed as described (Jowett and Lettice,
1994) using riboprobes to bmp2b and bmp4 (Martinez-Barbera et al., 1997),
chd (Miller-Bertoglio et al., 1997), dkk (Hashimoto et al., 2000), dlx2a
(Akimenko et al., 1994), flh (Talbot et al., 1995), shha (Krauss et al., 1993)
and wnt8 (Kelly et al., 1995).
DEVELOPMENT
antisense gsc constructs led to either head or head and notochord
reductions (Ferreiro et al., 1998; Steinbeisser et al., 1995; Yao and
Kessler, 2001). Results of gsc morpholino oligonucleotide injections
demonstrated that Gsc is required for head but not notochord
formation (Sander et al., 2007). In addition, Sander et al. suggested
that a major function of Gsc is to block the expression of the
ventralizing transcription factors Vent1/2. It has also been shown
that ectopic Gsc represses expression of the ventralizing factors
XWnt-8 and BMP4 (Christian and Moon, 1993; Fainsod et al., 1994;
Steinbeisser et al., 1995).
A gene that is activated by ectopic Gsc, presumably indirectly, is
the organizer gene chd, which encodes an extracellular inhibitor of
BMPs (Piccolo et al., 1996; Sasai et al., 1994). Xenopus Chd is an
essential downstream effector of Gsc function (Sander et al., 2007).
The Xenopus work suggests that Gsc plays an important role in
organizer function. In sharp contrast, targeted gsc knockout in
mouse had no effect on early DV patterning (Rivera-Perez et al.,
1995; Yamada et al., 1995). However, in heterotypic transplantation
experiments the neural-inducing properties of the mutant organizer
were impaired (Zhu et al., 1999). Technical issues might explain
some of the differences in the severity of these effects, whereas real
differences between species could stem from the known redundancy
in DV patterning mechanisms, which might vary between different
organisms. In either case, there are many unanswered questions that
warrant further investigation.
In zebrafish, gsc transcripts are present maternally, with zygotic
expression beginning at the midblastula transition in the region of
the future organizer (Schulte-Merker et al., 1994; Stachel et al.,
1993). Typically, embryos with mutations that disrupt the organizer
have little or no gsc expression and reduced dorsal structures
(Feldman et al., 1998; Gritsman et al., 1999; Kelly et al., 2000; Koos
and Ho, 1999; Nojima et al., 2004; Sampath et al., 1998; Schier et
al., 1997; Yamanaka et al., 1998), whereas gsc expression is
expanded in embryos dorsalized by lithium chloride treatment
(Stachel et al., 1993). Thus gsc transcript levels correlate with
organizer activity. In loss-of-function studies, injection of gsc
morpholinos cause head truncations in a small fraction of embryos
without affecting the notochord, whereas head defects occur at
higher frequency when morpholinos against gsc and foxa3 were
combined (Seiliez et al., 2006). As in Xenopus, ectopic zebrafish
Gsc represses wnt8 (Seiliez et al., 2006).
To investigate the molecular basis of organizer activity, we
examined Gsc function in zebrafish. Ventral injection of low doses
of gsc mRNA produced partial secondary axes that reflect a shortrange activity of the organizer, whereas higher doses led to complete
secondary axes, mimicking the long-range signaling activity of the
organizer. We propose that short-range signaling is accompanied by
BMP repression and long-range signaling by BMP and Wnt
repression. Surprisingly, Chd is not essential for Gsc function in
zebrafish, unlike in Xenopus. In fact, Gsc exhibited organizer
activity in the absence of three secreted BMP antagonists, suggesting
that Gsc functions in a parallel pathway to BMP inhibitors.
Development 136 (10)
goosecoid and DV patterning
RESEARCH ARTICLE 1677
Immunohistochemistry
Embryos were fixed, blocked and incubated in primary antibody as
described (Bruce et al., 2001). The peroxidase anti-peroxidase method was
used. Anti-Ntl antibody was diluted 1:5000 (Schulte-Merker et al., 1992),
goat anti-rabbit secondary antibodies and rabbit peroxidase anti-peroxidase
tertiary antibodies were diluted 1:100 and 1:500, respectively (Jackson
ImmunoResearch, West Grove, PA, USA).
Cell counts
Embryos between bud and 2-somite stages, stained with anti-Ntl antibody,
were flat-mounted and photographed on a Zeiss AxioImager Z1 compound
microscope using an Orca-ER camera (Hamamatsu, Bridgewater, NJ, USA).
Stained nuclei visible in each focal plane, excluding the tailbud, were traced
onto transparencies and counted.
Fig. 1. Ventral gsc overexpression induces complete secondary
axes. (A-I) Live zebrafish embryo injected with gfp (A-C) or gsc (D-I)
RNA. (A-F,H,I) DIC and fluorescence merge; (G) DIC. (A,D) Shield
(arrowhead), animal view. (B,F) Bud; arrowheads indicate notochord,
asterisk indicates prechordal plate. (C) 1 dpf, side view. (E) Bud; side
view, secondary prechordal plate (asterisk). (G-K) 1 dpf, dorsal view.
(J,K) dlx2a and shha (red). (J) gfp RNA injected. (K) gsc RNA injected
showing duplicated dlx2a expression (brackets): staining differs from
the control because the embryo had a ventral third eye. (L) Schematic
of injection procedure, clones in green; one clone was generated per
embryo. dien, diencephalon; e, eye; fp, floor plate; hg, hatching gland;
myo, myotomes; noto, notochord; tele, telencephalon.
in 36% (13/36) of cases, whereas in 58% (21/36) of cases the two
axes remained distinct, although they shared a single posterior trunk
and tail. Expression of the neural marker dlx2a (Akimenko et al.,
1994) was often normal in secondary axes, indicating the presence
of telencephalic and diencephalic tissue (Fig. 1J,K; see Table S4 in
the supplementary material). Therefore secondary axes were
essentially complete, containing notochord and anterior-most brain,
indicating that gsc overexpression mimicked an organizer transplant.
To determine whether Gsc has a role in organizer function
dorsally, where it is normally expressed, we examined embryos with
dorsal/dorsolateral gsc clones and observed the effect on DV
patterning. In controls (Fig. 2A), GFP was predominantly confined
to shield derivatives at bud and at 1 dpf (Fig. 2B-D), consistent with
previously described fate maps (Kimmel et al., 1990). The
distribution of dorsal/dorsolateral gsc clones was similar to controls
(Fig. 2E-H) and contrasted with results in Xenopus, in which dorsal
gsc-overexpressing cells were excluded from axial tissues (Niehrs
et al., 1993).
The single axes in gsc-injected embryos often had enlarged shield
derivatives, but thinner posterior trunks and tails, suggesting the
presence of excess dorsal/anterior tissue at the expense of
ventral/posterior tissues. For example, the notochord domain of an
embryo with a dorsolateral gsc clone was much larger than the
control (see Figs S2B and S2F in the supplementary material). To
quantify this observation, notochord nuclei were stained in late
gastrula stage embryos using the No tail (Ntl) antibody (SchulteMerker et al., 1992). There was a 40% increase in Ntl-positive nuclei
in embryos with dorsal, dorsolateral, or lateral gsc clones (Fig. 2I).
