Download Title: SLCO1B3 gene alterations and protein expression in

Title:
SLCO1B3 gene alterations and protein expression in colorectal cancer
Authors:
Lampri Evangeli1, Sainis Ioannis1, Kounnis Valentinos1,, Mitselou Antigony2, Ioachim Elli3,
Hatzimichael Eleftheria1,4, Galani Vasiliki 5, Briasoulis Evangelos1,4
1
Cancer Biobank Center, University of Ioannina, Ioannina, Greece
2
Department of Forensic Pathology, University of Ioannina, Ioannina, Greece
3
Department of Pathology, General Hospital “G.Hatzikosta”, Ioannina, Greece
4
Department of Hematology, Ioannina University Medical School, Ioannina
5
Departments of Embryology-Histology-Anatomy, University of Ioannina, Ioannina, Greece
Correspondence to:
Lampri Evangeli, MD, University of Ioannina Cancer Biobank Center, Post code 45500, Ioannina,
Greece , Phone: 0030-265-10-07713, [email protected]
The research was performed in University of Ioannina Cancer Biobank Center, iMOL, Post code
45500, Ioannina, Greece
Short running title: A study of SLCO1B3 in colorectal cancer
Authors details:
Lampri Evangeli, MD, Msc, PhD, University of Ioannina Cancer Biobank Center, iMOL, Post code
45110, Ioannina, Greece , Phone: +30-265-10-07713, [email protected] (corresponding
author)
Sainis Ioannis, PhD, University of Ioannina Cancer Biobank Center, iMOL, Post code 45500,
Ioannina, Greece , Phone: +30-265-10-07713, [email protected]
Kounnis Valentinos, PhD, MD, Hypoxia and Angiogenesis Group, Molecular Oncology
Laboratories,Weatherall Institute of Molecular Medicine, University of Oxford, John Radcliffe
Hospital,
OX3
9DS,
Oxford,
UK,
Phone:
+44-1865-2-22440,
[email protected]
Mitselou Antigony, PhD, MD, University of Ioannina, Department of Forensic Pathology Post code
45110, Ioannina, Greece, [email protected]
Ioachim Elli, PhD, MD, Department of Pathology, General Hospital “G.Hatzikosta”, Ioannina,
Greece, [email protected]
Hatzimichael Eleftheria PhD, MD, University of Ioannina Cancer Biobank Center, iMOL, Post code
45500, Ioannina, Greece, Phone: +30-265-10-07713, [email protected]
Galani Vasiliki, MD, PhD University of Ioannina Departments of Embryology-Histology-Anatomy,
University of Ioannina, Ioannina, Greece, [email protected]
Briasoulis Evangelos, Professor, University of Ioannina Cancer Biobank Center, Post code 45110,
Ioannina, Greece, Phone: +30-265-10-07713, [email protected]
Abstract
Background: Personalized medicine has made some major advances in Colorectal cancer (CRC),
but new biomarkers still remain a hot issue as an emergingtool with potential prognostic and
therapeutic potential.We ivestigated for SLCO1B3 gene alterations and protein expression in
colorectal cancer, using the novel High Resolution Melting analysis (HRMA) technique and
immunohistochemistry.
Materials and Methods: Formalin-Fixed paraffin-embedded tumor samples from 30 colorectal
cancer patients were used. The screening for gene alterations was done by High Resolution Melting
analysis (HRMA) for all exons of SLCO1B3. OATP1B3 protein expression was assessed by
immunohistochemistry using the monoclonal mouse MDQ antibody.
Results: High level of polymorphism was observed in the SLCO1B3 gene. We identified three
previously reported polymorphisms in exons 7, 12 and 14, 699G>A, 1557 A>G and 1833G>A,
respectively. In the exon 5, one variant seems to correspond to an as yet unknown SLCO family
member. The immunohistochemical study revealed that OATP1B3 was expressed in 27/30 samples.
Of great interest, the three samples, which were immunohistochemically negative, all appeared to
accommodate mutations which lead either to early stop codons or other conformations of the
tertiary protein structures affecting the antibody- epitope binding.
Conclusions: The results of this study are of much interest as HRMA proved to be a reliable and
rapid genotyping/scanning method for mutation detection of SLCO1B3.
Introduction
Colorectal cancer (CRC) is major world health issue because of its high prevalence and mortality
rates. It consists the second most common cancer diagnosed in Europe and the third most common
cancer in the US[1, 2, 3]. This cancer although highly curable by surgical resection at early stages,
when it presents with metastases at diagnosis, which occurs in 25% of the patients, or when it
becomes metastatic, which happens in 50% of the cases, it is considered largely incurable, despite
the progress made in the development of novel therapeutics [3]. Therefore, the discovery of novel
molecular targets and targeted therapies is of major importance for an essential improvement of
therapeutic outlook in this large group of patients.
