Download Isolation and characterization of a functional promoter from

MICROBIOLOGY
LETTERS
ELSEVIER
FEMS Microbiology
Letters 137 (1996) 9-12
Isolation and characterization of a functional promoter from
Nitrosomonas europaea
Ali Nejidat *, Ornit Spector, Aharon Abeliovich
Ben-Gut-ion University of the Negev, Environmental Microbiology, The Jacob Blaustein Institute for Desert Research,
Sede-Boker Campus, 84990, Israel
Received
14 November
1995; revised 14 December
1995; accepted
14 December
1995
Abstract
A functional promoter from the obligate autotrophic ammonia oxidizing bacterium Nitrosonwnas europaea was
identified by expression in Escherichia coli, using a promoterless reporter gene. Transcription initiation site of this promoter
was determined by primer extension analysis. The sequences at -35 and - 10 have low similarity to the - lO/ - 35
consensus sequence of known prokaryotic promoters.
Keywords: Nitrifying
bacteria;
Nitrosomonas europaea; Promoter
1. Introduction
Ammonia oxidizing bacteria are obligate autotrophs which use 0, and ammonia as their sole
natural energy source [l], thus playing a key role in
the global nitrogen cycle. Nitrifiers reproduce very
slowly and comprise only a nominal fraction of the
viable cells within a given niche [ 1,2] due to their
low rate of energy procurement [l].
Ammonia monooxygenase, which catalyzes the
oxidation of ammonia to hydroxylamine, can transform many pollutant chemicals that may contaminate
soils and aquifers [3,4]. This characteristic may facilitate the use of ammonia oxidizing bacteria in biore-
* Corresponding
(7) 565 835.
author.
Tel: +972
Federation of European Microbiological
SSDZ 0378-1097(96)00011-0
(7) 565 765; Fax:
Societies
+972
analysis; Transcription
initiation
mediation of contaminated soils. Further exploitation
of ammonia oxidizing bacteria for scientific as well
as applied purposes requires genetic manipulation.
This in turn depends on a transformation system
which hitherto does not exist.
Little is known, however, about tbe molecular
genetics and gene regulation of the ammonia oxidizing bacteria. The promoter of the gene coding for the
enzyme hydroxylamine
oxidoreductase (HAO),
which catalyzes the oxidation of hydroxylamine to
nitrite, is the only Nitrosomonas europaea promoter
so far analyzed [s]. This promoter has no typical
- 10 or - 35 prokaryotic consensus sequence [51.
Thus, it is possible that known prokaryotic promoters
may not drive the expression of foreign genes in
ammonia oxidizing bacteria. On the other hand, the
RNA polymerase of Escherichia coli recognizes a
diversity of promoters which do not have a typical
- 10 and - 35 consensus sequence [6,7]. Thus, with
IO
A. Nyjidar rt rrl. / k’EMS Miuohiolo,q\
the ultimate goal of constructing
a transformation
system for the ammonia oxidizing bacteria, an attempt was made towards the isolation and characterization of a constitutive promoter from the ammonia
oxidizing bacterium N. europueu by functional expression in E. co/i. The isolation, sequencing and
analysis of such a promoter is described.
2. Materials
2. I. Promoter
and methods
isolation
Genomic DNA from streptomycin-resistant
(200
pg/ml)
N. eurtjpaea ATCC 19718 was isolated as
in [8]. BumHI-digested
DNA was ligated
to
BamHI-digested
pKk232-8
(Pharmacia
Biotech.)
plasmid vector, upstream of a promoterless chloramphenicol acetyltransferase
gene. Recombinant
plasmids were transformed into E. coli DH5a and 50
chloramphenicol
resistant colonies were isolated. of
which clone pKA16 was randomly chosen for characterization. E. coli bacteria harboring the recombinant plasmid pKA16 were able to grow on 100
pug/ml of chloramphenicol
(maximum tested). Repeated transformations
using the pKk-232 plasmid
alone gave no chloramphenicol
resistant colonies.
The BumHI fragment in the clone pKA16 (about
1000 bp) was sequenced by the dideoxynucleotide
chain termination method [9] using the Sequenase kit
(USB, Cleveland, OH). RNA isolation and primer
extension analysis were performed as described in
B1.
