Download Supplementary Information

Supplementary Information
MiRNAs functioned by regulating different target mRNAs, then modulating cellular
characteristics. Cancer stem cells can be isolated and identified by specific markers.
Regulations of miRNAs on cancer and cancer stem cells functioned in many ways.
Supplementary Information accompanies the paper on the Oncogene website
(http://www.nature.com/onc).
Supplemental Tables
Table S1 Target genes of let-7 miRNA family members
Let-7
Sequence
Main Targets
Reference
ACTCCATCATCCAACATATCAA
Caspase-3, RAS, c-Myc, HMGA2,
LIN28, E1F2C2/AGO2, DICER1,
SOCS4, CDK6, CDC25A
(1-9)
ACTCCATCATCCAACACCAA
RAS, HMGA2, cyclin-D1, cyclins-D2,
cyclins-D3, cyclin A, CDK4, CDK6,
CDC25A, SOX4, PAK1, DIAPH2,
RDX, ITGB8
(2, 4, 7, 8, 10-14)
Let-7c
ACTCCATCATCCAACATACGAA
RAS, HMGA2, Caspase-3, SOCS4,
CDK6, CDC25A, IL-10, MMP-11,
PBX3, AR
(4, 7, 8, 10, 15-18)
Let-7d
AGAGGTAGTAGGTTGCATAGTT
RAS, HMGA2, SOCS4, PBX3, CDK6,
CDC25A, CREB, MOR1
(4, 7-10, 19, 20)
Let-7e
TGAGGTAGGAGGTTGTATAGTT
RAS, HMGA2, SOCS4, TLR4, E2F5,
CDK6, CDC25A
(4, 7-10, 13)
Let-7f-1/2
CTATACAATCTATTGCCTTCCC
RAS, HMGA2, SOCS4, CDK6,
CDC25A, MYH9, CYP19A1, IL-23R
(4, 7, 8, 10, 21-23)
Let-7g
TGAGGTAGTGGTTTGTACAGTT
RAS, HMGA2, SOCS4, LOX-1, c-Myc,
NF-κB, COL1A2, cyclin-D1,
cyclins-D2, CDK6, CDC25A
(2, 4, 7, 8, 10, 13, 24-26)
Let-7i
CTGCGCAAGCTACTGCCTTGCT
RAS, HMGA2, FUS1, c-Myc, SOCS4,
CDK6, CDC25A
(4, 7-10, 27)
ACTCCATCATTCAACATAACAA
HMGA2, FUS1, PGRMC1, cyclin-D2,
PGR, DDX3X, TIMP3 , CDK6,
CDC25A
(9, 27-31)
Let-7a-1/2/3
Let-7b
miR-98
COL1A2, Type I collagen alpha2; PBX3, Pre-leukemia transcription factor 3; CDK,
Cyclin-dependent kinase; CREB, cAMP-response element binding protein; MOR1,
Microtubule organization; AR, Androgen receptor; PBX3, pre-leukemia transcription
factor 3; MMP, matrix metalloproteinase; MYH, myosin heavy-chain; CYP19A1,
cytochrome P450, family 19, subfamily A, polypeptide 1.
Table S2 Markers of CSCs identified in multiple tumor types
Cancer
Illustration
Reference
CD34+/CD38-
Acute myeloid leukemia
+
- low
(32, 33)
+
Breast cancer
CD44 CD24 / , ALDH1 , SP
(34, 35)
Brain cancer
CD133+
(36-38)
Bone sarcoma
Stat-3, Oct-3/4, Nanog, SP
(39, 40)
+
Bladder cancer
CD44 , Oct-4, SP
(41-43)
Colorectal cancer
CD133+, CD44+, CD166+, ALDH1+, EpCAMhigh/CD44+
(44-47)
Endometrial carcinoma
CD133+, SP
(48, 49)
+
Gastric cancer
CD44
Head and neck squamous
cell carcinoma
CD44+, CD133+, CD147+, ALDH1
(51-55)
Hepatocellular carcinoma
SP, CD133+, CD44+, CD90+
(56-60)
SP ,
Lung cancer
CD133+,
uPAR+, ALDH1
(35, 61-64)
CD34+/CD38-
Leukemia
CD44+/CD133+/CD24+, ABCB5+,
Melanoma
(65)
CD20+
(66-68)
CD138-/CD20+/CD27+
Multiple myeloma
Ovarian cancer
(50)
CD44+/CD24-,
CD133+/CD117+,
CD44+/MYD88+,
(69, 70)
SP
(75-79)
Pancreatic cancer
CD44+/CD24-/ESA+, CD133+, ALDH1
(80-83)
Renal carcinoma
CD105+
(84)
Thyroid cancer
SP
(85, 86)
high/CD133+,
CD44+/α2β1high/CD133+,
(71-74)
α2β1
CD117+/ABCG2+, ALDH1
Prostate cancer
CXCR4/CD133+,
Supplemental References
1.