SLCO1B3 belongs to solute carrier organic anion transporter family and encodes the human organic
anion-transporting polypeptide (OATP) 1B3 [4]. It is located in chromosome 12 (2p12–31.7 to
12p12–37.2) (Figure 1A.) [5]. This gene has 6 transcripts, two of which, SLCO1B3-001 and
SLCO1B3-201, have a Consensus CDS and comprise of 16 and 15 exons, respectively [6], their
main difference is in the 1st and 2nd exon of the 001 transcript. (Figure 1B). OATP1B3 seems to be
the only hepatic OATP transporting digoxin, amanitin, docetaxel and paclitaxel. In addition,
OATP1B3 expression has been suggested as a potential variable of tumour sensitivity to
methotrexate treatment [7-15]. Moreover, besides the abundant expression in the periportal area in
liver, OATP1B3 has been found to be expressed in several types of cancers. The expression of
OATP1B3 in colon tumors and in the colon tumor cell lines was mainly cytoplasmic and clearly
different from the membranous expression pattern in the normal liver. Cytoplasmic localization of
OATP1B3 in tumor cells has also been found in primary breast cancer tissues. The aberrant
expression of OATP1B3 in the cytoplasm of colon tumors was the impetus to investigate whether
OATP1B3 functions differently in the setting of malignancy [8, 10]
The SLCO1B3 gene sequence (encoding OATP1B3) was shown to vary among different
populations as well as several SNPs were reported to date [16-21], therefore, the significance of
SLCO1B3 polymorphisms on drug pharmacokinetics is becoming increasingly evident and the
inter-ethnic differences exist in the allelic frequency of these variants suggests the need to
characterize the full extent of SLCO1B3 genetic variability in any given population [17].
The study of polymorphisms of SLCO1B3 presents a special interest as they seem to be implicated
in the function of the protein and promises a possible discrimination among patients in order to
achieve personalized treatment. In addition, HRMA technique was chosen to serve as a powerful
polymorphisms/mutation screening tool, based on the simplicity of the method, low cost, and high
sensitivity and specificity.
Moreover, the expression and cellular localization of OATP1B3 was assessed by
immunohistochemistry, using the monoclonal mouse MDQ anti-OATP1B3 antibody, which
recognizes the N-terminal region of OATP1B3, for the same tissue samples.
High Resolution Melting (HRM) analysis is a polymerase chain reaction (PCR) based method for
detecting DNA sequence variation by measuring changes in the melting point of a DNA duplex.
Until recently, there are not data as far as it concerns the use of HRM as a gene scanning method for
the gene of solute carrier organic anion transporter 1B3 (SLCO1B3) in FFPE tissues from patients
with CRC. Moreover, there are limited data about its corresponding protein organic aniontransporting polypeptide 1B3 (OATP1B3).
Materials and Method:
We used 30 FFPE tumor tissue samples from patients diagnosed with CRC provided by the
Department of Pathology of the General Hospital of Ioannina “G. Hatzikosta”. The institutional
review board approved all of the protocols. Patient’s median age was 65 years; 13 were female and
17 male. Histologically, six cases were diagnosed as poorly, eighteen as moderate and six as well
differentiated colon adenocarcinomas.
The genomic alterations of SLCO1B3 exons were assessed by HRM while the expression and
subcellular localization of OATP1B3 was carried out using immunohistochemistry.
DNA extraction
Up to 5 of 10μm FFPE tissue sections were gathered according to standard method [18] and were
used for DNA extraction with “NucleoSpin® FFPE DNA” kit (Macherey-Nagel cat number
740980) according to manufacturers instructions. Extracted DNA was quantified using a NanoDrop
1000 Spectrophotometer (ThermoScientific).
HRMA Analysis
HRMA was performed on the LightCycler® 480 Real-Time PCR System, using the LightCycler®
480 High Resolution Melting Master Reaction Mix (Roche Diagnostics cat number 4909631001).
Specific pairs of oligonucleotide primers (forward and reverse) were designed using Primer3
(version 3.0) to bracket each exon (Table 1) of SLCO1B3. The reference sequence gene of
SLCO1B3
is
formatted
and
downloaded
from
the
Ensemble
(http://www.ensembl.org/Homo_sapiens/Transcript/Exons?db=core;g=ENSG00000111700;r=12:20
963636-21243040;t=ENST00000261196).
Equal quantity of DNA template of each sample was used in each a 20-μl reaction with 0.2 μM and
2.5mM final primer and MgCl2 concentration respectively. Cycling conditions were set as follows
(Table 2): Pre-incubation/Denaturation of secondary structures 10 minutes at 950C, followed by 55
amplification cycles comprising of 1 min denaturation at 950C, followed by 60sec primer annealing
T (according to each primer) and a 60sec elongation period at 720C. Final PCR product
identification and genotype differentiation was carried on by a single cycle of High Resolution
Melting Curve (950C for 60sec, 400C for 60sec, 650C for 1 sec). The Annealing temperature can be
seen on table 1.