Lrrter.r 137 (IYY61 Y-l-7
3. Results and discussion
3.1. Clorle churucteri:ution
Partial DNA sequence (304 bp) of the BumHI
fragment in the pKA 16 clone is indicated in Fig. I.
To confirm the origin of the DNA fragment and to
rule out a possible major reorganization of the DNA
fragment during the cloning process, the DNA fragment was amplified by PCR from genomic DNA
isolated from an axenic N. europuea culture. Primers
L and RI and primers L and R2 amplified only the
expected DNA fragments, 765 and 470 bp respectively. from 1.0 ng of total genomic DNA of N.
europaeu (Fig. 2). Based on DNA sequences of
pKA16, the 470 bp fragment does not contain a
restriction site for PstI while the 765 bp fragment
contains two restriction sites which produce three
DNA fragments of 491, 152 and 122 bp and the
expected results were obtained (Fig. 2). These results
support the co-linearity of the DNA fragment with
the DNA of N. europaea.
3.2. Transcription
initiation site
After preliminary
experiments, the transcription
start site in the fragment cloned in pKA 16 was
determined by primer extension analysis with an
18-mer oligonucleotide primer complementary to sequences spanning bp l88- 171, using total RNA
isolated from N. europueu and E. coli (Fig. 3). In
N. europuea the transcription initiation site is located
at nucleotide 102 (Fig. 3). The transcript which starts
2.2. DNA umpl$ication
Genomic DNA was isolated from an axenic culture of N. europaeu and polymerase chain reaction
(PCR) amplification
was carried out as previously
described [lo] except that the annealing temperature
was decreased to 50°C. A 17-mer primer, L (5’CGCTGAGTATTGAAAGC),
located between bp
123 and 139, a l7-mer primer Rl (5’-GATTCCGTGTACCCAGG), complementary to the sequence spanning bp 887 and 871 and an internal 17-mer primer
R2 (5’-GGTCATGGTTGGATAAG),
complementary
to the sequences located between bp 592 and 576
were used in the PCR reactions.
ACGCCGGATAAACTGCGTGRGCCTGGGAAGCAGGGCAAACCGTATTCGG
50
TGAAAATTACCTGCAGGAAGGTCTGGTCAAAATCCGCGCACTGTCAGACC
100
*
-35
-10
TGCCAATCGAATGGCATTTCATCGGTCCGAATTCAAAGCAACAAAACCAA
150
ACTGATTGCCGAGAATTTTTCCTGGGTACACGGAATCGATCGGGAAAAAA
200
TCGCAACCCGCCTTTCAGCAGCACGGCCGGAATCGTTACCACCGCTGCAA
250
GTCTGTGTGCAGGTAAATGTAAGTGGAGAAATCACCAAGATGTGGAGTGG
300
ATCC
350
Fig. I. Fig. I. Partial DNA sequence 304 (bp) of the Bu~uHl
fragment in clone pKAl6. Transcription
start site (in N. eurqxwu) is indicated by a star. The - 10 and -35 regions xe
underlined. The DNA sequences have been submitted to the
EMBL Data Library under accession number X834 18.
A. Nejidat et al./ FEMS Microbiology Letters 137 (1996) 9-12
polymerase of both N. europaea and E. coli have
recognized similar DNA sequences. Although this
may be not true for other promoters, the results
support the possibility of using E. coli to trap functional promoters from N. europaea.
2ooo
3.3. Sequence analysis
600 -
Fig. 2. Ethidium bromide stained 1.4% agarose gel of PCRamplified DNA fragments from 1.0 ng of N. europaea DNA.
Lane 1 is a 100 bp DNA ladder (GIBCO BRL). Lanes 2 and 3 are
DNA products amplified by primers L-RI and L-R2 respectively.
Lanes 4 and 5 are DNA products amplified by primers L-RI and
L-R2 respectively, after PstI treatment.
at nucleotide 106 (Fig. 2) could be a second start
site, or the result of reverse transcriptase pausing due
to formation of RNA secondary structures. However,
several prokaryotic promoters initiate transcription at
more than one site 17,111 and in some cases as a
mechanism of gene regulation [12]. Primer extension
analysis using the same oligonucleotide
primer, and
total RNA isolated from E. coli cells growing in LB
broth containing
50 pg/ml
chloramphenicol
also
showed two major transcripts which are shorter by
one nucleotide only than those produced in N. europaea (Fig. 3). Thus, in this promoter the RNA
123456
A
11
C
0
f
Two conserved hexamers upstream of the transcription start site, TTGACA (- 35 region) and
TATAAT ( - 10 region) were identified by comparison of different prokaryotic promoters [7,11]. The
- 10 and the - 35 hexamers in pKA16 promoter
have four matches to the 12 consensus nucleotides,
(Fig. 1). Such a low level of homology to the
consensus sequence has also been shown in other E.