Tsang WP, Kwok TT. Let-7a microRNA suppresses therapeutics-induced cancer cell death by
targeting caspase-3. Apoptosis. 2008 Oct;13(10):1215-22.
2.
Pothof J, Verkaik NS, van Ijcken W, Wiemer EAC, Ta VTB, van der Horst GTJ, et al.
MicroRNA-mediated gene silencing modulates the UV-induced DNA-damage response. EMBO J.
[10.1038/emboj.2009.156]. 2009;28(14):2090-9.
3.
Sampson VB, Rong NH, Han J, Yang Q, Aris V, Soteropoulos P, et al. MicroRNA let-7a
down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007 Oct
15;67(20):9762-70.
4.
Lee YS, Dutta A. The tumor suppressor microRNA let-7 represses the HMGA2 oncogene. Genes
Dev. 2007 May 1;21(9):1025-30.
5.
Moss EG, Tang L. Conservation of the heterochronic regulator Lin-28, its developmental
expression and microRNA complementary sites. Dev Biol. 2003 Jun 15;258(2):432-42.
6.
Chang TC, Yu D, Lee YS, Wentzel EA, Arking DE, West KM, et al. Widespread microRNA repression
by Myc contributes to tumorigenesis. Nat Genet. 2008 Jan;40(1):43-50.
7.
Johnson CD, Esquela-Kerscher A, Stefani G, Byrom M, Kelnar K, Ovcharenko D, et al. The let-7
MicroRNA Represses Cell Proliferation Pathways in Human Cells. Cancer Research. 2007 August 15,
2007;67(16):7713-22.
8.
Hu G, Zhou R, Liu J, Gong A-Y, Chen X-M. MicroRNA-98 and let-7 Regulate Expression of
Suppressor of Cytokine Signaling 4 in Biliary Epithelial Cells in Response to Cryptosporidium parvum
Infection. Journal of Infectious Diseases. 2010 July 1, 2010;202(1):125-35.
9.
Johnson CD, Esquela-Kerscher A, Stefani G, Byrom M, Kelnar K, Ovcharenko D, et al. The let-7
microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug
15;67(16):7713-22.
10. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, et al. RAS is regulated by the
let-7 microRNA family. Cell. 2005 Mar 11;120(5):635-47.
11. Di Fazio P, Montalbano R, Neureiter D, Alinger B, Schmidt A, Merkel AL, et al. Downregulation of
HMGA2 by the pan-deacetylase inhibitor panobinostat is dependent on hsa-let-7b expression in liver
cancer cell lines. Experimental Cell Research. 2012;318(15):1832-43.
12. Schultz J, Lorenz P, Gross G, Ibrahim S, Kunz M. MicroRNA let-7b targets important cell cycle
molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res.
2008;18(5):549-57.
13. Schultz J, Lorenz P, Gross G, Ibrahim S, Kunz M. MicroRNA let-7b targets important cell cycle
molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res.
2008 May;18(5):549-57.
14. Hu X, Guo J, Zheng L, Li C, Zheng TM, Tanyi JL, et al. The Heterochronic microRNA let-7 Inhibits
Cell Motility by Regulating the Genes in the Actin Cytoskeleton Pathway in Breast Cancer. Molecular
Cancer Research. 2013 March 1, 2013;11(3):240-50.
15. Ovcharenko D, Kelnar K, Johnson C, Leng N, Brown D. Genome-scale microRNA and small
interfering RNA screens identify small RNA modulators of TRAIL-induced apoptosis pathway. Cancer
Res. 2007 Nov 15;67(22):10782-8.
