Download DORNRÖSCHEN is a direct target of the auxin response factor

RESEARCH ARTICLE 1643
Development 136, 1643-1651 (2009) doi:10.1242/dev.032177
DORNRÖSCHEN is a direct target of the auxin response
factor MONOPTEROS in the Arabidopsis embryo
Melanie Cole1,*, John Chandler1,*, Dolf Weijers2, Bianca Jacobs1, Petra Comelli1 and Wolfgang Werr1,†
DORNRÖSCHEN (DRN), which encodes a member of the AP2-type transcription factor family, contributes to auxin transport and
perception in the Arabidopsis embryo. Live imaging performed with transcriptional or translational GFP fusions shows DRN to be
activated in the apical cell after the first zygotic division, to act cell-autonomously and to be expressed in single cells extending
laterally from the apical shoot stem-cell zone at the position of incipient leaf primordia. Here, we show that the Auxin response
factor (ARF) MONOPTEROS (MP) directly controls DRN transcription in the tips of the embryonic cotyledons, which depends on the
presence of canonical Auxin response elements (AuxREs), potential ARF-binding sites flanking the DRN transcription unit.
Chromatin immunoprecipitation experiments show that MP binds in vivo to two AuxRE-spanning fragments in the DRN promoter,
and that MP is required for expression of DRN in cotyledon tips. Hence, DRN represents a direct target of MP and functions
downstream of MP in cotyledon development.
INTRODUCTION
Embryogenesis in plants establishes the basic body plan and stem
cell populations for the generation of all post-embryonic organs. In
Arabidopsis, embryo development is rapid and initially
characterized by stereotypic cell divisions, which establish apicalbasal polarity and radial symmetry (Jürgens, 1992; Weijers and
Jürgens, 2005). Based on seedling-lethal mutant analyses, the apical
tier of four cells within the octant-stage embryo generates most of
the cotyledon tissue and the shoot apical meristem (SAM) (Jürgens,
1995).
The remaining cotyledon tissue, hypocotyl and root apical initials,
the so-called central domain, derive from the lower tier of four cells,
whereas the basal hypophysis region forms the quiescent centre and
root cap initials (Scheres et al., 1994). Periclinal cell divisions
superimpose a second axis of radial (inner-outer) symmetry towards
the 16-cell stage. This radial symmetry is broken in the apical
embryo domain by cotyledon specification, which marks the
transition to bilateral symmetry, with a central-peripheral axis
extending from the SAM outwards to the expanding cotyledons and,
typical for dicots, a second, perpendicular plane of symmetry
medially between both cotyledons (reviewed by Jenik et al., 2007;
Chandler et al., 2008). Cotyledon defects in the seedling represent a
deficiency in the acquisition of bilateral symmetry and are
associated with mutations in genes encoding transcription factors,
such as the CUP-SHAPED COTYLEDON (Aida et al., 1997;
Aida et al., 1999), CLASS III HD-ZIP (Prigge et al., 2005)
or DORNRÖSCHEN/DORNRÖSCHEN-LIKE (DRN/DRNL)
(Chandler et al., 2007) genes or genes relating to auxin signalling
such as PINOID (PID) (Bennett et al., 1995) or auxin transport
(Friml et al., 2003). Auxin is also essential for specification of the
1
Institute of Developmental Biology, University of Cologne, Gyrhofstrasse 17, 50931
Cologne, Germany. 2Laboratory of Biochemistry, Wageningen University, Dreijenlaan
3, 6703 HA Wageningen, The Netherlands.
*These authors contributed equally to this work
Author for correspondence (e-mail: [email protected])
†
Accepted 6 March 2009
basal embryo domain, where the MONOPTEROS (MP) or
BODENLOS (BDL) gene products have a function in auxin
perception and mutant mp or bdl embryos exhibit pronounced basal
domain defects (Berleth and Jürgens, 1993; Hamann et al., 1999).
Auxin response factors (ARFs) are transcription factors that
regulate the expression of auxin response genes (Guilfoyle and
Hagen, 2007; Guilfoyle et al., 1998). One of the best-studied ARF
family members is MP (Hardtke and Berleth, 1998), mutant alleles
of which show defects in vascular tissue and basal embryo
development (Mayer et al., 1991; Berleth and Jürgens, 1993;
Przemeck et al., 1996). ARFs bind to TGTCTC auxin response
elements (AuxRE) in promoters of auxin-responsive genes
(Ulmasov et al., 1997a) and function in combination with Aux/IAA
(auxin/indole acetic acid) inhibitors, which dimerize with ARF
activators in an auxin-regulated manner and hence modulate ARF
activity (Ulmasov et al., 1997b). The Arabidopsis genome encodes
23 ARFs (Okushima et al., 2005), representing either transcriptional
activators or repressors of auxin response genes, and 29 Aux/IAA
proteins, which allows tremendous theoretical combinatorial
possibilities affecting auxin response on the cellular level (Guilfoyle
and Hagen, 2007). The Arabidopsis embryonic root meristem is
initiated by the specification of a single cell, the hypophysis
(Hamann et al., 1999), which crucially depends on the interaction of
MP with its Aux/IAA inhibitor BDL (Hamann et al., 2002). Both
MP and BDL genes function transiently in a small subdomain of the
pro-embryo adjacent to the future hypophysis, where they promote
transport of auxin and elicit a second non-cell-autonomous signal,
which acts synergistically with auxin to specify hypophysis cell
identity (Weijers et al., 2006). In the last few years, much research
has addressed the regulation of ARF gene/protein expression, their
function in plant growth or development, potential target genes, and
the mechanisms by which they regulate target gene promoters.
However, direct in vivo target genes served by individual ARFs
remain unknown (Lau et al., 2008).
Loss-of-function drn mutants have a bipartite phenotype affecting
both the apical and the basal embryo domain. DRN was initially
identified via a dominant drn-D allele isolated from an activationtagging screen in Arabidopsis, as having a shoot apical meristem
function (Kirch et al., 2003). DRN encodes an AP2/ERF-type
DEVELOPMENT
KEY WORDS: Arabidopsis, Dornroeschen, Auxin response factor, Embryonic patterning, Target gene
1644 RESEARCH ARTICLE
MATERIALS AND METHODS
Construction of transcriptional/translational GFP fusions,
mutagenesis of AuxREs and plant transformation
DRN promoter activity depends on elements upstream and downstream of
the protein-coding region (S. Niczyporuk, Diploma thesis, University of
Cologne, 2003). The expression cassette combines 4864 bp upstream and
1378 bp downstream sequences flanking a unique SmaI/XmaI site. The GFP
or chimeric DRN-GFP coding regions were inserted before transfer into the
binary pGVTV-Asc-BAR vector (Überlacker and Werr, 1996). Mutagenesis
of AuxREs was performed with the GeneEditor in vitro Site-Directed
Mutagenesis System (Promega, Madison). The primers are shown in Table
1. Mutated fragments were assembled in three possible combinations to
restore a functional expression cassette before insertion of the GFP marker
gene. All chimeric gene constructs were inserted into the AscI site of
pGVTV-Asc-BAR for Agrobacterium tumefaciens GV3101-mediated
transformation (Bechtold and Pelletier, 1998). Plants were cultivated on soil
in the greenhouse under long-day (16 hours light/8 hours dark) conditions
at 22°C, and transgenic progeny were selected using resistance against the
herbicide Basta.