Analysis of the experimental data with appropriate software
Analysis of results was achieved by the LightCycler 480 Gene Scanning Software using the
“Second Derivative Maximum/2nd Derivative” analysis method.
The group with the most identical samples served as the “wild type” sequence for each exon. Thus
any sample with a different melting peak than that of the wild type was considered to carry some
form of genetic mutation.
DNA Sequencing
Sequencing analysis was performed on a representative sample of the “wild type” group and for
each sample demonstrated genotypic differences.
Sequence analysis
Purified samples were sent for sequence to the VBC biotech Vienna. Results were assessed. The
wild type of each exon was in accordance with the relatives from e!Ensembl (based on the site:
Ensembl genome browser 67: Homo sapiens - Gene: SLCO1B3 ENSG00000111700. 2012). Then,
each sequence was aligned with the corresponding wild type by using the multiple alignment
algorithms in the Molecular Evolutionary Genetics Analysis 5.1 beta (MEGA 5.1beta). Moreover,
each nucleotide sequence was translated, using MEGA 5.1beta.
Immunohistochemistry
Tissue sections of 3–4 µm width were cut, applied on microscope slides and incubated overnight at
650C for optimum tissue–glass adhesion. Deparaffinization, rehydration, and heat-induced epitoperetrieval (HIER) was achieved by incubating the slides in preheated (65 0C) pH 9 target retrieval
solution (cat number S2375)for 20 minutes at 930C . DAKO’s Autostainer/PT link system was used
for the immunostaining process. A 30-minute blocking step with 5% dry milk preceded the Ab
application. Monoclonal antibody MDQ (mMDQ) (PROGEN Biotechnik, cat number 651140) was
used for the immunolocalization of the N-terminal 24 amino acid epitope of OATP1B3, at a final
concentration 1:10. Primary antibody was diluted with with Dako REAL™ Antibody Diluent
(DAKO, Code S2022) in 1% blocking reagent and applied on slides for 30 minutes. Endogenous
peroxidase was blocked using Daco REAL peroxidase blocking solution (Code S2023) for 10
minutes. DAKO’s special engineered Dextran backbone enriched with peroxidase molecules and
goat secondary antibody molecules against rabbit and mouse immunoglobulins (Dako REAL™
EnVision™/HRP, Rabbit/Mouse ENV, Code Code K5007) was applied on slides for 20 minutes
followed by a 5 minute Dako REAL™ DAB+ Chromogen (DAKO, Code K5007) detection system
and a 2 minute hematoxylene (QS H-3404 Vector Laboratories) exposure. All incubation steps were
performed at room temperature unless stated otherwise. Finally, sections were dehydrated with
alcohol/xylene baths and stabilized with mounting medium. Immunostaining intensity was assessed
by two experienced pathologists, who graded the results, using endothelial cells and tissue
macrophages as internal controls.
Results
HRMA results with sequence confirmation
Based on our results, we observed high polymorphism rate in the SLCO1B3 gene (table 3). Three
previously reported polymorphisms, are identified, in exons 7, 12 and 14 which correspond to
699G>A with amino acid variation Met233Ile, encoding the OTP1B3/OATP-8-M233I
(Rs7311358)[11, 19, 20], 1557 A>G with amino acid variation (Ala519Ala) encoding the
OTP1B3/OATP-8-A519A (Rs2053098), and 1833G>A with amino acid variation Gly611Gly
(Rs3764006), respectively.
Moreover, in exon 5, one variant seems to correspond to an as yet unknown SLCO family member
(Homo sapiens cDNA FLJ31312 fis, clone LIVER1000224, highly similar to Solute carrier organic
anion transporter family member 1B3, dbj|AK055874.1|). Some other nucleotide substitutions
which have not been reported yet, were found.
Furthermore, the observed deletion and/or insertion of adenine was evaluated with caution as it
might be caused by the use of formaldeyde during tissue fixation.
Changes were also observed in the nucleotide sequence in the area of introns of exon 1 and 11.
Immunohistochemistry
The Immunohistochemical study revealed OATP1B3 was expressed in 27/30 studied cases and was
located in the cytoplasm (Figure 2). Interestingly in positive cases, almost all cancer cells were
stained positive.
Furthermore, protein expression was intense in 40% of the cases studied while weak was the
dominant pattern with 63,3% of studied cases.