16. Jiang L, Cheng Z, Qiu S, Que Z, Bao W, Jiang C, et al. Altered let-7 expression in Myasthenia gravis
and let-7c mediated regulation of IL-10 by directly targeting IL-10 in Jurkat cells. International
Immunopharmacology. 2012;14(2):217-23.
17. Han H-B, Gu J, Zuo H-J, Chen Z-G, Zhao W, Li M, et al. Let-7c functions as a metastasis suppressor
by targeting MMP11 and PBX3 in colorectal cancer. The Journal of Pathology. 2012;226(3):544-55.
18. Nadiminty N, Tummala R, Lou W, Zhu Y, Zhang J, Chen X, et al. MicroRNA let-7c Suppresses
Androgen Receptor Expression and Activity via Regulation of Myc Expression in Prostate Cancer Cells.
Journal of Biological Chemistry. 2012 January 6, 2012;287(2):1527-37.
19. Ramberg H, Alshbib A, Berge V, Svindland A, Tasken K. Regulation of PBX3 expression by
androgen and Let-7d in prostate cancer. Molecular Cancer. 2011;10(1):50.
20. Chandrasekar V, Dreyer JL. Regulation of MiR-124, Let-7d, and MiR-181a in the accumbens
affects the expression, extinction, and reinstatement of cocaine-induced conditioned place preference.
Neuropsychopharmacology. 2011 May;36(6):1149-64.
21. Liang S, He L, Zhao X, Miao Y, Gu Y, Guo C, et al. MicroRNA Let-7f Inhibits Tumor Invasion and
Metastasis by Targeting MYH9 in Human Gastric Cancer. PLoS One. 2011;6(4):e18409.
22. Shibahara Y, Miki Y, Onodera Y, Hata S, Chan MSM, Yiu CCP, et al. Aromatase inhibitor treatment
of breast cancer cells increases the expression of let-7f, a microRNA targeting CYP19A1. The Journal of
Pathology. [10.1002/path.4019]. 2012;227(3):357-66.
23. Li Z, Wu F, Brant SR, Kwon JH. IL-23 Receptor Regulation by Let-7f in Human CD4+ Memory T Cells.
The Journal of Immunology. 2011 June 1, 2011;186(11):6182-90.
24. Chen KC, Hsieh IC, Hsi E, Wang YS, Dai CY, Chou WW, et al. Negative feedback regulation between
microRNA let-7g and the oxLDL receptor LOX-1. J Cell Sci. 2011 Dec 1;124(Pt 23):4115-24.
25. Arora H, Qureshi R, Jin S, Park AK, Park WY. miR-9 and let-7g enhance the sensitivity to ionizing
radiation by suppression of NFkappaB1. Exp Mol Med. 2011 May 31;43(5):298-304.
26. Ji J, Zhao L, Budhu A, Forgues M, Jia HL, Qin LX, et al. Let-7g targets collagen type I alpha2 and
inhibits cell migration in hepatocellular carcinoma. J Hepatol. 2010 May;52(5):690-7.
27. Wendler A, Keller D, Albrecht C, Peluso JJ, Wehling M. Involvement of let-7/miR-98 microRNAs in
the regulation of progesterone receptor membrane component 1 expression in ovarian cancer cells.
Oncol Rep. 2011 Jan;25(1):273-9.
28. Hebert C, Norris K, Scheper MA, Nikitakis N, Sauk JJ. High mobility group A2 is a target for
miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007;6:5.
29. Du L, Schageman JJ, Subauste MC, Saber B, Hammond SM, Prudkin L, et al. miR-93, miR-98, and
miR-197 regulate expression of tumor suppressor gene FUS1. Mol Cancer Res. 2009 Aug;7(8):1234-43.
30. Yang Y, Ago T, Zhai P, Abdellatif M, Sadoshima J. Thioredoxin 1 negatively regulates angiotensin
II-induced cardiac hypertrophy through upregulation of miR-98/let-7. Circ Res. 2011 Feb
4;108(3):305-13.
31. Panda H, Chuang TD, Luo X, Chegini N. Endometrial miR-181a and miR-98 expression is altered
during transition from normal into cancerous state and target PGR, PGRMC1, CYP19A1, DDX3X, and
TIMP3. J Clin Endocrinol Metab. 2012 Jul;97(7):E1316-26.