DEVELOPMENT
RESULTS
gsc-overexpressing cells populate organizer
derivatives
To examine the results of localized gsc overexpression, gfp mRNA
or gfp together with gsc mRNA was injected into one cell at the 8cell stage. Several doses were tested to determine the lowest dose
(24 pg) of gsc mRNA that consistently produced complete
secondary axes (see below). Because there is no direct correlation
between the position of a cell at the 8-cell stage and the location of
its descendants along the DV axis (Abdelilah et al., 1994; Helde et
al., 1994; Kimmel and Law, 1985; Kimmel and Warga, 1987), clone
location was documented relative to the shield and embryos were
sorted into dorsal, dorsolateral, lateral, ventral and ventrolateral
classes at 6 hours post-fertilization (hpf) (Fig. 1L). At 1 day postfertilization (dpf), sorted embryos were scored for GFP-expressing
cells in shield-derived structures: hatching gland, notochord, floor
plate of the spinal cord and hypochord (Saúde et al., 2000; Shih and
Fraser, 1995; Shih and Fraser, 1996). In striking contrast to gfp
control clones, every gsc clone labeled one or more shield
derivative, regardless of its initial location (see Table S1 in the
supplementary material). This occurred in two ways: gsc-expressing
cells contributed either to enlarged dorsal axial structures or to axial
structures in a secondary axis. Thus, gsc-overexpressing cells
populated tissues normally derived from the shield.
Analysis of ventral clones allowed us to examine Gsc function in
isolation from other organizer factors. gsc-injected embryos with
ventral/ventrolateral clones gave rise to secondary axes at high
frequency, whereas dorsal/dorsolateral gsc clones and gfp control
clones did not (see Table S2 in the supplementary material). As
expected, in controls with ventral clones (Fig. 1A), GFP-positive
cells were located posteriorly at the 1-somite stage and were absent
from axial mesoderm (Fig. 1B) and, at 1 dpf, GFP-positive cells
were located mainly in the myotomes of the trunk and tail (Fig. 1C).
By contrast, gsc-injected embryos with ventral clones (Fig. 1D)
often had two axes on opposite sides of an elongated yolk cell at bud
stage, one of which was GFP labeled (Fig. 1E). Elongated yolk
morphology is also seen with dorsalized embryos (Mullins et al.,
1996). GFP-positive cells populated axial tissues of the secondary
axis, including an apparent prechordal plate (Fig. 1E,F) and a
secondary notochord (Fig. 1F). Secondary axes did not always
contain notochord at bud stage (see Table S3 in the supplementary
material) although they did by 1 dpf.
Two distinct axes were often no longer apparent by 1 dpf, and
would have been missed if bud-stage embryos had not been
examined. At 1 dpf, the severely abnormal embryo contained a
broad head with two eyes (Fig. 1G) and a partially GFP-labeled
notochord (Fig. 1I), thus the two axes moved together between bud
and 1 dpf. When double axes were generated, they moved together
Development 136 (10)
The notochord was often shorter, but disproportionately wider, in
gsc-injected embryos (Fig. 2J), although by 1 dpf embryos were of
similar lengths as controls. Recruitment of more cells to the
notochord domain, compared with controls, suggested that
increasing the gsc dose dorsally enhanced organizer activity.
A representative embryo, with a ventrolateral gsc clone, contained
a secondary GFP-labeled notochord, whereas its associated
myotomes were unlabeled (Fig. 3A-C). In another embryo, neural
tissue of a secondary axis contained labeled and unlabeled cells (Fig.
3F-H). Unlabeled cells were morphologically normal and well
integrated into the tissue. Thus, just like an organizer transplant, gscoverexpressing cells recruited surrounding cells, causing them to
change their fate and participate in secondary axis formation. This
non cell-autonomous activity of Gsc is most likely to be indirect, as
Gsc is a transcription factor.
We used a molecular readout to measure the distance over which
Gsc exerts its non cell-autonomous effect by examining the
expression of the organizer gene chd in embryos with ventral gsc
clones. Double labeling of membrane GFP (to mark the clone) and
chd showed that ectopic chd was induced at a distance of up to ten
cell diameters away from the gsc clone (Fig. 3D). Signaling over
this large distance constitutes long-range signaling, as defined by
Chen and Schier for the zebrafish protein Nodal-related 1 (Chen
and Schier, 2001). Thus, Gsc exhibits long-range signaling activity
by a molecular criterion, which is probably responsible for the longrange organizer activity observed morphologically. Another
potential explanation is that dorsal chd-expressing cells migrated
towards the ventral gsc clone. We eliminated this possibility by
labeling the shield with Rhodamine Dextran in embryos with
ventral gsc clones and observing no movement of Rhodamine
positive cells towards ventral gsc clones in live embryos (not
shown).
We next asked whether gsc had dose dependent effects on axis
formation by injecting half the standard dose (12 pg). Partial
secondary axes were produced that lacked heads and notochords
and consisted only of neural and somitic tissue that was nearly
completely GFP labeled (Fig. 3I-K). Only a very few unlabeled
cells were recruited to the partial axis (Fig. 3K, insets), suggesting
that short-range signaling occurred. Examination of ectopic chd
expression in ventral gsc clones revealed that chd was primarily
confined to the clone itself and only extended at most one or two
cell diameters away (Fig. 3E). Thus, lower gsc doses acted
predominantly cell-autonomously and were unable to elicit longrange signaling.
gsc also had dose dependent effects on DV gene expression at
shield stage. At doses of gsc sufficient to induce complete secondary
axes, we observed a reduction in wnt8, bmp2b and bmp4 expression
and ectopic expression of the organizer genes chd, floating head (flh)
and dickkopf 1 (dkk1) (Fig. 3L-O; Table 1). In embryos injected with
a lower dose of gsc, chd was induced at similar frequencies but dkk1
(a Wnt signaling inhibitor) was induced only about half as often, and
the frequency of wnt8 inhibition was also moderately but
consistently reduced (Table 1). These results suggest that partial
secondary axes produced by low gsc doses might result from
inhibition of BMP signaling but insufficient inhibition of Wnt
signaling. In addition, we noticed that at the standard gsc dose, wnt8
was always repressed in a relatively small domain, whereas chd was
consistently induced in a large domain, that extended outside the gsc
clone. This spatial arrangement mimics what is normally seen in the
organizer, suggesting that Gsc is able to induce this organizer pattern
in a dose dependent fashion.
gsc overexpression has non cell-autonomous and
dose dependent effects on cell fate
The organizer is defined by its ability to re-specify and pattern
surrounding cells. Therefore, recruitment of unlabeled cells into
Gsc-induced secondary axes would demonstrate organizer activity.
gsc overexpression induces secondary axes in chd
null mutants
In Xenopus, Gsc function is mediated entirely by Chd (Sander et
al., 2007). To determine if Chd was required for Gsc function in
zebrafish, Gsc activity was examined in the absence of Chd by
Fig. 2. Dorsal gsc overexpression induces excess dorsal tissue.
(A-H) Merged images of live zebrafish embryo injected with gfp (A-D)
or gsc (E-H) RNA. (A,E) Shield (arrowhead). (B,F) Bud, arrowheads
indicate notochord. (C,D,G,H) 1 dpf. (I) Notochord cell counts with
standard deviations, five embryos per treatment. (J) Bud, anterior to the
top. Anti-Ntl staining is brown, injected RNA is listed in lower right.
hypo, hypochord; peri, periderm.
