RNA mRNA – messenger RNA tRNA – transfer RNA rRNA Download

Transcript
1. What type of protein can participates 4. Which of the diagrams below
shows the correct structure of a
in transmitting signals among the
nucleic acid?
cells?
a) enzyme
b) P
a) P
G
b) anti-body
c) receptor
S
S
d) structural
G
P
A
2. A protein that can initiate or repress
S
S
gene activity is called…
P
a) enzyme
b) hormone
d)
c) P
G
c) transcription factor
P
d) receptor
G
S
G
S
P
3. Which of the following proteins is an
A
P
enzyme?
A
S
A
S
a) hemoglobin
b) collagen
c) topoisomerase
d) myoglobin
Proteins have complex shapes!
1. Primary structure –
sequence of amino acids
(polypeptide)
2. Secondary structure –
helical or folded
3. Tertiary structure –
complex/functional
4. Quaternary structure –
several polypeptides
together
DNA code
RNA
RNA –– ribonucleic
ribonucleic acid
acid
AATTCACCGGGGGCATACACT
P
TTAAGTGGCCCCCGTATGTGA
Leu
Ser
Gly
Pro
Arg
- sugar - ribose
S
G
S
BASES
Met
A
codon/ triplet – 3 bases that map one amino acid
adenine
P
A
G
S
guanine
T
U
uracil
C
cytosine
P
U
S
RNA
AA
mRNA – messenger RNA
transcription – RNA assembly on a
DNA template
A A G
U U
T
C
A C
G
tRNA – transfer RNA
rRNA – ribosomal RNA
anticodon
1
Following transcription an RNA molecule has
coding and non-coding areas
TRANSLATION – protein assembly on mRNA template
mRNA
intron
exon
A A A C U G G C G C C G G G U U A C U U
spliceosome
AUG U C A G G C C C C G C A A U G U A G
postprocessing – removes introns
Leu
spliceosome
Ser
Gly
UAC
Pro
Arg
AGU
CCG
CGU
mRNA
Met
Met
UAC
GGG
Met
Ser
C U G G C G C U U
Pro
Gly
Arg
chromosome =
DNA + proteins (histones)
body cells
histones
diploid
haploid
somatic
gametes (sperm and oocytes)
1 set of DNA
2 sets of DNA
2 sets of every gene 1 set of every gene
1 set of
2 sets of chromosomes
chromosomes
DNA
Karyotype
Where do different cells come from?
MUTATIONS – changes in the DNA sequence
diploid cells
result of mitosis
or
result of fertilization
AATTCACCGGGGGCATACACT
TTAAGTGG
A CCCCCGTATGTGA
gametes
result of meiosis
MITOSIS
MEIOSIS
2n
2n
replication
replication
Alleles – different versions of the same gene
4n
4n
A diploid cell can be:
Homozygous – having 2 identical alleles AA bb
Heterozygous – having 2 different alleles for the
Aa
NM S2 S1
same gene:
S1 S1
2n
2n
2n
2n
n
n
n
n
2
Mitosis (increases the number of somatic cells)
Mitosis (cntd.)
A
A
(3) Anaphase
(2) Metaphase
(1) Prophase
A
A
A
A
A A
A
b
A
B
B
B B
b b
b
b
A
b
B
A
B
AA Bb
(4) Telophase
A
A
A
A
A
A
A
A
B
chromatids
A
b
A
B
BA
b
b
b
B
A
B
b b
B
AA Bb
AA Bb
Meiosis (makes gametes), 1st division
(1) Prophase I
(3) Anaphase I
(4) Telophase I
A
B
B
AA AA
B b
B b
A
A A
b
A
B
Meiosis, 2nd division
(4) Telophase II
A
A
A
A
A
A
AB
b
B
Ab
b
b
A
A A
AB
B
b b
b b
A A
gametes – haploid
B
A
(3) Anaphase II
B
B B
B B
A
(2) Metaphase II
A
(1) Prophase II
Meiosis, 2nd division
A
B
homologous
chromosomes
conjugate and
undergo crossing over
A
A
b b
A
b b
A
A
AA Bb
A
B B
B b
B b
b
A
A
A
A
A
A
Meiosis, 1st division
(2) Metaphase I
b
Ab
3
Similar