32. Ishikawa F, Yoshida S, Saito Y, Hijikata A, Kitamura H, Tanaka S, et al. Chemotherapy-resistant
human AML stem cells home to and engraft within the bone-marrow endosteal region. Nat Biotechnol.
2007 Nov;25(11):1315-21.
33. Saito Y, Uchida N, Tanaka S, Suzuki N, Tomizawa-Murasawa M, Sone A, et al. Induction of cell
cycle entry eliminates human leukemia stem cells in a mouse model of AML. Nat Biotechnol. 2010
Mar;28(3):275-80.
34. Ricardo S, Vieira AF, Gerhard R, Leitao D, Pinto R, Cameselle-Teijeiro JF, et al. Breast cancer stem
cell markers CD44, CD24 and ALDH1: expression distribution within intrinsic molecular subtype. J Clin
Pathol. 2011 Nov;64(11):937-46.
35. Oliveira LR, Jeffrey SS, Ribeiro-Silva A. Stem cells in human breast cancer. Histol Histopathol. 2010
Mar;25(3):371-85.
36. Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J, et al. Identification of a Cancer
Stem Cell in Human Brain Tumors. Cancer Research. 2003 September 15, 2003;63(18):5821-8.
37. Vescovi AL, Galli R, Reynolds BA. Brain tumour stem cells. Nat Rev Cancer. 2006 Jun;6(6):425-36.
38. Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, et al. Identification of human brain
tumour initiating cells. Nature. [10.1038/nature03128]. 2004;432(7015):396-401.
39. Gibbs CP, Kukekov VG, Reith JD, Tchigrinova O, Suslov ON, Scott EW, et al. Stem-like cells in bone
sarcomas: implications for tumorigenesis. Neoplasia. 2005 Nov;7(11):967-76.
40. Murase M, Kano M, Tsukahara T, Takahashi A, Torigoe T, Kawaguchi S, et al. Side population cells
have the characteristics of cancer stem-like cells/cancer-initiating cells in bone sarcomas. Br J Cancer.
2009;101(8):1425-32.
41. Atlasi Y, Mowla SJ, Ziaee SAM, Bahrami A-R. OCT-4, an embryonic stem cell marker, is highly
expressed in bladder cancer. International Journal of Cancer. 2007;120(7):1598-602.
42. Alison MR, Lim SM, Nicholson LJ. Cancer stem cells: problems for therapy? J Pathol. 2011
Jan;223(2):147-61.
43. Dimov I, Visnjic M, Stefanovic V. Urothelial cancer stem cells. ScientificWorldJournal.
2010;10:1400-15.
44. Yeung TM, Mortensen NJ. Colorectal Cancer Stem Cells. Diseases of the Colon & Rectum.
2009;52(10):1788-96 10.007/DCR.0b013e3181a8738c.
45. Dalerba P, Dylla SJ, Park I-K, Liu R, Wang X, Cho RW, et al. Phenotypic characterization of human
colorectal cancer stem cells. Proceedings of the National Academy of Sciences. 2007 June 12,
2007;104(24):10158-63.
46. Huang EH, Hynes MJ, Zhang T, Ginestier C, Dontu G, Appelman H, et al. Aldehyde Dehydrogenase
1 Is a Marker for Normal and Malignant Human Colonic Stem Cells (SC) and Tracks SC Overpopulation
during Colon Tumorigenesis. Cancer Research. 2009 April 15, 2009;69(8):3382-9.
47. Ricci-Vitiani L, Fabrizi E, Palio E, De Maria R. Colon cancer stem cells. Journal of Molecular
Medicine. 2009;87(11):1097-104.
48. Hubbard SA, Gargett CE. A cancer stem cell origin for human endometrial carcinoma?
Reproduction. 2010 Jul;140(1):23-32.
49. Kyo S, Maida Y, Inoue M. Stem cells in endometrium and endometrial cancer: accumulating
evidence and unresolved questions. Cancer Lett. 2011 Sep 28;308(2):123-33.
50. Takaishi S, Okumura T, Tu S, Wang SSW, Shibata W, Vigneshwaran R, et al. Identification of Gastric
Cancer Stem Cells Using the Cell Surface Marker CD44. STEM CELLS. 2009;27(5):1006-20.