Genetic materials and genotyping
EMS mutant mp alleles arf5-1 (N24605) and mp-U55 (N8147) (Mayer et
al., 1991) and the T-DNA insertion allele mp-S319 (N21319) from the SALK
collection (Alonso et al., 2003) were obtained from the NASC European
Arabidopsis Stock Centre. mp mutant alleles were propagated as
heterozygotes and DRN::GFP expression was analysed in the fraction (25%)
of homozygous mp embryos obtained after selfing. Heterozygosity of the
arf5-1 allele was confirmed by PCR on seedlings, whereas transmission of
the mp-U55 allele solely relied on embryonic phenotypes after germination
of F2 seeds.
To obtain mp-U55 drn double mutants, heterozygous mp-S319/+ plants
were crossed with homozygous drn/drn plants, both in Columbia ecotype,
and transmission of the mp-S319 allele was confirmed by genotyping F1
progeny. Independent F2 lines were selected that contained a recombination
event between the linked mp and drn loci, and progeny of the resulting mpS319/+, drn/drn lines were subjected to detailed phenotypic and genetic
analyses in the F3 generation. The primers used for genotyping are included
in Table 1. Paired Student’s t-tests were performed on select phenotypic data
to assess statistical significance.
Details of the construction of the MP-GFP fusion will be described
elsewhere (Alexandra Schlereth and Dolf Weijers, unpublished). In brief,
eGFP was amplified by PCR and inserted into the MlsI restriction site in the
central region of the MP gene within an 8.5 kb genomic fragment that has
been shown to complement the mp mutant (Weijers et al., 2006). The
resulting MP-GFP construct (in pGreenII BASTA) was transformed into
Col-0 Arabidopsis plants, and transgenic plants were selected based on GFP
fluorescence in roots and embryos. Subsequently, one line was selected for
a cross with the mp mutant and analysis of F2 seedlings demonstrated full
complementation of the mutant.
Confocal imaging and histology
GFP expression was monitored using a Leica TCS SP2 confocal laserscanning microscope (CLSM). Earliest embryo stages were analysed still
within the ovule, whereas later stages were isolated. Whole-mount seedlings
were stained with the lipophilic styryl dye FM4-64 (4 μM) in 1% Tween,
130 mM NaCl, 10 mM phosphate buffer (pH 7.5). GFP was excited at 488
nm and emission analysed between 502 and 525 nm. All images were
processed using Adobe Photoshop CS2 software.
Chromatin immunoprecipitation and real-time PCR
For crosslinking, nuclei were prepared from immature siliques (5g),
essentially as described in (Conley et al., 1994), isolated nuclei were
resuspended in nuclear isolation buffer (NIB: 50 mM Hepes pH 7.4, 5 mM
MgCl2, 25 mM NaCl, 5% sucrose, 30% glycerol, 0.1% β-mercaptoethanol)
supplemented with 20 μg/ml plant protease inhibitor cocktail (PPIC; Sigma
P9599), 1 mM Na-orthovanadate and 1 mM NaF (NIBA). Crosslinking was
performed with 1% formaldehyde for 5 minutes at room temperature in
NIBA and stopped by pelleting and resuspending nuclei in NIBA containing
0.1 M glycine. Chromatin was fragmented by micrococcal nuclease
(MNase) digestion (Wagschal et al., 2007) and nuclei were lysed in 10 mM
TRIS pH 7.5, 1 mM EDTA, 0.5% SDS, 20 μg/ml PPIC. An aliquot of
fragmented chromatin served as an input control for the PCR analysis and
the remainder was subjected to immunoprecipitation (Mulholland et al.,
2002). Magnetic bead-coupled anti-GFP antibodies (Miltenyi Biotec) were
used to enrich for MP-GFP-containing chromatin fragments and decrosslinking of ChIP eluate and input control was preceded by a proteinase
K treatment (1 μl/50 μl; Sigma P4580). DNA was purified with
phenol/chloroform, precipitated with ethanol, washed with 70% ethanol and
resuspended in 50 μl 10 mM Tris pH 7.5, 1 mM EDTA. The input control
DEVELOPMENT
transcription factor and maps to chromosome 1 within a larger
chromosomal duplication also containing a paralogue DRN-LIKE
(DRNL) at about 20 cM distance from DRN (Kirch et al., 2003). A
strong drnl allele, drnl-2 or bcm1 (B-Class Modifier 1), also affects
stamen development (Nag et al., 2007). Analysis of drn single
mutants or double mutants between drn and a weak drnl-1 allele
revealed a functional contribution to hypophysis specification in the
globular/early heart-stage embryo; abnormal longitudinal cell
divisions in the suspensor cells subtending the hypophysis led to a
suspensor comprised of multiple parallel cell files. A proportion of
drn drnl-1 double mutants phenocopies mp, a phenotype not
frequently observed in drn or drnl single mutants, with an absence
of the primary root and hypocotyl in the seedling. However,
patterning defects in the apical embryo domain are reflected in a
cotyledon phenotype, which is observed in up to 10% of drn single
mutant seedlings and in 30% of drn drnl double mutant seedlings,
with an additional 20% of drn drnl seedlings showing postgermination basal domain defects. Genetically, DRN and DRNL are
highly redundant during embryonic patterning (Chandler et al.,
2007). This conclusion is validated by protein-interaction studies
showing that both DRN and DRNL interact with Class III HD-ZIP
proteins such as PHAVOLUTA (PHV), PHABULOSA,
REVOLUTA or CORONA and a basic helix-loop-helix-type
transcription factor BIM1 (BES1-interacting myc-like) protein
(Chandler et al., 2007; Chandler et al., 2009). Consistent with the
assumption that these three classes of transcription factors form a
higher-order protein complex, the phenotype of the drn phv bim1
triple mutant implicates all three genes in a single genetic pathway.
DRN acts upstream of auxin signalling/perception or transport, as
drn mutant embryos lack the DR5::GFP maximum in the
hypophysis and upper suspensor cell and the subcellular polar
distribution of PIN1-GFP is randomized and not oriented towards
the hypophyseal cell in the basal domain of the globular embryo as
in wild type (Chandler et al., 2007). A similar deficiency in directed
auxin transport is observed in triple and quadruple mutant
combinations of class III HD-ZIP genes (Prigge et al., 2005),
encoding known interaction partners of DRN. Different lines of
evidence thus support a connection between DRN and auxin
transport or perception although overexpression experiments
functionally link DRN (ESR1) or its paralogue DRNL (ESR2) also to
cytokinins (Banno et al., 2001; Ikeda et al., 2006).
DRN expression, as shown by RNA in situ hybridization, is
dynamic throughout embryogenesis, beginning in the apical cell of
the 2-cell embryo and gradually becoming restricted to the apical
cell lineage (Kirch et al., 2003). Here, we describe a detailed spatial
and temporal analysis of DRN expression in the Arabidopsis embryo
using reporter constructs and show cell-autonomy of the DRN
protein. Point mutations in canonical AuxREs show that upstream
AuxREs are essential for DRN promoter activity in the emerging
cotyledons. DRN expression in mp loss-of-function alleles and
chromatin immunoprecipitation (ChIP) experiments both identify
DRN as a direct target of MONOPTEROS in the embryo.
Development 136 (10)
was diluted 50-fold relative to the ChIP eluate and quantitative PCR analysis
was performed using an Applied Biosystems 7300 Real-Time PCR System
and Power SYBR Green PCR Master Mix (Applied Biosystems) and the
relative amounts of different amplicons were determined by the ΔΔCT
method and normalisation to the open reading frame (ORF) amplicon. All
ChIP primers are included in Table 1 and the relative positions of the
amplicons depicted in Fig. 3.