DEVELOPMENT
1678 RESEARCH ARTICLE
goosecoid and DV patterning
RESEARCH ARTICLE 1679
Fig. 3. gsc recruits unlabeled cells to secondary
axes. (A-K) Zebrafish embryos injected with gsc RNA.
(A-C) Lateral views, (A) bud; (B,C) 1 dpf. (D,E) Animal
views; (F-K) dorsal views, 1 dpf. (A,B,F,I) DIC; (G,J)
fluorescence; (C,H,K) merge. (A) Secondary notochord
with somites (arrowheads) at bud. (B,C) Myotomes
(arrowheads) with GFP-labeled notochord (dashed
lines). (D,E) Shield stage gsc RNA-injected embryos
stained for membrane-GFP (brown) and chd (purple),
with ectopic chd (arrowheads). (F-H) Secondary neural
tube with GFP-labeled (arrow) and unlabeled cells;
arrowhead marks anterior GFP limit. (I-K) Low gsc RNA
dose ventral clone produces partial secondary axis.
(K) Arrows indicate unlabeled cells in neural tissue
(right inset) and in myotomes (left inset). (L-O) Shield
(arrowheads). (L,N) gfp RNA injected; (M,N) gsc RNA
injected, with wnt8 (L,M) and chd (N,O) in situ probe.
nt, neural tissue.
overexpressing gsc in chdtt250 null mutant embryos (SchulteMerker et al., 1997). chdtt250 mutants have expanded ventral
tissues, most notably blood, blood island and tail fin and have
reduced anterior neural tissue, whereas gsc expression is normal
in most mutants (Fisher et al., 1997; Hammerschmidt et al., 1996;
Schulte-Merker et al., 1997). gsc was injected into one cell at the
8-cell stage and embryos were genotyped at the end of the
experiment. At the standard gsc dose (24 pg), the majority of
mutant embryos with ventral/ventrolateral clones (Fig. 4A)
contained partial secondary axes with neural and somitic tissue
but not notochord (Fig. 4D), similar to the overexpression of a low
dose of gsc in wild-type embryos. However, these axes
occasionally had well developed heads, separate from the
endogenous head (Fig. 4B). Interestingly, the endogenous head
was often more fully developed than in uninjected chd
mutants (Fig. 4B), suggesting that ventral gsc injection could
partially rescue the endogenous axis, indicative of a long-range
effect.
Strikingly, doubling the gsc concentration (48 pg) resulted in
complete secondary axes with GFP-labeled notochords (Fig. 4E-G).
Thus, in the absence of chd, a higher concentration of gsc was
needed to induce complete axes, suggesting that Chd facilitates, but
is not essential for, Gsc-induced axis formation.
chd and gsc overexpression are not equivalent
Since Chd facilitates the ability of Gsc to induce secondary axes,
we next addressed whether it was sufficient to induce complete
secondary axes by overexpressing chd ventrally. Global chd
overexpression in zebrafish dorsalizes embryos (Miller-Bertoglio
et al., 1997) however, localized overexpression was not
examined. To test the axis-forming ability of Chd in zebrafish,
200 pg of chd mRNA was injected into one cell at the 8-cell
stage. Ventral/ventrolateral chd clones generated partial
secondary axes that never contained head or notochord and that
merged with the endogenous axis posteriorly. Morphologically,
secondary axes contained neural tissue (Fig. 5C,D), most had
ectopic myotomes (Fig. 5E,F), some had beating cardiac tissue
(not shown) and ectopic or enlarged otic vesicles (Fig. 5G,H).
Notably, these partial axes resembled those induced by low gsc
doses. Chd did not induce ectopic Gsc (see Fig. S3 in the
supplementary material). dlx2a expression was not detected in
the secondary neural tube and flh and wnt8 expression were
normal at shield stage (not shown). Interestingly, secondary axes
were typically well separated from the primary axis, in contrast
to those seen following gsc overexpression. In addition, partial
secondary axes were nearly completely GFP labeled, suggesting
that Chd did not have long-range inductive effects.
Injected mRNA
gfp
gsc (24 pg) + gfp
gsc (12 pg) + gfp
wnt8
bmp2b
bmp4
chd
flh
dkk1
13/71 (18%)
reduced
19/30 (63%)
reduced
14/30 (47%)
reduced
2/24 (9%)
reduced
23/30 (77%)
reduced
n.d.
2/38 (5%)
reduced
24/38 (63%)
reduced
n.d.
2/46 (4%)
ectopic
78/80 (98%)
ectopic
88/93 (95%)
ectopic
0/60 ectopic
0/12 (uninjected)
ectopic
11/12 (92%) ectopic
54/62 (87%)
ectopic
n.d.
13/25 (52%) ectopic
Ventral markers appear less strongly affected than dorsal markers. This is likely to be a technical issue, as dorsal marker probes typically produced stronger signals than
ventral marker probes, making these embryos easier to score. n.d., not defined.
DEVELOPMENT
Table 1. DV markers at shield stage in gsc-injected embryos
1680 RESEARCH ARTICLE
Development 136 (10)
Fig. 4. gsc induces secondary axes in the absence of
Chd. (A-G) Live chdtt250 embryos injected ventrally with 24
pg (A-D) or 48 pg (E-G) gsc RNA. (A,C,E) Shield, dorsal to
the right. (B,D) 1 dpf, anterior to the top. (F,G) 1 dpf,
anterior to the left. (B) Secondary axis with head (2/7,
29%). (D) Secondary axis without notochord (5/7, 71%).
(F,G) Two notochords (arrows, 9/12, 75%). nt, neural
tissue.
gsc overexpression induces secondary axes in the
absence of three BMP inhibitors
The ability of Gsc to induce secondary axes in chd mutant embryos
could be explained by the presence of other, compensatory, BMP
inhibitors. The BMP inhibitors Noggin1 (Nog1) and Follistatin-like
1b (Fstl1b) were reported to be zygotically expressed and to function
redundantly with Chd (Dal-Pra et al., 2006; Fürthauer et al., 1999).
As shown previously, coinjection of nog1- and fstl1b-MOs into chd
mutant embryos enhances the mutant phenotype (see Fig. S3 in the
supplementary material) (Dal-Pra et al., 2006). mRNA rescue
experiments demonstrated morpholino specificity (see Fig. S4 in the
supplementary material). When gsc was injected ventrally into
embryos injected with nog1- and fstl1b-MOs, both partial (Fig. 5I,J)
and complete (Fig. 5K,L) secondary axes were observed. Therefore,
Gsc induced complete secondary axes when all known zygotic BMP
antagonists expressed in the early embryo were reduced or
eliminated. In addition, the head of the endogenous axis was
partially rescued in embryos with ventral gsc clones, further
demonstrating the ability of Gsc to trigger long-range effects (not
shown).
A caveat to these results is that the morpholino knockdowns might
have been incomplete. However, in wild-type embryos, ventral
overexpression of nog1 induced only partial secondary axes, lacking
notochords, whereas ventral overexpression of fstl1b had no effect
(not shown), similar to previous results in which these two genes
were globally overexpressed (Dal-Pra et al., 2006). Crucially, ventral
coinjection of chd, fstl1b and nog1 mRNAs in wild-type embryos
also induced only partial secondary axes (Fig. 5M,N). These data
indicate that Gsc can function in the absence of all three secreted
BMP inhibitors.