coli promoters [ 111. Interestingly, an AT rich region
at the - 19 position of this promoter also exists in
the HA0 promoter [5] and in another N. europaea
promoter which was analyzed in E. coli (data not
shown). It is tempting to speculate that these sequences may have a role in transcriptional regulation
in N. europaea. However, the analysis of more
promoters and site-directed mutagenesis studies are
necessary to establish the presence of regulatory
elements in the promoters of ammonia-oxidizing
bacteria. An attempt to fuse the pKA16 promoter to
a reporter gene for the expression in N. europaea
will be made.
Acknowledgements
We thank Prof. Y. Heimer and Mr. S. Barak for
reading the manuscript. This work was supported by
the Rashi Foundation and an Eshcol grant from the
Israeli Ministry of Science and Technology to A.N.
References
Fig. 3. Localization
of the transcription
initiation site of the
promoter at clone pKA16 by primer extension analysis. The same
primer used for primer extension analysis was also used to
produce the sequence depicted (lanes 1 through 4). Lanes 5 and 6
contain primer extension products using 40 pg of total RNA
isolated from E. coli and N. europaea respectively.
[l] Hooper, A.B. (1989) Biochemistry of the nitrifying lithoautotrophic bacteria. In: Autotrophic Bacteria (Schlegel, H.G.
and Bowien, B., Bds.), pp. 239-265. Springer Verlag, Berlin.
[2] Focht, D.D. and Verstraete, W. (1977) Biochemical ecology
of nitrification and denitrification. In: Advances in Microbial
Ecology Vol. 1. pp. 135-214. Plenum Press, New York and
London.
[3] Keener, W.K. and Arp, D.J. (1994) Kinetic studies of ammo-
12
[4]
[5]
[6]
[7]
A. Nejidat et 01. / FEMS Microbiology
nia monooxygenase
inhibition in Nifrosomonc~s ruropueu by
hydrocarbons and halogenated hydrocarbons in an optimized
whole-cell assay. Appl. Environ. Microbial. 60, 1914- 1920.
Vannelli, T., Logan, M., Arciero, D.M. and Hooper. A.B.
(1990) Degradation of halogenated aliphatic compounds by
ammoniaoxidizing
bacterium
Nitrosomonas europura.
Appl. Environ. Microbial. 56. I I69- I 17 I.
Sayavedra-Soto,
L.A., Hommes, N.G. and Arp, D.J. (1994)
Characterization
of the gene encoding hydroxylamine
oxidoreductase in Nitrosomonus ruropcwi. J. Bacterial.
176.
504-5 10
McClure, W.R. (1985) Mechanism and control of tranacription initiation in prokaryotes. Ann. Rev. Biochem. 54, 171204.
Harley, C.B. and Reynolds, R.P. (1987) Analyaia of E. co/i
promoter sequences. Nucleic Acids Rea. 15. 2343-2360
Letters 137 (IY%/
Y-12
[8] Ausubel, F.M., Brent, R.. Kingston, R.E., Moore, D.D.,
Smith. J.A., Sideman, J.G. and Strul, K. (1987) Current
Protocols in Molecular Biology. John Wiley And Sons Inc..
New York.
[91 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA
sequencing
with chain-terminating
inhibitors. Proc. Natl.
Acad. Sci. USA 74, 5463-5467.
[IO] Nejidat, A. and Abeliovich, A. (1994) Detection of Nitrosomonas spp. by polymerase chain reaction. FEMS Microbiol. Lett. 120, 191-194.
[I
II Lisser, S. and Margalit, H. (1993) Compilation of E. coli
promoter sequences. Nucleic Acids Res. 2 I, 1507- I5 16.
[I21 Wilson, H.R., Archer, CD., Liu, J. and Tumbough, C.L., Jr.
(1992) Translational control of pyrC expression mediated by
nucleotide-sensitive
selection of transcriptional
start sites in
Evcherichia coli. J. Bacterial. 174, 514-524.