RESULTS
DRN::GFP expression pattern
The DRN promoter construct comprises 4865 bp upstream from the
DRN translation start and 1378 bp downstream of the stop codon
(Kirch et al., 2003) and its activity depends on the combination of
upstream and downstream elements (S. Niczyporuk, Diploma thesis,
University of Cologne, 2003). In the chimeric DRN::GFP
transcriptional reporter, the GFP-coding region exactly replaces the
DRN ORF from the ATG to the stop codon whereas the GFP ORF
was inserted in front of the DRN translation stop codon to obtain the
DRN::DRN-GFP translational fusion (Fig. 1A); both constructs thus
differ only by the presence or absence of the DRN coding region.
Characteristic DRN::GFP expression patterns from successive
embryonic stages are combined in Fig. 1B-N, and comparison of
these patterns with those from the translational DRN-GFP fusion
showed no substantial differences in expression on the cellular level,
Table 1. Primers used in this study
Primer
Sequence (5⬘ to 3⬘)
AuxRE mutagenesis
Mut ARE-A
check mut-a
Mut ARE-B
check mut-b
Mut ARE-C
check mut-c
Mut ARE-D
check mut-d
Mut ARE-E
check mut-e
GAGAGATTAGGAGCCATTTGATCAGAGC
AGAGTAATAGTAATAAAAGAGTAGTC
TAATTGCTGCTTATTGGCTCATTCAGTCATTTGC
CTATGGTTTCACATAGAGTTGTAACATTTC
CATGAAATACATATATGGCTCATACATACGTTTAG
GTAAGCATCGGGCGATATGGCATGATTATTTC
CAAAAGGCAGTGTTTGGCTCTGTCTTCTCCAAC
GGAAAATTCCTTTGTTCAGCAATGTTGGTATC
GTAATTTAATCTACTGGCTCATATAAGTAGACAAC
GTATGTTTCGTGGTTATTGCGTTGATGTAAC
ChIP analysis
RTnonAREf
RTnonAREr
RT-ARE-Af
RT-ARE-Ar
RT-ARE-Bf
RT-ARE-Br
RT-ARE-Cf
RT-ARE-Cr
RT-ORFf
RT-ORFr
RT-actin2f
RT-actin2r
CCATGGTGGTTTTGGTCTTTAC
TGTATTCAAATTTGTTTGGTTGG
TGCATACATATGAATCTGACCCTA
GAAGAGGAGCAAAATGATCTGC
CAGAATTAACGCAGGGGTTTTA
AAACCATCTACCATGACCATGAC
AACAAGCTTCTGATACATGAAATACA
CGAAGAGGACATTTCAGGTTTG
AACTCTTTCAACGGCTCATCAT
ACGACTCGTTGTTTTCGTTTTC
GTGTTGTTAGCAACTGGGATGA
CTCTTCAGGAGCAATACGAAGC
Genotyping
ARF5f
ARF5r (+LBb1)
MP-S319f
MP-S319r (+LBa1)
DRNf (+SPM8)
DRNr
LBa1salk T-DNA
border
LBb1salk T-DNA
border
Spm8
GGCTATTGAGATATTTTGGC
CATTGAGGATTGAAGAAGCT
GATTTTCCAGATAATTCTGGA
ATGAATATAGTTTCAGGTCTC
ATGGAAAAAGCCTTGAGAAAC
ATCATGATGAATATCTAGCTA
TGGTTCACGTAGTGGGCCATCG
GCGTGGACCGCTTGCTGCAACT
GTTTTGGCCGACACTCCTTAC
RESEARCH ARTICLE 1645
except that the GFP protein was cytosolic whereas the DRN-GFP
fusion protein accumulated more locally and was mostly associated
with the nuclear compartment. Importantly, no evidence was
obtained for trafficking of the DRN-GFP protein into basal
suspensor cells during embryogenesis. However, introduction of the
DRN::DRN-GFP translational fusion transgene into the drn1 drnl
double mutant background resulted in partial complementation of
the basal domain embryo phenotype. Homozygous drn-1 drnl-1
mutant embryos have virtually complete (94%) penetrance of
abnormal cell divisions in the basal embryo and subtending
suspensor domain, which is reduced to 43% (38/89 embryos) in the
presence of the DRN::DRN-GFP transgene; similarly, the
penetrance of the cotyledon phenotype in the seedling is reduced
from 50 to 7% in this complementation experiment. The DRN-GFP
fusion protein therefore is at least partially functional, and the cellautonomous activity in the apical embryo domain is sufficient for
significant rescue of basal domain defects. In consequence, aberrant
cell divisions in the basal cell lineage of drn mutant embryos
probably relate to a secondary non-cell-autonomous signal
downstream of DRN.
The DRN::GFP transcriptional reporter and the DRN::DRN-GFP
translational fusion were expressed throughout the 2-, 4-, 8- or 16cell embryo proper (Fig. 1B-G). From the 32-cell stage onwards,
DRN::GFP expression was no longer detected in the basal domain,
which gives rise to hypocotyl and primary root (Fig. 1H,I), and two
discrete expression maxima became evident in the apical domain of
the late globular embryo, which mark the positions of the
prospective cotyledons (Fig. 1J). During the late heart stage, both
DRN::GFP and DRN::DRN-GFP expression was restricted to the
tips of the cotyledons, with no expression observed in the sinus
between the cotyledons or in the prospective SAM (Fig. 1K; data not
shown). DRN expression was activated in the SAM during the
torpedo stage (Fig. 1L,M). Subsequently, expression ceased in the
cotyledon tips, whereas expression in the SAM continued during
later embryonic stages. At the cellular level, DRN::GFP showed a
dynamic expression pattern at the SAM periphery, where expression
was occasionally observed to extend laterally into a single cell
outside the central expression domain of the SAM. This expression
was observed in single cells at either flank of the SAM, at positions
where the first leaf primordium will be initiated (Fig. 1N), or marked
positions of incipient leaf primordia in the germinating seedling
(Fig. 1O). DRN::GFP expression persisted in the L1 layer of the
developing leaf during early development (Fig. 1O).
Point mutations in AuxREs alter DRN::GFP
expression
Differences in auxin transport or signalling/perception observed in drn
mutant embryos compared to wild type (Chandler et al., 2007),
suggested an analysis of functional contribution of five canonical
TGTCTC AuxRE motifs, three of which are located in the DRN 4.8
kb upstream region, and two downstream of the coding sequence (Fig.
2A). Point mutations were introduced into each canonical AuxRE
motif (TGTCTC to TGgCTC) and three classes of transgenic
Arabidopsis plants were raised carrying either mutations in all five
AuxRE motifs (abcde) or mutations in the three upstream (abc) or the
two downstream motifs (de). This T-to-G mutation in the AuxRE
motif has been shown to eliminate binding of ARFs (Ulmasov et al.,
1999). Point mutations in AuxRE motifs had no effect on DRN
expression during early stages of embryogenesis, based on data from
at least three independent transgenic lines (Fig. 2C,D). However, at
the torpedo (Fig. 2E) and early walking-stick stage (Fig. 2F), AuxRE
mutations in the upstream motifs (abcde or abc) abolished DRN::GFP
DEVELOPMENT
DORNRÖSCHEN an in vivo target of MONOPTEROS
1646 RESEARCH ARTICLE
Development 136 (10)
expression in the tips of the cotyledons. Therefore, at least one, or a
combination of AuxRE motifs upstream of the coding region, are
essential to maintain DRN promoter activity in the tips of the
cotyledons. DRN::GFP expression in the tips of the cotyledons also
coincided with a high auxin concentration/perception maximum as
monitored by DR5::GFP (Fig. 2B). By contrast, mutations in the
downstream AuxREs alone (de) had little effect on the DRN::GFP
expression pattern in the embryo, although the restriction of
DRN::GFP activity into the apical domain during the globular stage
appeared delayed relative to that in transgenic lines containing the
non-mutated promoter construct (Fig. 2D).