Distinct mechanisms underlie long- and shortrange signaling
We next addressed whether Gsc is normally involved in DV
patterning. No gsc mutant exists, and maternal gsc expression raises
the possibility that maternal protein is present. For these reasons, we
initially took a dominant-negative approach to block Gsc function.
Gsc is a transcriptional repressor in other systems (Danilov et al.,
Fig. 5. chd induces partial
secondary axes. (A-H) Live zebrafish
embryo injected with chd RNA. Shield
(A), 1 dpf (B-H). (B) Partial secondary
axis (arrow, 13/21, 62%). GFP-labeled
neural tissue (C,D) (13/13, 100%),
myotomes (E,F) (9/13, 69%) and
ectopic otic vesicle (G,H) (6/13, 46%).
Some injected embryos had beating
cardiac tissue (4/13, 31%). (I-L) Live
chdtt250 embryos injected ventrally with
48 pg gsc and nog1- and fstl1b-MOs.
(I,J) Partial GFP-labeled secondary axis
with neural (arrow) and somitic
(arrowheads) tissue. (K,L) Secondary
axis containing GFP-labeled notochord
and neural tissue (3/5, 60%). For an
example of an uninjected chd mutant
embryo see Fig. 7D. (M,N) Wild-type
embryo injected ventrally with chd,
fstl1b and nog1 mRNAs. Arrowhead
marks neural tissue. ov, otic vesicle.
DEVELOPMENT
Tripling the concentration of chd (664 pg) also produced partial
secondary axes (not shown). Therefore, no chd dose tested could
elicit a complete secondary axis. Thus, Chd neither had organizer
properties, nor did it generate axial mesoderm, the primary organizer
derivative.
1998; Ferreiro et al., 1998; Latinkic and Smith, 1999; Mailhos et al.,
1998; Smith and Jaynes, 1996). Therefore, we made two activator
constructs designed to antagonize endogenous Gsc function. VPgscHD contains the gsc homeodomain (HD) fused to the VP16
transcriptional activator (Kessler, 1997) and is predicted to bind to
and activate transcription of Gsc target genes. The second construct,
gsc-VP2, contains the entire gsc coding region plus two minimal
VP16 domains and, in Xenopus, the equivalent construct blocks Gsc
function by binding to Gsc target genes without activating their
transcription (Latinkic and Smith, 1999). Thus, gsc-VP2 should
produce a phenotype more akin to Gsc loss-of-function than VPgscHD. We also generated a repressor construct, consisting of the
gsc HD fused to the engrailed repressor domain (eng-gscHD)
(Kessler, 1997), that should mimic endogenous Gsc function.
Similar constructs were originally used in Xenopus (Kessler, 1997;
Latinkic and Smith, 1999) and our zebrafish versions performed as
expected in Xenopus embryos (see Fig. S5 in the supplementary
material and not shown).
Ventral injection of eng-gscHD (24 pg) into zebrafish often
produced complete secondary axes with GFP-positive cells located in
organizer derivatives (Fig. 6A,B), demonstrating that Gsc functions
as a transcriptional repressor in zebrafish. As predicted, ventral
injection of VP-gscHD had no effect, even at high doses (660 pg, not
shown). To test whether VP-gscHD could inhibit Gsc function, we
examined its ability to block secondary axis formation by Gsc and
found, surprisingly, that it could not (not shown). However, VPgscHD blocked eng-gscHD from eliciting complete secondary axes,
leading to partial axes instead (Fig. 6H,I). This suggested that VPgscHD could block the long-range organizer activity of eng-gscHD,
producing an effect similar to injection of a low gsc dose.
Unexpectedly, ventral injection of gsc-VP2, at a moderate dose
(200 pg) that was predicted to block Gsc function, occasionally
produced partial secondary axes that were almost completely
labeled by GFP (Fig. 6C,D). High concentrations (520 pg) also
produced partial secondary axes. Thus, complete axes could not
be induced at every dose tested, again mimicking the effect of low
dose gsc. An analysis of chd expression in gsc-VP2-injected
embryos revealed that ectopic chd was transiently induced,
presumably accounting for the infrequent partial secondary axes
observed (Fig. 6E-G and see Table S5 in the supplementary
material). Ectopic expression of Xenopus gsc-VP2 (Latinkic and
Smith, 1999) or dominant-negative Xenopus myc-tagged gsc
(Ferreiro et al., 1998) also occasionally produced partial
secondary axes in zebrafish (not shown). Significantly, we never
observed partial secondary axes in Xenopus using either the frog
or zebrafish constructs.
These findings suggest that constructs designed to block Gsc
function in Xenopus could partially mimic the short-range function
of Gsc in zebrafish. To confirm this, gsc was injected at a
subthreshold dose (4 pg). This gsc dose had no effect alone but
dorsalized embryos (6/7, 86%) when coinjected with a reduced dose
of gsc-VP2 (100 pg), suggesting a synergistic effect.
Gsc and endogenous dorsal specification
Since the dominant-negative constructs failed to fully block Gsc
function, we used gsc morpholinos instead (Seiliez et al., 2006). gscMO had mild ventralizing effects, as shown previously (Seiliez et
al., 2006). However, morphologically, most embryos appeared
normal (Fig. 7E). To further investigate the extent to which Gsc
requires Chd and to explore potential synergistic effects, we used a
fixed concentration of gsc-MO in combination with chdtt250 mutant
embryos and two different doses of chd-MO to generate embryos
RESEARCH ARTICLE 1681
Fig. 6. gsc elicits distinct short- and long-range signaling
activities. Injected construct is listed in lower left. (A-D,H,I) Live
embryos at 1 dpf. (A,B) Embryo with two notochords (arrows).
(C,D) Embryo with partial secondary axis, with neural (arrow) and
somitic (arrowheads) tissue. (E-G) Shield stage embryos stained for chd.
(E) Control; (F,G) gsc-VP2-injected embryos. Arrowheads indicate
ectopic chd. (H,I) Dorsalized embryo with partial secondary axis.
possessing no, low or intermediate levels of Chd (Nasevicius and
Ekker, 2000). Morpholino control experiments confirmed that the
effects were specific (see Fig. S4 in the supplementary material).
Firstly, gsc-MO was injected into chdtt250 mutants. gsc-MO
exacerbated the chdtt250 phenotype, leading to a more severe
reduction in head and notochord (Fig. 7D,H,L,P). Thus, endogenous
Gsc plays a role in DV patterning that is independent of Chd,
consistent with our overexpression results. We then examined the
effect of gsc-MO on embryos in which Chd levels were reduced,
using concentrations of chd-MO that produced either a less severe
phenotype than that of chdtt250 mutants (Fig. 7C) or no phenotype at
all (Fig. 7B). At both concentrations of chd-MO, coinjection of gscMO resulted in more severely ventralized embryos with further
reduced heads and enlarged ventral structures (compare Fig. 7F to
7B and Fig. 7G to 7C). Ntl antibody staining was used to examine
the notochord and in situ hybridization for dlx2a was used to
examine the anterior brain. Consistent with the increased
ventralization observed by external morphology, we found that
notochord and anterior neural structures were reduced when gscMO was added to chd-depleted embryos (Fig. 7I-P; Table 2 and not
shown).
