Download Spontaneous tumorigenesis studies

Supplementary Information
Methods
Generation of double knockout mice. Homozygous TSG-53® mice [C57BL/6
N12] were purchased from Taconic Farm, Inc. (37) and were crossed with inhouse Rassf1a-/- mice (Rassf1a.301A-102/129S1 strain) (23). Heterozygous
offspring Rassf1a+/- p53+/- mice were then intercrossed to produce single and
compound mutant animals with a hybrid C57BL/6 x 129/Sv genetic background.
The mice were housed in a high-efficiency particulate air-filtered, environmentally
controlled room (at 24 + 1 C, on a 12-h light/dark cycle), with food and water
available ad libitum. The animals were maintained in compliance with the
National Institute of Health guidelines for animal care and use. Mice were
routinely genotyped using tail DNA isolated by DirectPCR Lysis Reagent
(Viagen Biotech, Inc.). To identify the Rassf1a status, PCR amplification was
performed with primers UMIOAI, 5’ –TTGTGCCGTGCCCCGCCCA, LMIIAA, 5’ –
TGACCAGCCCTCCACTGCCGC
and
Neo48U,
5’
–
GGGCCAGCTCATTCCTCCCAC, as previously described (23). To detect the
p53 genotype, the following primers were used in independent PCR reactions:
P5314F,
5’-ACACACCTGTAGCTCCAGCAC,
P53E5R,
5’-
AGCGTCTCACGACCTCCGTG, OPT-21, 5’ –GTGTTCCGGCTGTCAGCGCA,
which produced a 520-bp band for the wild type allele, a 730-bp band for the
knockout allele and both fragments for heterozygous mice (Figure 1A). PCR
thermocycling conditions were set in accordance with the Taconic protocol: 95C
for 15 min (1 cycle); 94°C for 45 sec, 60C for 1 min, 7C for 1 min (30 cycles);
72C for 5 min (1 cycle) (Taconic Farm, Inc.). Multiplex PCR products were
separated on 2% agarose gels.
MEF generation and cell culture. Primary mouse embryonic fibroblasts (MEFs)
were isolated from embryos derived from Rassf1a+/- p53+/- parents, according to
published procedures (19, 23). Briefly, mouse embryos were harvested in utero
at 13.5 days of gestation. Following the removal of the head (for DNA
genotyping) and internal organs, the embryos were roughly minced and
incubated with trypsin for 30 min at 37C. Next, cells were disaggregated by
passage through a syringe equipped with an 18-gauge needle. Homogenous cell
suspensions were then added to 25 ml of Dulbecco Modified Eagle’s Medium
(DMEM, SIGMA,), supplemented with 10% fetal calf serum, non-essential
aminoacids, and 0.1 mM -mercaptoethanol. Following 3-4 days of incubation at
37°C, confluent cultures were trypsinized and frozen, at 2-3 x 106 cells per vial.
Early passage (P<6) mouse embryonic fibroblasts (MEFs) were used for all
experiments.
Fluorescence Activated Cell Sorting (FACS) and video time lapse
recording. MEFs were plated at a density of 0.7-1 x 106 per 100-mm dish at
least 24 h prior to all the experiments. To study cell cycle perturbations following
DNA damage, fibroblasts were treated with 0.2 µg/ml fresh doxorubicin (SIGMA)
in DMEM for 18 h. For FACS analysis, cells were collected before and after
treatment, washed thrice in PBS, fixed in 70% cold ethanol, and stained with
propidium iodide (at a final concentration of 100 g/ml) in a PBS buffer containing
0.1% BSA, 0.1% Triton X-100, and 150 g/ml RNase. Fifty thousand to 100,000
cells were processed using a MoFlo MLS apparatus (Dako Cytomation,
Colorado), and data were analyzed using the Summit software v4.2 (Dako
Cytomation, Colorado). For life cell imaging, asynchronous fibroblasts derived
from Rassf1a+/+ p53+/+, Rassf1a-/- p53+/+, Rassf1a+/+ p53-/-, Rassf1a+/- p53-/-, and
Rassf1a-/- p53-/- embryos, were seeded at a density of 1 x 10 5 in 25-mm flasks
and consecutive images were captured by time-lapse microscopy (Nikon Eclipse
TS100, Nikon Instruments Inc., Melville, NY). Mitotic progression was monitored
from prophase (time 0: when cells began to change morphology) until cytokinesis
was completed. Microphotoghraphs of the cell cultures were taken every 5 min
with video time lapse-frame (VTLF) software.
GTG banding and interphase fluorescence in situ hybridization (FISH). For
metaphase spread preparation, early passage (passage 3) mouse embryonic
fibroblasts from Rassf1a+/+ p53+/+, Rassf1a-/- p53+/-, and Rassf1a-/- p53-/littermates, were grown to 80% confluency and harvested following standard
procedures. Cells were fixed using Carnoy’s fixative (3:1 methanol:acetic acid),
dropped onto non-sylanized slides, and air-dried. The slides were baked at 45C
for 72 hours prior to staining. Slides were then GTG-banded with trypsin
(standard procedures), and metaphases (30 per genotype) were photographed
with the BandView imaging system from Applied Spectral Imaging (ASI). To
determine the ploidy level of mouse paraffin-embedded tissue (PET) sections,
FISH was performed using the FISH-mapped confirmed BAC probe, RP23-159j3
(8qA1.1) labeled in Spectrum Orange (Abbott Laboratories, Inc.). Unstained PET
slides were baked (60C for 3 h), placed in fresh xylene (5 min, twice), and
rehydrated through serial ethanol rinses and water. Following several washes in
1xPBS and 2xSSC, slides were pretreated with pepsin and hybridized with the
FISH probe, as recommended by the manufacturer. Two hundred interphase
cells were scored per specimen. Images were captured with the BioView Imaging
system (BioView, Israel).
Figure legends
Suppl. Figure 1. A multi-step model for tumor development in Rassf1a, p53
single and double mutant mice. a) wildtype mouse; very slow tumor
development. b) Rassf1a-/- p53+/- mouse; in the situation where an active p53
allele is retained, as well as its ability to overrule the mitotic defects dictated by
the Rassf1a-/- phenotype (at least initially and/or in absence of other oncogenic
events), tumors may grow slowly due to low levels of aneuploidy and/or
chromosome rearrangements (Rassf1a-/- p53+/- phenotype). A second hit (loss of
the functional p53 allele) may be required to accelerate tumorigenesis. c) p53-/mouse; rapid onset of tumorigenesis d) Rassf1a-/-, p53-/- mouse; in a more severe
scenario where both Rassf1a and p53 functions are completely lost, cells are
incapable of monitoring the mitotic defects generated by loss of Rassf1a. This
will lead to significant genomic instability, possible growth advantage and
aggressive tumor development (Rassf1a-/- p53-/- phenotype).