Canonical AuxRE motifs are not required for DRN expression
maxima at the position of the incipient cotyledons during the late
globular stage of embryogenesis (Fig. 2D) and the expression of
DRN::GFP in single cells extending from the SAM periphery was
similarly not affected by mutations in upstream AuxREs. Positional
information relating to DRN expression is thus also perceived in the
absence of functional canonical AuxREs during cotyledon
specification and at the SAM periphery.
MONOPTEROS controls DRN::GFP expression in the
tips of the cotyledons
Based on the AuxRE function in the DRN promoter, it was tempting
to search for a potentially interacting ARF. Cotyledon and basal
domain defects, which are characteristic for drn mutants, are shared
with homozygous mp embryos. We therefore crossed the DRN::GFP
marker into two mp mutant backgrounds; the mp-U55 allele (Mayer
et al., 1991) and the arf5-1 T-DNA insertion allele (Okushima et al.,
2005) from the SALK collection. In both mp backgrounds, which
were propagated as heterozygotes, DRN::GFP expression in the tips
of the cotyledons was abolished in segregating homozygous mutant
embryos (25% of progeny) from the heart stage onwards, whereas
other DRN::GFP expression domains e.g. during early embryogenesis
or in the SAM, remained unaffected. Phenotypic mp embryos at the
late torpedo stage showed no DRN::GFP expression in cotyledon tips,
whereas expression in the SAM was unaffected (Fig. 3A-C). As the
mp mutant often has cotyledon defects, the DRN::GFP expression
pattern in mp mutant embryos was difficult to compare with wild type
or AuxRE-mutated DRN promoter versions, where it pre-patterns
DEVELOPMENT
Fig. 1. Dynamics of DRN expression in the embryo and germinating seedlings. (A) Schematic of the DRN::GFP transcriptional and DRN::DRNGFP translational fusions. (B-D) DRN::GFP expression in the apical cell of the early embryo (B) and restriction to the apical cell lineage in 4-cell
embryos (C) (subtending non-expressing suspensor cells are outlined in B and C) or 8-cell embryos (D). (E) Cell autonomy of the DRN-GFP fusion
protein at the 8-cell stage. (F-I) Comparison of DRN::GFP and DRN::DRN-GFP expression patterns in early (F,G) and late (H,I) globular stage embryos.
The focus of the DRN-GFP fusion protein into the apical hemisphere presumably relates to the stability of the chimeric protein relative to that of the
GFP marker. (J,K) Focussing of DRN::GFP expression to the prospective cotyledons at the late globular (J) and early heart (K) stage. (L,M) Expression
patterns of the transcriptional DRN::GFP (L) and translational DRN::DRN-GFP (M) fusion in torpedo-stage embryos. Note DRN promoter activity in
the SAM, which is absent during the heart stage (compare with K). (N) Lateral expression of DRN::GFP in a single cell extending laterally from the L1
layer at the position of an incipient leaf primordium in the torpedo-stage embryo. Inset, close-up of the SAM region showing a single GFPexpressing cell at the lateral flank. (O) A similar occurrence in the vegetative SAM of a two-leaf stage seedling. The frontal cotyledon has been
removed and the first two leaf primordia are emerging on both sides of the SAM. The large cells above the leaf primordia belong to the remaining
cotyledon at the back. Note DRN::GFP activity in the L1 layer of the leaf primordia (O) or the cotyledons (N). Scale bars: 20 μm.
DORNRÖSCHEN an in vivo target of MONOPTEROS
RESEARCH ARTICLE 1647
cotyledon initiation. In phenotypic heart-stage mp mutant embryos,
DRN::GFP expression was highest in the L1 layer, with expression
also found throughout the SAM (compare Fig. 3D with 3E). Although
DRN::GFP expression was confined to the L1 layer of the apical
embryo domain and to the prospective cotyledons, it was
downregulated in wild type irrespective of the presence of functional
AuxREs; however, in the mp mutant background, DRN::GFP
apparently remained active in the SAM.
The lack of DRN::GFP expression in the cotyledon tips in the
absence of MP activity exactly recapitulates the results obtained
from point mutations in upstream AuxREs of the DRN promoter.
Apparently, MP provides a unique ARF function essential for DRN
transcription in the tips of the embryonic cotyledons, which is not
masked by redundancy among other members of the ARF family of
transcription factors.
MONOPTEROS interacts with the DRN promoter in
vivo
To test whether the regulation of DRN expression by MP involves
direct binding of MP to the DRN promoter, we performed ChIP
experiments with a transgenic MP::MP-GFP line expressing a
functional MP-GFP fusion protein driven from the MP promoter
(Fig. 3F,G). Immature siliques of transgenic MP::MP-GFP lines
containing heart-stage embryos were collected and used for ChIP
experiments, as outlined in Materials and methods. Anti-GFP
antibodies coupled to magnetic beads were used to precipitate MPbound DNA fragments, and the enrichment of upstream or
downstream DRN promoter sequences via ChIP was analysed and
quantified by real-time PCR. The position of the different PCR
amplicons in the DRN upstream or coding region is indicated in
Fig. 3H. The bar diagram (Fig. 3I) shows the relative levels of
individual PCR amplicons obtained in two independent ChIP
experiments according to triplicate real-time qPCR normalized to
an amplicon located in the DRN ORF. A control fragment in the
promoter upstream region lacking any AuxRE (nonARE) was
amplified to a similar level to that of the most distal AuxRE A. By
contrast, AuxRE B and AuxRE C, which are proximal to the DRN
transcription start site were selectively enriched in independent
ChIP experiments. Within individual experiments, the enrichment
of AuxRE B (about 12-fold) exceeded that of AuxRE C (about 5fold), suggesting that binding of AuxRE B to MP may either be
stronger or more frequent than to AuxRE C. The ChIP experiments
thus confirm the physical interaction of MP to two promoter
regions spanning canonical AuxRE motifs proximal to the
transcription start in the DRN upstream promoter region. Taken
together, the combination of ChIP with the effect of point
mutations in AuxREs in the DRN promoter and the DRN::GFP
expression pattern in the mp mutant background confirms that
DRN is a direct target of MP in the tips of the cotyledons during
embryogenesis.
DEVELOPMENT
Fig. 2. Functional contribution of AuxREs in the DRN
upstream and downstream region. (A) Position of AuxREs
upstream or downstream of the DRN coding region, which is
replaced by GFP in the DRN::GFP construct. Canonical AuxREs
are indicated by capital letters (A,B,C,D,E) in the wild type;
mutated AuxREs are indicated by crosses in the individual
constructs depicted beneath and denoted by lowercase letters.