Analysis of DV markers at shield stage revealed no obvious
changes in bmp2b, chd, or flh expression in gsc-MO injected
embryos. bmp2b and flh expression were normal in chd-MO and
double gsc-MO/chd-MO injected embryos (not shown). A slight
dorsal expansion of wnt8 in a small percentage of gsc-MO injected
DEVELOPMENT
goosecoid and DV patterning
1682 RESEARCH ARTICLE
Development 136 (10)
Fig. 7. gsc and chd morpholinos affect DV
patterning. Injected construct or genotype is
listed in lower right. (A-H) Live embryos, 1 dpf.
(I-P) Tails, 1 dpf; stained with anti-Ntl antibody,
anterior to the left. Arrowheads indicate thin
notochords, arrows indicate truncated
notochords. (Q-S) 60% epiboly embryos stained
for wnt8; arrowhead marks dorsal. (Q) Control.
(R) gsc-MO-injected embryo with ectopic wnt8
expression dorsally (11/81, 14%). (S) Ectopic
staining in embryo injected with gsc-MO and a
low concentration of chd-MO (46/106, 43%).
embryos (Fig. 7R) was detected, as observed previously (Seiliez et
al., 2006), whereas wnt8 was normal in chd-MO injected embryos
(not shown). By contrast, there was an obvious difference in the
expression of wnt8 in double morpholino injected embryos versus
control and single morpholino injected embryos. In almost half of
double morpholino injected embryos, wnt8 was ectopically
expressed dorsally in the shield and this expression was more robust
than in gsc morphants (Fig. 7S). Thus, reducing gsc and chd levels
resulted in a more than additive effect on wnt8 expression. This is
consistent with our overexpression experiments showing that a
higher gsc concentration was necessary to induce complete
secondary axes in the absence of chd, suggesting that they could
function cooperatively. Taken together, these results suggest a
synergistic interaction between Gsc and Chd and that these two
proteins operate in parallel pathways.
We showed that Gsc could induce complete secondary axes in chd
mutant embryos coinjected with fstl1b- and nog1-MOs, suggesting
that Gsc can function independently of these three BMP inhibitors.
Consistent with this finding, triple morpholino knockdown of gsc,
fstl1b and nog1 in chd mutant embryos produced a more severe
phenotype than the double knockdown of fstl1b and nog1 in chd
mutants (see Fig. S3 in the supplementary material). These results
suggest that Gsc functions independently of these three BMP
inhibitors.
DISCUSSION
When ectopically expressed, Gsc appears to establish dorsal fates by
dose dependently inhibiting the expression of ventralizing genes.
The data suggest that Gsc functions in parallel with Chd and other
BMP antagonists. Our results are summarized in a simple model
(Fig. 8), the key elements of which are discussed below.
Gsc and short-range signaling
The hallmark of the organizer is its ability, upon transplantation, to
pattern distant cells to form a secondary axis. Organizer function,
therefore, requires cell-cell signaling. Our studies suggest that Gsc
can trigger both short- and long-range signaling. Ventral injection of
low doses of gsc into wild-type embryos resulted in nearly
completely GFP-labeled partial secondary axes, containing neural
and somitic tissue. Labeled cells were located in tissues that never
Injected mRNA
Uninjected (n=111)
gsc-MO (n=81)
chd-MO-l (n=71)
gsc-MO + chd-MO-l (n=81)
chd-MO-h (n=47)
gsc-MO + chd-MO-h (n=37)
chdtt250 mutants (n=23)
gsc-MO + chdtt250 mutants (n=22)
Normal
111 (100%)
81 (100%)
71 (100%)
14 (17%)
2 (4%)
Thin posteriorly
Small gaps
posteriorly
50 (62%)
34 (72%)
17 (46%)
16 (70%)
9 (41%)
17 (21%)
6 (13%)
8 (22%)
5 (21%)
3 (14%)
chd-MO-l, low concentration of morpholino; chd-MO-h, high concentration of morpholino.
Large gaps
posteriorly
Absent
from tail
Absent
posterior to
yolk extension
Absent
7 (32%)
1 (4%)
5 (11%)
12 (32%)
2 (9%)
2 (9%)
DEVELOPMENT
Table 2. Notochord morphology assessed by anti-Ntl staining at 1 dpf
Fig. 8. Model of Gsc function. Gsc directly or indirectly inhibits wnt8
and bmp transcription at high doses, whereas low Gsc doses
predominantly inhibit bmp transcription. Gsc indirectly activates
expression of chd, the product of which acts together with Nog1 and
Fstl1b to inhibit the function of BMP proteins. See text for details.
normally express gsc, such as retina and muscle, suggesting that gsc
does not interfere with the differentiation of specific cell types nor
does it appear to directly induce them. The observed effect is mainly
cell-autonomous but not entirely, as a few unlabeled cells are
incorporated into the partial secondary axes. We suggest that the
short-range effects result from Gsc acting in cells to trigger
autocrine, short-range signaling and that only a few unlabeled cells
that receive this local signal are incorporated into the partial axes.
This is consistent with our molecular analysis showing that
induction of ectopic chd extends only one or two cell diameters
away from the gsc clone.
Furthermore, we propose that the putative autocrine signal,
responsible for induction of partial secondary axes, involves
repression of BMP signaling (Fig. 8). In Xenopus, BMP
repression ventrally produces partial secondary axes containing
neural and somitic tissue (Yasuo and Lemaire, 2001). In addition,
zebrafish BMP pathway mutants and embryos globally
overexpressing chd have expanded neural and somitic tissue but
not axial mesoderm (Miller-Bertoglio et al., 1997; Mullins et al.,
1996; Tucker et al., 2008). Xenopus Gsc can repress bmp4
transcription (Fainsod et al., 1994; Steinbeisser et al., 1995) and
we showed that Gsc can repress bmp2b and bmp4 transcription in
zebrafish, although it is not known whether this is direct. Ventral
chd overexpression also induced partial secondary axes,
indicating that it is capable of short-range signaling. However,
Chd is not required for axis induction by Gsc, suggesting that
additional factors are involved.
What is the identity of the short-range signal? BMP signaling is
maintained by a positive autoregulatory feedback loop, thus any
reduction in BMP levels will be amplified as a result of disrupting
this loop (Little and Mullins, 2006). There is also in vitro evidence
that mouse, human, chick and zebrafish bmp2b transcript stability is
reduced in cells expressing no or low levels of BMP (Fritz et al.,
2004). It therefore seems likely that incorporation of a few unlabeled
cells into the partial secondary axes occurs simply as a result of the
local absence or reduction of BMP. How does Gsc repress BMP?
The zebrafish transcriptional repressor Bozozok (Boz; Dharma ZFIN), which acts upstream of zygotic Gsc, can directly bind and
repress the bmp2b promoter (Leung et al., 2003). Both Boz and Gsc
are paired-type homeodomain proteins, thus raising the possibility
that Gsc binds the paired-type binding sites in the bmp2b promoter.
Alternatively, Gsc might function via an unknown factor (Fig. 8,
Factor X) to repress BMP signaling.
RESEARCH ARTICLE 1683
Gsc and long-range signaling
Increasing the gsc dose ventrally mimics both the short- and longrange activities of the organizer, resulting in complete secondary
axes, in which GFP-labeled cells are predominantly confined to
organizer derivatives. Large-scale recruitment of unlabeled cells
indicates that long-range signaling occurred. A demonstration of
long-range signaling at the molecular level is that ectopic chd was
induced at a distance from gsc clones; however, as discussed below,
chd cannot mediate the long-range signal. We and others have
observed that complete secondary axes move towards and often
merge with the primary axis. By contrast, we found that partial
secondary axes did not merge, suggesting that long-range signals are
responsible for this phenomenon.