51. Prince ME, Sivanandan R, Kaczorowski A, Wolf GT, Kaplan MJ, Dalerba P, et al. Identification of a
subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma.
Proceedings of the National Academy of Sciences. 2007 January 16, 2007;104(3):973-8.
52. Richard V, Pillai MR. The stem cell code in oral epithelial tumorigenesis: 'the cancer stem cell shift
hypothesis'. Biochim Biophys Acta. 2010 Dec;1806(2):146-62.
53. Ailles L, Prince M. Cancer stem cells in head and neck squamous cell carcinoma. Methods Mol
Biol. 2009;568:175-93.
54. Albers AE, Chen C, Köberle B, Qian X, Klussmann JP, Wollenberg B, et al. Stem cells in squamous
head and neck cancer. Critical Reviews in Oncology/Hematology. 2012;81(3):224-40.
55. Visus C, Ito D, Amoscato A, Maciejewska-Franczak M, Abdelsalem A, Dhir R, et al. Identification of
human aldehyde dehydrogenase 1 family member A1 as a novel CD8+ T-cell-defined tumor antigen in
squamous cell carcinoma of the head and neck. Cancer Res. 2007 Nov 1;67(21):10538-45.
56. Ma S, Chan KW, Hu L, Lee TKW, Wo JYH, Ng IOL, et al. Identification and Characterization of
Tumorigenic Liver Cancer Stem/Progenitor Cells. Gastroenterology. 2007;132(7):2542-56.
57. Suetsugu A, Nagaki M, Aoki H, Motohashi T, Kunisada T, Moriwaki H. Characterization of CD133+
hepatocellular carcinoma cells as cancer stem/progenitor cells. Biochemical and Biophysical Research
Communications. 2006;351(4):820-4.
58. Chiba T, Kita K, Zheng Y-W, Yokosuka O, Saisho H, Iwama A, et al. Side population purified from
hepatocellular
carcinoma
cells
harbors
cancer
stem
cell–like
properties.
Hepatology.
2006;44(1):240-51.
59. Zhu Z, Hao X, Yan M, Yao M, Ge C, Gu J, et al. Cancer stem/progenitor cells are highly enriched in
CD133+CD44+
population
in
hepatocellular
carcinoma.
International
Journal
of
Cancer.
2010;126(9):2067-78.
60. Yang ZF, Ho DW, Ng MN, Lau CK, Yu WC, Ngai P, et al. Significance of CD90+ Cancer Stem Cells in
Human Liver Cancer. Cancer Cell. 2008;13(2):153-66.
61. Eramo A, Lotti F, Sette G, Pilozzi E, Biffoni M, Di Virgilio A, et al. Identification and expansion of
the tumorigenic lung cancer stem cell population. Cell Death Differ. 2008 Mar;15(3):504-14.
62. Seo DC, Sung JM, Cho HJ, Yi H, Seo KH, Choi IS, et al. Gene expression profiling of cancer stem cell
in human lung adenocarcinoma A549 cells. Mol Cancer. 2007;6:75.
63. Ho MM, Ng AV, Lam S, Hung JY. Side Population in Human Lung Cancer Cell Lines and Tumors Is
Enriched with Stem-like Cancer Cells. Cancer Research. 2007 May 15, 2007;67(10):4827-33.
64. Wang B, Yang H, Huang YZ, Yan RH, Liu FJ, Zhang JN. Biologic characteristics of the side
population of human small cell lung cancer cell line H446. Chin J Cancer. 2010 Mar;29(3):254-60.
65. Majeti R, Weissman IL. Human acute myelogenous leukemia stem cells revisited: there's more
than meets the eye. Cancer Cell. 2011 Jan 18;19(1):9-10.
66. Dou J, Pan M, Wen P, Li Y, Tang Q, Chu L, et al. Isolation and identification of cancer stem-like cells
from murine melanoma cell lines. Cell Mol Immunol. 2007 Dec;4(6):467-72.
67. Schatton T, Murphy GF, Frank NY, Yamaura K, Waaga-Gasser AM, Gasser M, et al. Identification of
cells initiating human melanomas. Nature. [10.1038/nature06489]. 2008;451(7176):345-9.