(B) DR5::GFP expression in late heart-stage embryos showing
auxin concentration/perception maxima in the tips of the
cotyledons and in the embryonic root. (C-F) Comparison of GFP
expression obtained with the three AuxRE mutated constructs
depicted in A relative to the non-mutated DRN::GFP
transcriptional fusion at different stages of embryo
development: (C) globular stage, (D) early heart stage, (E) late
heart/early torpedo stage, (F) late torpedo stage. Note the
absence of DRN::GFP expression in cotyledon tips later than
heart stage (E or F) when upstream elements are mutated
(constructs abc or abcde), which contrasts with the marking of
the prospective cotyledons in D.
1648 RESEARCH ARTICLE
Development 136 (10)
Fig. 3. Molecular and genetic interactions between MP and DRN. (A-C) DRN::GFP expression pattern in wild-type embryos (A) as compared
with in the mp-U55 (B) or arf5-1 (C) mutant backgrounds. Note GFP activity in the SAM in both wild-type and mutant embryos, but the absence of
expression in the tips of cotyledons in both mp mutant backgrounds. (D,E) Downregulation of DRN::GFP in the SAM of early heart-stage wild-type
embryos (D) as compared with a continuous stripe of DRN::GFP activity from the cotyledons through the SAM in mp-U55 mutant embryos (E).
(F,G) MP::MP-GFP expression in early (F) or late (G) heart-stage embryos showing a broad expression domain in apical and basal regions, including
the vasculature. (H) Schematic of the DRN gene showing the upstream region and transcriptional unit (box), AuxRE positions (ovals) and the
position of PCR amplicons in the promoter or coding region. (I) Results of two independent ChIP experiments performed with nuclei from immature
siliques containing heart-stage embryos. The relative levels of PCR amplicons are depicted, as estimated by real-time PCR and normalized to the
DRN ORF amplicon. AuxRE-B and AuxRE-C, which lie proximal to the DRN transcription start site, are selectively amplified. By contrast, chromatin
templates spanning the distal AuxRE-A or the noARE amplicons are present at levels similar to those for the DRN ORF. Bars indicate the variation in
three independent real-time PCR replicates performed for each ChIP experiment. Scale bars: 20 μm.
DISCUSSION
DRN transcription pattern and the contribution of
canonical AuxREs
The DRN promoter is activated after the first zygotic division and
DRN transcription in the apical cell coincides with acropetal auxin
transport in the 2-cell Arabidopsis embryo (Friml et al., 2003),
although the effect of point mutations in canonical AuxRE motifs in
the DRN promoter does not suggest that transcription is controlled by
auxin before the heart stage. Canonical AuxREs are not relevant for
dynamic changes in DRN expression during the globular stage when
DRN promoter activity is lost in the basal embryo domain or when
expression maxima are established at the position of the prospective
cotyledons. These results are consistent with the genetically defined
role of DRN upstream of auxin transport or perception in the early
Arabidopsis embryo (Chandler et al., 2007). However, they by no
Fig. 4. Genetic interactions between mp and drn mutant alleles.
(A) The mp basal domain defect, (B) the absence of the seedling root
and presence of a single cotyledon and (C) the pin-like inflorescence
phenotype. For frequencies see Table 2.
DEVELOPMENT
Genetic interaction between mp and drn
To test for genetic interactions between mp and drn, we created
double mutants using a weak mp-S319 allele from the SALK
collection (Alonso et al., 2003). MP is located on chromosome 1
(27.6 cM) in the interval between DRN (19.2 cM) and DRNL (39.0
cM); this linkage necessitated a recombination event between drn
and mp in order for mp to be propagated as a heterozygote in a drn
mutant background. In a population segregating for mp but
homozygous for drn, double mutant progeny should comprise a
25% fraction. The penetrance of seedling and inflorescence
phenotypes was determined for progeny of six independent mp/MP
drn/drn lines (Fig. 4; Table 2). The mp-S319 allele either showed a
lowly penetrant embryonic pattern phenotype reflected in the
absence of the basal seedling domain (Berleth and Jürgens, 1993) or
a pin-like inflorescence phenotype (Przemeck et al., 1996), and
together both phenotypes were fully penetrant, corresponding to the
expected 25% fraction. In lines homozygous for drn and also
segregating for mp, the penetrance of either the mp basal domain
seedling (Fig. 4A,B) or inflorescence phenotype (Fig. 4C) was not
statistically different to that of mp single mutants, and the frequency
of the drn cotyledon phenotype was significantly reduced
(P<0.001), thus confirming that the penetrance of characteristic drn
cotyledon defects is dependent on MP function and that the mp
phenotype is epistatic to that of drn. The absence of additivity of
phenotypic penetrance or novel phenotypes together with the
epistasis of mp over drn, supports the assumption that MP and DRN
are in a linear pathway and that MP is a positive upstream activator
of DRN.
DORNRÖSCHEN an in vivo target of MONOPTEROS
RESEARCH ARTICLE 1649
means exclude a contribution of non-canonical auxin response motifs
to the regulation of early embryonic DRN expression, as it is still not
clear how degenerate the consensus TGTCTC sequence can be to
serve as a functional AuxRE in planta (Guilfoyle and Hagen, 2007).
There is also no contribution of AuxREs to the activation of DRN
transcription in the SAM at the late heart stage; DRN expression is
still absent from the SAM when meristem markers such as
WUSCHEL (WUS) (Mayer et al., 1998) and SHOOT
MERISTEMLESS (STM) (Long and Barton, 1998) have already
been activated. The late onset of DRN activity in the SAM only
towards the end of the heart stage implies that DRN function may
not directly contribute to SAM anlage. At the SAM periphery, the
DRN::GFP marker reveals strikingly dynamic DRN promoter
activity: from the group of 6-8 L1 layer cells permanently expressing
DRN::GFP in the SAM centre, expression is often observed in
single cells extending laterally from the flank of the stem cell zone
at the position of the next incipient leaf primordium. Persisting
DRN::GFP expression in the L1 layer of emerging leaf primordia
makes it tempting to interpret these single DRN::GFP-expressing
cells as evidence for anlagen of new leaf primordia, which in the
close Arabidopsis relative Cardamine hirsuta trace back to as few
as two cells (Barkoulas et al., 2008). The initiation of lateral organs
is dependent on the polar transport of auxin into incipient primordia
(Reinhardt et al., 2003), however, it remains to be determined
whether this transport already occurs as early as the observed
DRN::GFP expression in single cells lateral to the SAM in embryo
or seedling. This lateral expansion of DRN::GFP transcription is
also independent of canonical AuxREs, suggesting that positional
information monitored by DRN promoter activity at the SAM
periphery might not rely on auxin signalling. This situation is
reminiscent of the late globular embryo when two DRN::GFP
expression maxima are established at the positions of the prospective
cotyledons despite mutations in upstream AuxREs (Fig. 2D, abc or
abcde). However, functional AuxREs in the DRN promoter
upstream region are indispensable for the maintenance of
DRN::GFP expression in the tips of the cotyledons during the heart
and torpedo stage of embryo development. The selectivity of
individual DRN promoter element function on the cellular level is
extremely striking; they regulate only a very specific aspect of DRN
transcription in the embryo. Although DRN genetically acts
upstream of auxin (Chandler et al., 2007) in the embryo, point
mutations in AuxREs provide clear evidence for a feedback control
via auxin signalling.
The expression patterns of the promoter DRN::GFP and protein
fusion DRN::DRN-GFP constructs were essentially comparable,
thus providing no evidence for intercellular trafficking of the DRN
protein, e.g. from the apical to the basal domain of the embryo.
