Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
1. What type of protein can participates 4. Which of the diagrams below shows the correct structure of a in transmitting signals among the nucleic acid? cells? a) enzyme b) P a) P G b) anti-body c) receptor S S d) structural G P A 2. A protein that can initiate or repress S S gene activity is called… P a) enzyme b) hormone d) c) P G c) transcription factor P d) receptor G S G S P 3. Which of the following proteins is an A P enzyme? A S A S a) hemoglobin b) collagen c) topoisomerase d) myoglobin Proteins have complex shapes! 1. Primary structure – sequence of amino acids (polypeptide) 2. Secondary structure – helical or folded 3. Tertiary structure – complex/functional 4. Quaternary structure – several polypeptides together DNA code RNA RNA –– ribonucleic ribonucleic acid acid AATTCACCGGGGGCATACACT P TTAAGTGGCCCCCGTATGTGA Leu Ser Gly Pro Arg - sugar - ribose S G S BASES Met A codon/ triplet – 3 bases that map one amino acid adenine P A G S guanine T U uracil C cytosine P U S RNA AA mRNA – messenger RNA transcription – RNA assembly on a DNA template A A G U U T C A C G tRNA – transfer RNA rRNA – ribosomal RNA anticodon 1 Following transcription an RNA molecule has coding and non-coding areas TRANSLATION – protein assembly on mRNA template mRNA intron exon A A A C U G G C G C C G G G U U A C U U spliceosome AUG U C A G G C C C C G C A A U G U A G postprocessing – removes introns Leu spliceosome Ser Gly UAC Pro Arg AGU CCG CGU mRNA Met Met UAC GGG Met Ser C U G G C G C U U Pro Gly Arg chromosome = DNA + proteins (histones) body cells histones diploid haploid somatic gametes (sperm and oocytes) 1 set of DNA 2 sets of DNA 2 sets of every gene 1 set of every gene 1 set of 2 sets of chromosomes chromosomes DNA Karyotype Where do different cells come from? MUTATIONS – changes in the DNA sequence diploid cells result of mitosis or result of fertilization AATTCACCGGGGGCATACACT TTAAGTGG A CCCCCGTATGTGA gametes result of meiosis MITOSIS MEIOSIS 2n 2n replication replication Alleles – different versions of the same gene 4n 4n A diploid cell can be: Homozygous – having 2 identical alleles AA bb Heterozygous – having 2 different alleles for the Aa NM S2 S1 same gene: S1 S1 2n 2n 2n 2n n n n n 2 Mitosis (increases the number of somatic cells) Mitosis (cntd.) A A (3) Anaphase (2) Metaphase (1) Prophase A A A A A A A b A B B B B b b b b A b B A B AA Bb (4) Telophase A A A A A A A A B chromatids A b A B BA b b b B A B b b B AA Bb AA Bb Meiosis (makes gametes), 1st division (1) Prophase I (3) Anaphase I (4) Telophase I A B B AA AA B b B b A A A b A B Meiosis, 2nd division (4) Telophase II A A A A A A AB b B Ab b b A A A AB B b b b b A A gametes – haploid B A (3) Anaphase II B B B B B A (2) Metaphase II A (1) Prophase II Meiosis, 2nd division A B homologous chromosomes conjugate and undergo crossing over A A b b A b b A A AA Bb A B B B b B b b A A A A A A Meiosis, 1st division (2) Metaphase I b Ab 3