Analysis of DV marker expression demonstrated that high gsc
doses resulted in inhibition of both BMP and Wnt signaling. In
Xenopus, low levels of BMP and Wnt signaling are required dorsally
for notochord formation and BMP, and Wnt signaling must be
repressed ventrally for ectopic notochord induction (Yasuo and
Lemaire, 2001). In zebrafish, overexpression of wnt8a or inhibition
of the Wnt antagonist dkk1 results in head truncations (Seiliez et al.,
2006), whereas overexpression of dkk1 and deletion of wnt8
produces expanded brain and axial mesoderm (Hashimoto et al.,
2000; Lekven et al., 2001). Although axial mesoderm is unaffected
in BMP mutants, when both wnt8 and bmp2b function are removed,
axial mesoderm expands (Ramel et al., 2005). Thus, the ability of
Gsc to induce complete secondary axes ventrally and increase
notochord cell number dorsally is probably the result of combined
inhibition of Wnt and BMP signaling. Gsc directly represses wnt8
transcription in Xenopus and we propose that this is likely to be the
case in zebrafish as well (Fig. 8). Gsc might also directly inhibit
expression of the ventralizing factors ved/vox/vent as it does in
Xenopus (Sander et al., 2007).
What is the molecular identity of the long-range signal(s)?
Induction of head and notochord was always accompanied by cell
recruitment, indicative of long-range signaling. However, it is
notable that we could see evidence of long-range signaling in the
absence of notochord induction. Ventral injection of gsc into chd
mutants at the dose that gave rise to partial secondary axes often
resulted in more fully developed endogenous heads. We also found
that ventral overexpression of dkk1 led to enlarged endogenous
heads, suggesting that it could be the long-range signal, although
dkk1 did not elicit complete secondary axes when overexpressed
ventrally (our unpublished data). We also tested whether coinjection
of dkk1 and chd ventrally could elicit complete secondary axes and
found that it could not (our unpublished data). One possibility is that
a combination of known factors is required, for example, Dkk1
might act in combination with other Wnt signaling inhibitors.
Alternatively, an unknown factor(s) might be involved (Fig. 8,
Factor Y). A recent study showed that implanted cells from early
zebrafish gastrula and pharyngula cell lines could induce secondary
axes by inducing organizer gene expression in host tissue, but this
was not mediated by known organizer inducers, including Nodals,
Bozozok, and FGFs, leading the authors to suggest that an unknown
secreted factor was responsible (Hashiguchi et al., 2008). Clearly,
additional experiments are required to identify these factors and to
characterize their interactions.
Gsc does not require Chd
Xenopus Gsc function relies entirely on Chd (Sander et al., 2007).
Furthermore, Xenopus Chd is required for complete secondary axis
induction by ventral organizer transplantation (Oelgeschläger et al.,
2003). Thus, it appears that Xenopus Chd can mediate both short-
DEVELOPMENT
goosecoid and DV patterning
and long-range organizer activities. We present evidence suggesting
that Chd is not required for Gsc function in zebrafish. Gsc induced
complete secondary axes in chdtt250 null mutant embryos and
injection of gsc-MO further ventralized chdtt250 mutants, suggesting
that Gsc has Chd-independent functions in DV patterning. Our
database searches have not provided evidence for a second chd gene
in zebrafish, nor is chd maternally expressed (Miller-Bertoglio et al.,
1997). Moreover, our data suggest that in zebrafish, Gsc and Chd
operate in parallel rather than in a simple linear pathway. We also
showed that Gsc does not require two other zygotic BMP inhibitors,
Nog1 and Fstl1b. Although Gsc might require other BMP inhibitors
for its function, we have eliminated the known zygotic BMP
inhibitors that are expressed at the appropriate time and place.
Conclusions
Our findings suggest that Gsc has dose dependent effects on axis
induction and provide new insights into molecularly distinct shortand long-range signaling activities of the organizer. In addition, we
show that Gsc functions in parallel to three secreted BMP inhibitors.
Our work also suggests that Gsc function in Xenopus and zebrafish
is different. Thus, despite the conservation of organizer genes among
vertebrates, divergent functions have evolved for key organizer
genes in different species.
We thank Stephanie Lepage for Fig. 8 and Fig. 1L; Olivia Luu for the Xenopus
work; Brian Ciruna, Marnie Halpern, Mary Mullins, Ian Scott and Jim Smith for
reagents; and Brian Ciruna, Tony Harris, Robert Ho, Stephanie Lepage, Hiro
Ninomiya, Ulli Tepass and Rudi Winklbauer for comments on the manuscript.
A.E.E.B. thanks Rudi Winklbauer for many helpful discussions. ZIRC is
supported by NIH-NCRR. A.E.E.B. was supported by NSERC and CFI.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/136/10/1675/DC1
References
Abdelilah, S., Solnica-Krezel, L., Stainier, D. Y. and Driever, W. (1994).
Implications for dorsoventral axis determination from the zebrafish mutation
janus. Nature 370, 468-471.
Akimenko, M. A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994).
Combinatorial expression of three zebrafish genes related to distal-less: part of a
homeobox gene code for the head. J. Neurosci. 14, 3475-3486.
Beddington, R. S. P. (1994). Induction of a second neural axis by the mouse node.
Development 120, 613-620.
Blum, M., Gaunt, S. J., Cho, K. W., Steinbeisser, H., Blumberg, B., Bittner, D.
and De Robertis, E. M. (1992). Gastrulation in the mouse: the role of the
homeobox gene goosecoid. Cell 69, 1097-1106.
Blumberg, B., Wright, C. V. E., DeRobertis, E. M. and Cho, K. W. Y. (1991).
Organizer-specific homeobox genes in Xenopus laevis embryos. Science 253,
194-196.
Bruce, A. E., Oates, A. C., Prince, V. E. and Ho, R. K. (2001). Additional hox
clusters in the zebrafish: divergent expression patterns belie equivalent activities
of duplicate hoxB5 genes. Evol. Dev. 3, 127-144.
Bruce, A. E., Howley, C., Zhou, Y., Vickers, S. L., Silver, L. M., King, M. L. and
Ho, R. K. (2003). The maternally expressed zebrafish T-box gene eomesodermin
regulates organizer formation. Development 130, 5503-5517.
Chen, Y. and Schier, A. F. (2001). The zebrafish Nodal signal Squint functions as a
morphogen. Nature 411, 607-610.
Cho, K. W., Blumberg, B., Steinbeisser, H. and De Robertis, E. M. (1991).
Molecular nature of Spemann’s organizer: the role of the Xenopus homeobox
gene goosecoid. Cell 67, 1111-1120.
Christian, J. L. and Moon, R. T. (1993). Interactions between Xwnt-8 and
Spemann organizer signaling pathways generate dorsoventral pattern in the
embryonic mesoderm of Xenopus. Genes Dev. 7, 13-28.
Dal-Pra, S., Fürthauer, M., Van-Celst, J., Thisse, B. and Thisse, C. (2006).
Noggin1 and Follistatin-like2 function redundantly to Chordin to antagonize
BMP activity. Dev. Biol. 298, 514-526.
Danilov, V., Blum, M., Schweickert, A., Campione, M. and Steinbeisser, H.