Therefore, DRN apparently acts cell-autonomously in the
Arabidopsis embryo. The absence of a DR5::GFP maximum in the
hypophyseal region and aberrant cell divisions in the root/suspensor
associated with drn loss of function therefore either relate to defects
in auxin signalling or must be explained by another non-cellautonomous signal downstream of DRN, as it is also discussed for
mp mutants (Weijers et al., 2006).
Molecular and genetic interactions
Three complementary findings support the idea that DRN is a direct
target of MP: the results of point mutations in AuxREs, the
DRN::GFP expression pattern in an mp mutant background and ChIP
experiments, which confirm the physical interaction of MP with two
small promoter fragments containing AuxREs proximal to the DRN
transcription start site. The strict dependence of DRN::GFP expression
in the tips of the cotyledons on canonical AuxREs in the promoter
upstream region and a functional MP allele is notable, considering that
MP is a member of the Arabidopsis ARF gene family comprised of
23 members with inherent redundancy. A functional overlap between
MP/ARF5 and NPH4/ARF7 during cotyledon development has been
reported (Hardtke et al., 2004). However, this is incompatible with the
absence of DRN::GFP activity in the tips of the cotyledons obtained
in the mp-U55 (Mayer et al., 1991) and the arf5-1 (Okushima et al.,
2005) alleles, which show that MP is unique in promoting
transcriptional activity of the DRN promoter in the tips of the
Total seedling
phenotype penetrance (%)
drn cotyledon
phenotype penetrance (%)
mp seedling
phenotype penetrance (%)
mp inflorescence
phenotype penetrance (%)
1
2
3
4
5
6
7.04
13.27
9.55
12.63
13.91
10.40
11.23±2.62
1.53
2.81
2.59
2.55
3.08
2.17
2.46±0.54
5.51
10.46
6.96
10.08
10.83
8.23
8.68±1.96
21.59
15.32
18.52
14.29
13.46
17.62
16.80±3.04
1
2
3
4
5
6
13.68
8.60
8.93
11.06
6.31
14.39
10.50±3.14
0.50
0.27
0.19
0.00
0.08
0.26
0.22±0.17
13.18
8.33
8.74
11.06
6.23
14.13
10.35±3.15
9.89
14.17
17.00
11.13
15.40
13.30
13.48±2.65
9.86
8.80
11.53
9.95
9.54
9.44
9.85±0.92
0.12
0.10
0
0
0
0
0.04±0.06
Parental genotype
Line
drn drn/MP mp
Mean±s.d.
MP mp
Mean±s.d.
drn drn
1
2
3
4
5
6
Mean±s.d.
The mp-S319 allele is propagated heterozygously.
DEVELOPMENT
Table 2. The penetrance of seedling and inflorescence phenotypes obtained in six independent mp/MP drn/drn lines in
comparison to frequencies characteristic for mp and drn single mutants
cotyledons, and therefore that other ARF family members, including
NPH4/ARF7, cannot compensate for the loss of MP function with
respect to DRN::GFP transcription in a few apical cells of the
emerging cotyledons in heart- or torpedo-stage embryos.
As striking as the strict dependence of DRN::GFP transcription
on MP in the tips of the cotyledons is the fact that this is very local,
comprising only a small subfraction of the DRN (Fig. 1) or MP
(Hardtke and Berleth, 1998) expression domains in the embryo.
Apparently, MP is not sufficient alone to activate DRN::GFP outside
the apical tip of the cotyledons. It is known that ARFs are under
control of Aux/IAA proteins (Ulmasov et al., 1997b); for example,
MP binds to BDL and both enter the nuclear compartment (Weijers
et al., 2006). MP might bind DNA targets (Lau et al., 2008) including
AuxREs in the DRN promoter more widely as a heterodimer with
BDL. However, to effect transcriptional activation, MP has to be
released from BDL repression, which requires the nuclear SCFTIR1
complex and high auxin concentrations (Mockaitis and Estelle,
2008; Tan et al., 2007), as can be reflected in DR5::GFP activity in
the tips of the cotyledons (see Fig. 2B). Apart from MP modulation
by BDL and auxin, the TOPLESS co-repressor restricts MP
activity during embryogenesis (Szemenyei et al., 2008) or
heterodimerization with other ARFs might result in altered DNA
target-site specificity (Kim et al., 1997; Ulmasov et al., 1997a).
Although MP is capable of forming heterodimers with NPH4/ARF7
(Hardtke et al., 2004), the overlap of the MP or NPH4 expression
domains throughout the embryonic vasculature cannot explain the
local response of DRN::GFP in the tips of the cotyledons. Possibly,
additional cis or trans elements have to converge for a positive
transcriptional read-out from the DRN promoter with the differential
response of AuxREs. However, the specific loss of DRN::GFP
activity at the tips of the cotyledons in mp single mutant
backgrounds unequivocally demonstrates that MP is unique among
the ARF gene family in controlling DRN transcription.
According to point mutations and ChIP experiments, at least two
AuxREs proximal to the DRN transcriptions start site are potential
DNA target sites for the MP protein. AuxREs have been repeatedly
identified in available genome sequences and functionally supported
by transcriptome analyses, but the descriptions of specific auxindependent events that depend on protein-DNA interactions between
an individual member of the ARF family and specific target gene
promoters have remained elusive in vivo (Guilfoyle and Hagen,
2007; Lau et al., 2008), although NPH4/ARF7 has been shown in
vitro to interact with AuxRE-containing fragments of the LATERAL
ORGAN BOUNDARIES DOMAIN16 (LBD) or LBD29 gene
promoters (Okushima et al., 2007). The identification of DRN as a
bona fide target of MP, the unique role of MP in controlling DRN
expression at the tip of the embryonic cotyledons, possibly in
response to auxin, and the suitability of the Arabidopsis embryo for
live imaging should now facilitate studies on the cellular and
molecular level.
The genetic epistasis of the mp mutant phenotype over that of drn,
together with the absence of any additive phenotypic effects in either
penetrance or novel phenotypes in the double mutant supports a
genetic hierarchy whereby MP is a positive regulator of DRN (Avery
and Wasserman, 1992). This genetic interaction is somewhat difficult
to explain relative to transcriptional control exerted by MP at the
DRN promoter, which affects only a single and rather late aspect of
DRN expression involving only a minority of MP-expressing cells.
More penetrant phenotypes in drn and mp single mutants are basal
domain defects; similarly to mp or bdl mutants, drn mutant embryos
lack the DR5::GFP auxin concentration/perception maximum in the
hypophysis (Chandler et al., 2007). Concerning basal domain defects,
Development 136 (10)
MP and DRN act in different functional hierarchies; whereas mp
mutant embryos exhibit reduced PIN1::PIN-GFP expression levels
(Weijers et al., 2006), drn embryos show alterations in the
intracellular compartmentation of the PIN1-GFP fusion protein in
terms of membrane polarity compared with wild type (Chandler et
al., 2007). By contrast, mono- or polycotyledony or cotyledon fusion,
which are characteristic for drn mutant seedlings and which are
reduced in drn mp double mutants, reflect aberrant specification of
cells in the apical embryo domain.
The dependence of DRN on MP in terms of embryonic patterning
might be functionally addressed in more depth by ectopic expression
of DRN in the mp mutant background. This, however, is difficult to
perform and of questionable relevance for several reasons: firstly,
35S::DRN transgenic plants are inhibited in shoot formation (Banno
et al., 2001) and the dominant drn-1D allele results in a phenotype
only late in seedling development (Kirch et al., 2003) and only
extremely rarely exhibits cotyledon defects (Chandler et al., 2007).