68. Fang D, Nguyen TK, Leishear K, Finko R, Kulp AN, Hotz S, et al. A tumorigenic subpopulation with
stem cell properties in melanomas. Cancer Res. 2005 Oct 15;65(20):9328-37.
69. Matsui W, Wang Q, Barber JP, Brennan S, Smith BD, Borrello I, et al. Clonogenic multiple
myeloma progenitors, stem cell properties, and drug resistance. Cancer Res. 2008 Jan 1;68(1):190-7.
70. Huff CA, Matsui W. Multiple myeloma cancer stem cells. J Clin Oncol. 2008 Jun
10;26(17):2895-900.
71. Gao Q, Geng L, Kvalheim G, Gaudernack G, Suo Z. Identification of cancer stem-like side
population cells in ovarian cancer cell line OVCAR-3. Ultrastruct Pathol. 2009 Jul-Aug;33(4):175-81.
72. Shi MF, Jiao J, Lu WG, Ye F, Ma D, Dong QG, et al. Identification of cancer stem cell-like cells from
human epithelial ovarian carcinoma cell line. Cell Mol Life Sci. 2010 Nov;67(22):3915-25.
73. Bapat SA. Human ovarian cancer stem cells. Reproduction. 2010 July 1, 2010;140(1):33-41.
74. Alvero AB, Chen R, Fu HH, Montagna M, Schwartz PE, Rutherford T, et al. Molecular phenotyping
of human ovarian cancer stem cells unravels the mechanisms for repair and chemoresistance. Cell
Cycle. 2009 Jan 1;8(1):158-66.
75. Miki J, Furusato B, Li H, Gu Y, Takahashi H, Egawa S, et al. Identification of Putative Stem Cell
Markers, CD133 and CXCR4, in hTERT–Immortalized Primary Nonmalignant and Malignant
Tumor-Derived Human Prostate Epithelial Cell Lines and in Prostate Cancer Specimens. Cancer
Research. 2007 April 1, 2007;67(7):3153-61.
76. Richardson GD, Robson CN, Lang SH, Neal DE, Maitland NJ, Collins AT. CD133, a novel marker for
human prostatic epithelial stem cells. Journal of Cell Science. 2004 July 15, 2004;117(16):3539-45.
77. Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ. Prospective Identification of Tumorigenic
Prostate Cancer Stem Cells. Cancer Research. 2005 December 1, 2005;65(23):10946-51.
78. Liu T, Xu F, Du X, Lai D, Zhao Y, Huang Q, et al. Establishment and characterization of multi-drug
resistant, prostate carcinoma-initiating stem-like cells from human prostate cancer cell lines 22RV1.
Mol Cell Biochem. 2010 Jul;340(1-2):265-73.
79. Ma I, Allan AL. The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem
Cell Rev. 2011 Jun;7(2):292-306.
80. Li C, Heidt DG, Dalerba P, Burant CF, Zhang L, Adsay V, et al. Identification of Pancreatic Cancer
Stem Cells. Cancer Research. 2007 February 1, 2007;67(3):1030-7.
81. Lee CJ, Dosch J, Simeone DM. Pancreatic Cancer Stem Cells. Journal of Clinical Oncology. 2008
June 10, 2008;26(17):2806-12.
82. Hermann PC, Huber SL, Herrler T, Aicher A, Ellwart JW, Guba M, et al. Distinct Populations of
Cancer Stem Cells Determine Tumor Growth and Metastatic Activity in Human Pancreatic Cancer. Cell
stem cell. 2007;1(3):313-23.
83. Douville J, Beaulieu R, Balicki D. ALDH1 as a functional marker of cancer stem and progenitor
cells. Stem Cells Dev. 2009 Jan-Feb;18(1):17-25.
84. Bussolati B, Bruno S, Grange C, Ferrando U, Camussi G. Identification of a tumor-initiating stem
cell population in human renal carcinomas. FASEB J. 2008 Oct;22(10):3696-705.
85. Mitsutake N, Iwao A, Nagai K, Namba H, Ohtsuru A, Saenko V, et al. Characterization of side
population in thyroid cancer cell lines: cancer stem-like cells are enriched partly but not exclusively.
Endocrinology. 2007 Apr;148(4):1797-803.
86. Derwahl M. Linking stem cells to thyroid cancer. J Clin Endocrinol Metab. 2011 Mar;96(3):610-3.