Download RNA mRNA – messenger RNA tRNA – transfer RNA rRNA

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Transcript
1. What type of protein can participates 4. Which of the diagrams below
shows the correct structure of a
in transmitting signals among the
nucleic acid?
cells?
a) enzyme
b) P
a) P
G
b) anti-body
c) receptor
S
S
d) structural
G
P
A
2. A protein that can initiate or repress
S
S
gene activity is called…
P
a) enzyme
b) hormone
d)
c) P
G
c) transcription factor
P
d) receptor
G
S
G
S
P
3. Which of the following proteins is an
A
P
enzyme?
A
S
A
S
a) hemoglobin
b) collagen
c) topoisomerase
d) myoglobin
Proteins have complex shapes!
1. Primary structure –
sequence of amino acids
(polypeptide)
2. Secondary structure –
helical or folded
3. Tertiary structure –
complex/functional
4. Quaternary structure –
several polypeptides
together
DNA code
RNA
RNA –– ribonucleic
ribonucleic acid
acid
AATTCACCGGGGGCATACACT
P
TTAAGTGGCCCCCGTATGTGA
Leu
Ser
Gly
Pro
Arg
- sugar - ribose
S
G
S
BASES
Met
A
codon/ triplet – 3 bases that map one amino acid
adenine
P
A
G
S
guanine
T
U
uracil
C
cytosine
P
U
S
RNA
AA
mRNA – messenger RNA
transcription – RNA assembly on a
DNA template
A A G
U U
T
C
A C
G
tRNA – transfer RNA
rRNA – ribosomal RNA
anticodon
1
Following transcription an RNA molecule has
coding and non-coding areas
TRANSLATION – protein assembly on mRNA template
mRNA
intron
exon
A A A C U G G C G C C G G G U U A C U U
spliceosome
AUG U C A G G C C C C G C A A U G U A G
postprocessing – removes introns
Leu
spliceosome
Ser
Gly
UAC
Pro
Arg
AGU
CCG
CGU
mRNA
Met
Met
UAC
GGG
Met
Ser
C U G G C G C U U
Pro
Gly
Arg
chromosome =
DNA + proteins (histones)
body cells
histones
diploid
haploid
somatic
gametes (sperm and oocytes)
1 set of DNA
2 sets of DNA
2 sets of every gene 1 set of every gene
1 set of
2 sets of chromosomes
chromosomes
DNA
Karyotype
Where do different cells come from?
MUTATIONS – changes in the DNA sequence
diploid cells
result of mitosis
or
result of fertilization
AATTCACCGGGGGCATACACT
TTAAGTGG
A CCCCCGTATGTGA
gametes
result of meiosis
MITOSIS
MEIOSIS
2n
2n
replication
replication
Alleles – different versions of the same gene
4n
4n
A diploid cell can be:
Homozygous – having 2 identical alleles AA bb
Heterozygous – having 2 different alleles for the
Aa
NM S2 S1
same gene:
S1 S1
2n
2n
2n
2n
n
n
n
n
2
Mitosis (increases the number of somatic cells)
Mitosis (cntd.)
A
A
(3) Anaphase
(2) Metaphase
(1) Prophase
A
A
A
A
A A
A
b
A
B
B
B B
b b
b
b
A
b
B
A
B
AA Bb
(4) Telophase
A
A
A
A
A
A
A
A
B
chromatids
A
b
A
B
BA
b
b
b
B
A
B
b b
B
AA Bb
AA Bb
Meiosis (makes gametes), 1st division
(1) Prophase I
(3) Anaphase I
(4) Telophase I
A
B
B
AA AA
B b
B b
A
A A
b
A
B
Meiosis, 2nd division
(4) Telophase II
A
A
A
A
A
A
AB
b
B
Ab
b
b
A
A A
AB
B
b b
b b
A A
gametes – haploid
B
A
(3) Anaphase II
B
B B
B B
A
(2) Metaphase II
A
(1) Prophase II
Meiosis, 2nd division
A
B
homologous
chromosomes
conjugate and
undergo crossing over
A
A
b b
A
b b
A
A
AA Bb
A
B B
B b
B b
b
A
A
A
A
A
A
Meiosis, 1st division
(2) Metaphase I
b
Ab
3
Document related concepts
no text concepts found
Similar