Additionally, redundancy between DRN and DRNL might mask part
of the interaction between MP and DRN; drn drnl double mutants
exhibit cotyledon defects at 50% penetrance, but it is still unknown
whether DRNL can substitute for DRN function or whether the
DRNL promoter is also under control of MP. Finally, MP maps on
chromosome 1 within the 20 cM interval between DRN and DRNL
and so is tightly linked to both, and we have so far failed to establish
a triple mutant.
In the mp background, the DRN::GFP expression pattern is
altered such that, in contrast to wild type, transcription in the future
SAM region is not downregulated between the prospective
cotyledons (compare Fig. 3D with 3E). Similar ectopic DRN
promoter activity is not observed with point mutations in canonical
AuxREs in the DRN promoter; by contrast, DRN::GFP activity
initially marks the prospective cotyledons but is lost in both mp
mutant embryos and following mutation of upstream DRN promoter
ARFs. This unique role of MP at the DRN promoter and at the tips
of the cotyledons coincides with a local maximum of YUCCA4
monooxygenase (Cheng et al., 2007), and thus local auxin
biosynthesis, together with auxin maxima or response peak as
monitored via DR5::GFP (see Fig. 2B). Exactly how the AP2-type
transcription factor DRN functionally integrates into the embryonic
patterning programme remains elusive; however, the deficiencies in
PIN1-GFP polarization in drn mutants strongly implicate auxin
transport, which might be initially direct auxin into cotyledon
anlagen similarly to into incipient leaf primordia (Reinhardt et al.,
2003) and contribute to an MP-dependent auxin maximum at the
apical tip of the developing cotyledons. Conceivably, an auxin
feedback loop here could control cotyledon outgrowth but also cause
cellular ambiguities in the apical embryo domain, which is manifest
in cotyledon defects in drn seedlings. By contrast, the epistasis of
the mp phenotype over that of drn could reside in an altered cellular
competence for the functional separation of cotyledons or their
subsequent morphogenesis, which is implied by the altered
DRN::GFP expression in mp mutants. Additional contributions to
cotyledon development are suggested by cotyledon defects in pid
(Bennett et al., 1995), polar transport double mutants such as pin4
pin7 (Friml et al., 2003) or the cuc mutants (Aida et al., 1997; Aida
et al., 1999), most of these being lowly penetrant.
In summary, genetic and molecular evidence identify DRN as a
direct target gene of MONOPTEROS in the tips of the embryonic
cotyledons in the Arabidopsis embryo. All data merge on the
conclusion that two canonical AuxREs proximal to the DRN
transcription start site serve as in vivo targets for MP, which now
facilitates molecular studies on the specificity of auxin signalling on
DEVELOPMENT
1650 RESEARCH ARTICLE
the cellular, individual ARF and target gene level. DRN, encoding
an AP2 family transcription factor, is a particularly intriguing target
as it apparently acts upstream and downstream of auxin, is
associated with the apical cell fate after the first zygotic division and
perceives positional information at the flank of the stem-cell
population, which relates to the initiation of new lateral organs.
This work was funded by the Deutsche Forschungsgemeinschaft through SFB
572 (M.C., J.C., B.J., P.C. and W.W.) and by the Dutch Organisation for
Scientific Research (NWO; ALW-VIDI grant 864.06.012 to D.W.).
References
Aida, M., Ishida, T., Fukaki, H., Fujisawa, H. and Tasaka, M. (1997). Genes
involved in organ separation in Arabidopsis: an analysis of the cup-shaped
cotyledon mutant. Plant Cell 9, 841-857.
Aida, M., Ishida, T. and Tasaka, M. (1999). Shoot apical meristem and cotyledon
formation during Arabidopsis embryogenesis: interaction among the CUPSHAPED COTYLEDON and SHOOT MERISTEMLESS genes. Development 126,
1563-1570.
Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J., Chen, H., Shinn, P.,
Stevenson, D. K., Zimmerman, J., Barajas, P., Cheuk, R. et al. (2003).
Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301,
653-657.
Avery, L. and Wasserman, S. (1992). Ordering gene function: the interpretation
of epistasis in regulatory hierarchies. Trends Genet. 8, 312-316.
Banno, H., Ikeda, Y., Niu, Q. W. and Chua, N. H. (2001). Overexpression of
Arabidopsis ESR1 induces initiation of shoot regeneration. Plant Cell 13, 26092618.
Barkoulas, M., Hay, A., Kougioumoutzi, E. and Tsiantis, M. (2008). A
developmental framework for dissected leaf formation in the Arabidopsis
relative Cardamine hirsuta. Nat. Genet. 40, 1136-1141.
Bechtold, N. and Pelletier, G. (1998). In planta Agrobacterium-mediated
transformation of adult Arabidopsis thaliana plants by vacuum infiltration.
Methods Mol. Biol. 82, 259-266.
Bennett, S. R. M., Alvarez, J., Bossinger, G. and Smyth, D. R. (1995).
Morphogenesis in pinoid mutants of Arabidopsis thaliana. Plant J. 8, 505-520.
Berleth, T. and Jürgens, G. (1993). The role of the monopteros gene in
organising the basal body region of the Arabidopsis embryo. Development 118,
575-587.
Chandler, J. W., Cole, M., Flier, A., Grewe, B. and Werr, W. (2007). The AP2
transcription factors DORNRÖSCHEN and DORNRÖSCHEN-LIKE redundantly
control Arabidopsis embryo patterning via interaction with PHAVOLUTA.
Development 134, 1653-1662.
Chandler, J. W., Nardmann, J. and Werr, W. (2008). Plant development revolves
around axes. Trends Plant Sci. 13, 78-84.
Chandler, J. W., Cole, M., Flier, A. and W. W. (2009). BIM1, a bHLH protein
involved in brassinosteroid signalling, controls Arabidopsis embryonic patterning
via interaction with DORNROESCHEN and DORNROESCHEN-LIKE. Plant Mol.
Biol. 69, 57-68.
Cheng, Y., Dai, X. and Zhao, Y. (2007). Auxin synthesized by the YUCCA flavin
monooxygenases is essential for embryogenesis and leaf formation in
Arabidopsis. Plant Cell 19, 2430-2439.
Conley, T. R., Park, S. C., Kwon, H. B., Peng, H. P. and Shih, M. C. (1994).
Characterization of cis-acting elements in light regulation of the nuclear gene
encoding the A subunit of chloroplast isozymes of glyceraldehyde-3-phosphate
dehydrogenase from Arabidopsis thaliana. Mol. Cell. Biol. 14, 2525-2533.
Friml, J., Vieten, A., Sauer, M., Weijers, D., Schwarz, H., Hamann, T.,
Offringa, R. and Jürgens, G. (2003). Efflux-dependent auxin gradients
establish the apical-basal axis of Arabidopsis. Nature 426, 147-153.
Guilfoyle, T. J. and Hagen, G. (2007). Auxin response factors. Curr. Opin. Plant
Biol. 10, 453-460.
Guilfoyle, T. J., Ulmasov, T. and Hagen, G. (1998). The ARF family of
transcription factors and their role in plant hormone-responsive transcription.
Cell Mol. Life Sci. 54, 619-627.
Hamann, T., Mayer, U. and Jürgens, G. (1999). The auxin-insensitive bodenlos
mutation affects primary root formation and apical-basal patterning in the
Arabidopsis embryo. Development 126, 1387-1395.