(1998). Negative autoregulation of the organizer-specific homeobox gene
goosecoid. J. Biol. Chem. 273, 627-635.
Development 136 (10)
Erter, C. E., Solnica-Krezel, L. and Wright, C. V. (1998). Zebrafish nodal-related
2 encodes an early mesendodermal inducer signaling from the extraembryonic
yolk syncytial layer. Dev. Biol. 204, 361-372.
Fainsod, A., Steinbeisser, H. and De Robertis, E. M. (1994). On the function of
BMP-4 in patterning the marginal zone of the Xenopus embryo. EMBO J. 13,
5015-5025.
Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T., Rennebeck, G.,
Sirotkin, H. I., Schier, A. F. and Talbot, W. S. (1998). Zebrafish organizer
development and germ-layer formation require nodal- related signals. Nature
395, 181-185.
Ferreiro, B., Artinger, M., Cho, K. and Niehrs, C. (1998). Antimorphic
goosecoids. Development 125, 1347-1359.
Fisher, S., Amacher, S. L. and Halpern, M. E. (1997). Loss of cerebum function
ventralizes the zebrafish embryo. Development 124, 1301-1311.
Fritz, D. T., Liu, D., Xu, J., Jiang, S. and Rogers, M. B. (2004). Conservation of
Bmp2 post-transcriptional regulatory mechanisms. J. Biol. Chem. 279, 4895048958.
Fürthauer, M., Thisse, B. and Thisse, C. (1999). Three different noggin genes
antagonize the activity of bone morphogenetic proteins in the zebrafish embryo.
Dev. Biol. 214, 181-196.
Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W. S. and Schier, A.
F. (1999). The EGF-CFC protein one-eyed pinhead is essential for nodal
signaling. Cell 97, 121-132.
Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A., van Eeden, F. J.,
Granato, M., Brand, M., Furutani-Seiki, M., Haffter, P., Heisenberg, C. P. et
al. (1996). dino and mercedes, two genes regulating dorsal development in the
zebrafish embryo. Development 123, 95-102.
Hashiguchi, M., Shinya, M., Tokumoto, M. and Sakai, N. (2008).
Nodal/Bozozok-independent induction of the dorsal organizer by zebrafish cell
lines. Dev. Biol. 321, 387-396.
Hashimoto, H., Itoh, M., Yamanaka, Y., Yamashita, S., Shimizu, T., SolnicaKrezel, L., Hibi, M. and Hirano, T. (2000). Zebrafish Dkk1 functions in
forebrain specification and axial mesendoderm formation. Dev. Biol. 217, 138152.
Helde, K. A., Wilson, E. T., Cretekos, C. J. and Grunwald, D. J. (1994).
Contribution of early cells to the fate map of the zebrafish gastrula. Science
265, 517-520.
Ho, R. K. (1992). Axis formation in the embryo of the zebrafish, Brachydanio rerio.
Semin. Dev. Biol. 3, 53-64.
Izpisua-Belmonte, J. C., De Robertis, E. M., Storey, K. G. and Stern, C. D.
(1993). The homeobox gene goosecoid and the origin of organizer cells in the
early chick blastoderm. Cell 74, 645-659.
Jowett, T. and Lettice, L. (1994). Whole-mount in situ hybridizations on zebrafish
embryos using a mixture of digoxigenin- and fluorescein-labelled probes. Trends
Genet. 10, 73-74.
Kelly, C., Chin, A. J., Leatherman, J. L., Kozlowski, D. J. and Weinberg, E. S.
(2000). Maternally controlled (beta)-catenin-mediated signaling is required for
organizer formation in the zebrafish. Development 127, 3899-3911.
Kelly, G. M., Greenstein, P., Erezyilmaz, D. F. and Moon, R. T. (1995). Zebrafish
wnt8 and wnt8b share a common activity but are involved in distinct
developmental pathways. Development 121, 1787-1799.
Kessler, D. S. (1997). Siamois is required for formation of Spemann’s organizer.
Proc. Natl. Acad. Sci. USA 94, 13017-13022.
Kimmel, C. B. and Law, R. D. (1985). Cell lineage of zebrafish blastomeres. III.
Clonal analyses of the blastula and gastrula stages. Dev. Biol. 108, 94-101.
Kimmel, C. B. and Warga, R. M. (1987). Indeterminate cell lineage of the
zebrafish embryo. Dev. Biol. 124, 269-280.
Kimmel, C. B., Warga, R. M. and Schilling, T. F. (1990). Origin and organization
of the zebrafish fate map. Development 108, 581-594.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F.
(1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253310.
Koos, D. S. and Ho, R. K. (1999). The nieuwkoid/dharma homeobox gene is
essential for bmp2b repression in the zebrafish pregastrula. Dev. Biol. 215, 190207.
Krauss, S., Concordet, J. P. and Ingham, P. W. (1993). A functionally conserved
homolog of the Drosophila segment polarity gene hh is expressed in tissues with
polarizing activity in zebrafish embryos. Cell 75, 1431-1444.
Latinkic, B. V. and Smith, J. C. (1999). Goosecoid and mix.1 repress Brachyury
expression and are required for head formation in Xenopus. Development 126,
1769-1779.
Lekven, A. C., Thorpe, C. J., Waxman, J. S. and Moon, R. T. (2001). Zebrafish
wnt8 encodes two wnt8 proteins on a bicistronic transcript and is required for
mesoderm and neurectoderm patterning. Dev. Cell 1, 103-114.
Leung, T., Bischof, J., Soll, I., Niessing, D., Zhang, D., Ma, J., Jackle, H. and
Driever, W. (2003). bozozok directly represses bmp2b transcription and
mediates the earliest dorsoventral asymmetry of bmp2b expression in zebrafish.
Development 130, 3639-3649.
Little, S. C. and Mullins, M. C. (2006). Extracellular modulation of BMP activity in
patterning the dorsoventral axis. Birth Defects Res. C Embryo Today 78, 224-242.
DEVELOPMENT
1684 RESEARCH ARTICLE
Mailhos, C., Andre, S., Mollereau, B., Goriely, A., Hemmati-Brivanlou, A. and
Desplan, C. (1998). Drosophila Goosecoid requires a conserved heptapeptide
for repression of paired-class homeoprotein activators. Development 125, 937947.
Martinez-Barbera, J. P., Toresson, H., Da Rocha, S. and Krauss, S. (1997).
Cloning and expression of three members of the zebrafish Bmp family: Bmp2a,
Bmp2b and Bmp4. Gene 198, 53-59.
Miller-Bertoglio, V. E., Fisher, S., Sanchez, A., Mullins, M. C. and Halpern, M.
E. (1997). Differential regulation of chordin expression domains in mutant
zebrafish. Dev. Biol. 192, 537-550.
Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J., Brand, M.,
van Eeden, F. J., Furutani-Seiki, M., Granato, M., Haffter, P., Heisenberg,
C. P. et al. (1996). Genes establishing dorsoventral pattern formation in the
zebrafish embryo: the ventral specifying genes. Development 123, 81-93.
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene ‘knockdown’ in
zebrafish. Nat. Genet. 26, 216-220.
Niehrs, C. (2004). Regionally specific induction by the Spemann-Mangold
organizer. Nat. Rev. Genet. 5, 425-434.
Niehrs, C., Keller, R., Cho, K. W. and De Robertis, E. M. (1993). The
homeobox gene goosecoid controls cell migration in Xenopus embryos. Cell
72, 491-503.