Hamann, T., Benkova, E., Baurle, I., Kientz, M. and Jürgens, G. (2002). The
Arabidopsis BODENLOS gene encodes an auxin response protein inhibiting
MONOPTEROS-mediated embryo patterning. Genes Dev. 16, 1610-1615.
Hardtke, C. S. and Berleth, T. (1998). The Arabidopsis gene MONOPTEROS
encodes a transcription factor mediating embryo axis formation and vascular
development. EMBO J. 17, 1405-1411.
Hardtke, C. S., Ckurshumova, W., Vidaurre, D. P., Singh, S. A., Stamatiou, G.,
Tiwari, S. B., Hagen, G., Guilfoyle, T. J. and Berleth, T. (2004). Overlapping
and non-redundant functions of the Arabidopsis auxin response factors
MONOPTEROS and NONPHOTOTROPIC HYPOCOTYL 4. Development 131,
1089-1100.
RESEARCH ARTICLE 1651
Ikeda, Y., Banno, H., Niu, Q. W., Howell, S. H. and Chua, N. H. (2006). The
ENHANCER OF SHOOT REGENERATION 2 gene in Arabidopsis regulates CUPSHAPED COTYLEDON 1 at the transcriptional level and controls cotyledon
development. Plant Cell Physiol. 47, 1443-1456.
Jenik, P. D., Gillmor, S. and Lukowitz, W. (2007). Embryonic patterning in
Arabidopsis thaliana. Annu. Rev. Cell Dev. Biol. 23, 207-236.
Jürgens, G. (1992). Pattern formation in the flowering plant embryo. Curr. Opin.
Genet. Dev. 2, 567-570.
Jürgens, G. (1995). Axis formation in plant embryogenesis: cues and clues. Cell
81, 467-470.
Kim, J., Harter, K. and Theologis, A. (1997). Protein-protein interactions among
the Aux/IAA proteins. Proc. Natl. Acad. Sci. USA 94, 11786-11791.
Kirch, T., Simon, R., Grunewald, M. and Werr, W. (2003). The
DORNRÖSCHEN/ENHANCER OF SHOOT REGENERATION1 Gene of Arabidopsis
acts in the control of meristem cell fate and lateral organ development. Plant
Cell 15, 694-705.
Lau, S., Jürgens, G. and De Smet, I. (2008). The evolving complexity of the auxin
pathway. Plant Cell 20, 1738-1746.
Long, J. A. and Barton, M. K. (1998). The development of apical embryonic
pattern in Arabidopsis. Development 125, 3027-3035.
Mayer, K. F., Schoof, H., Haecker, A., Lenhard, M., Jürgens, G. and Laux, T.
(1998). Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot
meristem. Cell 95, 805-815.
Mayer, U., Torres Ruiz, R. A., Berleth, T., Miséra, S. and Jürgens, G. (1991).
Mutations affecting body organization in the Arabidopsis embryo. Nature 353,
402-407.
Mockaitis, K. and Estelle, M. (2008). Auxin receptors and plant development: a
new signaling paradigm. Annu. Rev. Cell Dev. Biol. 24, 55-80.
Mulholland, D. J., Cheng, H., Reid, K., Rennie, P. S. and Nelson, C. C. (2002).
The androgen receptor can promote β-catenin nuclear translocation
independently of adenomatous polyposis coli. J. Biol. Chem. 277, 17933-17943.
Nag, A., Yang, Y. and Jack, T. (2007). DORNRÖSCHEN-LIKE, an AP2 gene, is
necessary for stamen emergence in Arabidopsis. Plant Mol. Biol. 65, 219-232.
Okushima, Y., Overvoorde, P. J., Arima, K., Alonso, J. M., Chan, A., Chang,
C., Ecker, J. R., Hughes, B., Lui, A., Nguyen, D. et al. (2005). Functional
genomic analysis of the AUXIN RESPONSE FACTOR gene family members in
Arabidopsis thaliana: unique and overlapping functions of ARF7 and ARF19.
Plant Cell 17, 444-463.
Okushima, Y., Fukaki, H., Onoda, M., Theologis, A. and Tasaka, M. (2007).
ARF7 and ARF19 regulate lateral root formation via direct activation of LBD/ASL
genes in Arabidopsis. Plant Cell 19, 118-130.
Prigge, M. J., Otsuga, D., Alonso, J. M., Ecker, J. R., Drews, G. N. and Clark,
S. E. (2005). Class III homeodomain-leucine zipper gene family members have
overlapping, antagonistic, and distinct roles in Arabidopsis development. Plant
Cell 17, 61-76.
Przemeck, G. K., Mattsson, J., Hardtke, C. S., Sung, Z. R. and Berleth, T.
(1996). Studies on the role of the Arabidopsis gene MONOPTEROS in vascular
development and plant cell axialization. Planta 200, 229-237.
Reinhardt, D., Pesce, E. R., Stieger, P., Mandel, T., Baltensperger, K., Bennett,
M., Traas, J., Friml, J. and Kuhlemeier, C. (2003). Regulation of phyllotaxis by
polar auxin transport. Nature 426, 255-260.
Scheres, B., Wolkenfeldt, H., Willemsen, V., Terlouw, M., Lawson, E., Dean,
C. and Weisbeek, P. (1994). Embryonic origin of the Arabidopsis primary root
meristem initials. Development 120 2475-2487.
Szemenyei, H., Hannon, M. and Long, J. A. (2008). TOPLESS mediates auxindependent transcriptional repression during Arabidopsis embryogenesis. Science
319, 1384-1386.
Tan, X., Calderon-Villalobos, L. I., Sharon, M., Zheng, C., Robinson, C. V.,
Estelle, M. and Zheng, N. (2007). Mechanism of auxin perception by the TIR1
ubiquitin ligase. Nature 446, 640-645.
Überlacker, B. and Werr, W. (1996). Vectore with rare-cutter restriction enzyme
sites for expression of open reading frames in transgenic plants. Mol. Breed. 2,
293-295.
Ulmasov, T., Hagen, G. and Guilfoyle, T. J. (1997a). ARF1: a transcription factor
that binds to auxin response elements. Science 276, 1865-1868.
Ulmasov, T., Murfett, J., Hagen, G. and Guilfoyle, T. J. (1997b). Aux/IAA
proteins repress expression of reporter genes containing catural and highly active
synthetic auxin response elements. Plant Cell 9, 1963-1971.
Ulmasov, T., Hagen, G. and Guilfoyle, T. J. (1999). Activation and repression of
transcription by auxin-response factors. Proc. Natl. Acad. Sci. USA 96, 58445849.
Wagschal, A., Delaval, K., Pannetier, M., Arnaud, P. and Feil, R. (2007).
Chromatin immunoprecipitation (ChIP) on unfixed chromatin from cells and
tissues to analyze histone modifications. CSH Protoc. 3,
doi:10.1101/pdb.prot4767.
Weijers, D. and Jurgens, G. (2005). Auxin and embryo axis formation: the ends
in sight? Curr. Opin. Plant Biol. 8, 32-37.
Weijers, D., Schlereth, A., Ehrismann, J. S., Schwank, G., Kientz, M. and
Jürgens, G. (2006). Auxin triggers transient local signaling for cell specification
in Arabidopsis embryogenesis. Dev. Cell 10, 265-270.
DEVELOPMENT
DORNRÖSCHEN an in vivo target of MONOPTEROS