Nojima, H., Shimizu, T., Kim, C. H., Yabe, T., Bae, Y. K., Muraoka, O., Hirata,
T., Chitnis, A., Hirano, T. and Hibi, M. (2004). Genetic evidence for
involvement of maternally derived Wnt canonical signaling in dorsal
determination in zebrafish. Mech. Dev. 121, 371-386.
Oelgeschläger, M., Kuroda, H., Reversade, B. and De Robertis, E. M. (2003).
Chordin is required for the Spemann organizer transplantation phenomenon in
Xenopus embryos. Dev. Cell 4, 219-230.
Oppenheimer, J. M. (1934). Experiments on early developing stages of Fundulus.
Proc. Natl. Acad. Sci. USA 20, 536-538.
Piccolo, S., Sasai, Y., Lu, B. and De Robertis, E. M. (1996). Dorso-ventral
patterning in Xenopus: inhibition of ventral signals by direct binding of Chordin
to BMP-4. Cell 86, 589-598.
Ramel, M. C. and Lekven, A. C. (2004). Repression of the vertebrate organizer by
Wnt8 is mediated by Vent and Vox. Development 131, 3991-4000.
Ramel, M. C., Buckles, G. R., Baker, K. D. and Lekven, A. C. (2005). WNT8 and
BMP2B co-regulate non-axial mesoderm patterning during zebrafish
gastrulation. Dev. Biol. 287, 237-248.
Rivera-Perez, J. A., Mallo, M., Gendron-Maguire, M., Gridley, T. and
Behringer, R. R. (1995). Goosecoid is not an essential component of the mouse
gastrula organizer but is required for craniofacial and rib development.
Development 121, 3005-3012.
Rupp, R. A., Snider, L. and Weintraub, H. (1994). Xenopus embryos regulate
the nuclear localization of XMyoD. Genes Dev. 8, 1311-1323.
Sampath, K., Rubinstein, A. L., Cheng, A. M., Liang, J. O., Fekany, K.,
Solnica-Krezel, L., Korzh, V., Halpern, M. E. and Wright, C. V. (1998).
Induction of the zebrafish ventral brain and floorplate requires cyclops/nodal
signalling. Nature 395, 185-189.
Sander, V., Reversade, B. and De Robertis, E. (2007). The opposing homeobox
genes Goosecoid and Vent1/2 self-regulate Xenopus patterning. EMBO J. 26,
2955-2965.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E.
M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizerspecific homeobox genes. Cell 79, 779-790.
Saúde, L., Woolley, K., Martin, P., Driever, W. and Stemple, D. L. (2000). Axisinducing activities and cell fates of the zebrafish organizer. Development 127,
3407-3417.
Schier, A. F. and Talbot, W. S. (2005). Molecular genetics of axis formation in
zebrafish. Annu. Rev. Genet. 39, 561-613.
RESEARCH ARTICLE 1685
Schier, A. F., Neuhauss, S. C., Helde, K. A., Talbot, W. S. and Driever, W.
(1997). The one-eyed pinhead gene functions in mesoderm and endoderm
formation in zebrafish and interacts with no tail. Development 124, 327-342.
Schulte-Merker, S., Ho, R. K., Herrmann, B. G. and Nusslein-Volhard, C.
(1992). The protein product of the zebrafish homologue of the mouse T gene is
expressed in nuclei of the germ ring and the notochord of the early embryo.
Development 116, 1021-1032.
Schulte-Merker, S., Hammerschmidt, M., Beuchle, D., Cho, K. W., De
Robertis, E. M. and Nusslein-Volhard, C. (1994). Expression of zebrafish
goosecoid and no tail gene products in wild- type and mutant no tail embryos.
Development 120, 843-852.
Schulte-Merker, S., Lee, K. J., McMahon, A. P. and Hammerschmidt, M.
(1997). The zebrafish organizer requires chordino. Nature 387, 862-863.
Seiliez, I., Thisse, B. and Thisse, C. (2006). FoxA3 and goosecoid promote
anterior neural fate through inhibition of Wnt8a activity before the onset of
gastrulation. Dev. Biol. 290, 152-163.
Shih, J. and Fraser, S. E. (1995). Distribution of tissue progenitors within the
shield region of the zebrafish gastrula. Development 121, 2755-2765.
Shih, J. and Fraser, S. E. (1996). Characterizing the zebrafish organizer:
microsurgical analysis at the early-shield stage. Development 122, 1313-1322.
Smith, S. T. and Jaynes, J. B. (1996). A conserved region of engrailed, shared
among all en-, gsc-, Nk1-, Nk2- and msh-class homeoproteins, mediates active
transcriptional repression in vivo. Development 122, 3141-3150.
Spemann, H. and Mangold, H. (1924). Uber induction von embryonanlagen
durch implantation artfremder organis atoren. Roux’s Arch. Dev. Biol. 100, 599638.
Stachel, S. E., Grunwald, D. J. and Myers, P. Z. (1993). Lithium perturbation and
goosecoid expression identify a dorsal specification pathway in the pregastrula
zebrafish. Development 117, 1261-1274.
Steinbeisser, H., Fainsod, A., Niehrs, C., Sasai, Y. and De Robertis, E. M.
(1995). The role of gsc and BMP-4 in dorsal-ventral patterning of the marginal
zone in Xenopus: a loss-of-function study using antisense RNA. EMBO J. 14,
5230-5243.
Talbot, W. S., Trevarrow, B., Halpern, M. E., Melby, A. E., Farr, G.,
Postlethwait, J. H., Jowett, T., Kimmel, C. B. and Kimelman, D. (1995). A
homeobox gene essential for zebrafish notochord development. Nature 378,
150-157.
Tucker, J. A., Mintzer, K. A. and Mullins, M. C. (2008). The BMP signaling
gradient patterns dorsoventral tissues in a temporally progressive manner along
the anterioposterior axis. Dev. Cell 14, 108-119.
Waddington, C. H. (1932). Experiments on the development of the chick and the
duck embryo cultivated in vitro. Philos. Trans. R. Soc. London Ser. B 211, 179230.
Yamada, G., Mansouri, A., Torres, M., Stuart, E. T., Blum, M., Schultz, M., De
Robertis, E. M. and Gruss, P. (1995). Targeted mutation of the murine
goosecoid gene results in craniofacial defects and neonatal death. Development
121, 2917-2922.
Yamanaka, Y., Mizuno, T., Sasai, Y., Kishi, M., Takeda, H., Kim, C. H., Hibi, M.
and Hirano, T. (1998). A novel homeobox gene, dharma, can induce the
organizer in a non-cell- autonomous manner. Genes Dev. 12, 2345-2353.
Yao, J. and Kessler, D. S. (2001). Goosecoid promotes head organizer activity by
direct repression of Xwnt8 in Spemann’s organizer. Development 128, 29752987.
Yasuo, H. and Lemaire, P. (2001). Role of Goosecoid, Xnot and Wnt antagonists
in the maintenance of the notochord genetic programme in Xenopus gastrulae.
Development 128, 3783-3793.
Zhu, L., Belo, J. A., De Robertis, E. M. and Stern, C. D. (1999). Goosecoid
regulates the neural inducing strength of the mouse node. Dev. Biol. 216, 276281.
DEVELOPMENT
goosecoid and DV patterning