HRMA of the 3 OATP1B3 negative samples confirmed the presence of polymorphisms in exons 2
and 3 of the transcript SLCO1B3-001 which either led to early stop codons or other conformations
of the tertiary protein structures prohibiting proper the antibody- epitope binding thus inability in
protein detection.
One of them had an insertion of 22 nucleotides in the area of exon 2 of the transcript SLCO1B3201, which causes deletion of the start codon. As a consequence, the protein OATP1B3 is not
produced at all, making impossible for the mMDQ to detect. The other two cases have the same
mutation, a deletion of Adenine and a substitution of Cytosine to Thymine in the second exon of the
transcript SLCO1B3-00. This exon belongs to the untranslated area of the gene SLCO1B3. We
suggest that these mutations may change the Ribosomal Binding Site (RBS), which is a sequence
on mRNA that is bound by the ribosome when initiating protein translation.
Discussion
The great interest for SLCO1B3, as far as it concerns cancer, is that its protein OATP1B3, although
it is expressed in the human liver under normal conditions, can be also expressed in various human
cancer tissues that have been associated with prognosis and clinical outcomes. The expression of
OATP1B3 in colon tumors and in the colon tumor cell lines was mainly cytoplasmic and clearly
different from the membranous expression pattern in the normal liver. This is in accordance with
our immunohistochemical results (Figure 2). The aberrant expression of OATP1B3 in the cytoplasm
of colon tumors was the impetus to investigate whether OATP1B3 functions differently in the
setting of malignancy [10]. The molecular entity of cancer-associated OATP1B, it remains
undetermined. Only Nagai et al. (2012) [21] reported the identification of a new OATP1B3 mRNA
isoform expressed in human colon and lung cancer tissues, which they named cancer-type
OATP1B3 (Ct-OATP1B3).It was such data that raised our interest to investigate this transporter,
applying HRMA in FFPE samples derived from patients with CRC. The upper goal was to scan
possible polymorphisms/mutations of the transporter SLCO1B3 in this group of patient, with
possible implications in the pathogenesis and treatment of CRC.
In the present study, although the high levels of polymorphism which was observed in the exons of
the SLCO1B3 gene, the results could not confirm that any of these polymorphisms presented with
greater frequency in patients with CRC. Actually, they were identified three previously reported
polymorphisms in exons 7, 12 and 14. In exon 5, one variant seems to correspond to an as yet
unknown SLCO family member (Homo sapiens cDNA FLJ31312 fis, clone LIVER1000224, highly
similar to Solute carrier organic anion transporter family member 1B3, dbj|AK055874.1|). In
addition, many other novel variants were identified, which were not reported yet.
As it is already known, in the general population, more than fifty SLCO1B3 polymorphisms, most
of which are located in regulatory regions, have been identified along with a variety of haplotypes.
Two clusters of deletions at -7 to -4 and -28 to -1 in the 5’-UTR that may result in reduced mRNA
stability or problems with initiation of translation have been also reported [17, 20]. Among all these
polymorphisms, functional analysis indicated that the variant 699G>A, which was also detected in
our study, alters transport levels and kinetics of OATP1B3 and the change appears to be substratespecific, while 699G>A expression was not different from that of wild-type. Moreover, 699G>A is
the most common OATP1B3 polymorphism in individual of all racial backgrounds (Hispanic
Americans=0.833,
Chinese
American=0.795,
Caucasian
Americans=0.779,
African
Americans=0.478, Caucasian Europeans 0.71) [11,
19, 20]. This commonly inherited
polymorphism M233I (as well as S112A) influences the degree to which testosterone is imported
into cells through SLCO1B3 playing a possible important role in men with prostate cancer [22].
Immunohistochemically, it was revealed that three cases were completely negative for the mMDQ
protein. A possible hypothesis is that these mutations may not permit the protein of OATP1B3 to be
produced throughout. It was observed expression of the mMDQ antibody in the rest of the cases
because the epitope of the antibody is found in the area of protein which is encoded by the second
exon of the transcript SLCO1B3-201 or the third of the transcript SLCO1B3-001. Thus, mutations
after this exon, deletions, insertions, or premature stop codons, might produce conformational
changes in the OATP1B3 polypeptide, but they do not interfere with recognition of this epitope.
However, nobody can exclude that others mutations also could exist in the positive
immunohistochemical speciments.
Neither the present study can elucidate the precise role of OATP1B3 in CRC. Because of the limited
number of samples, only 30, the interpretation of the results was quite difficult. The use of more
samples could possible show some polymorphisms/mutations to be presented more often in this
group of patients. Our results could not confirm that a polymorphism or mutation was more often in
the patients with CRC, suggesting a possible pathophysiological correlation with CRC. The three
already reported variants that have been found may represent just polymorphisms of the population
and they are not connected to the disease.
It is noteworthy the fact that there are relatively often deletion and insertions of the base adenine. A
possible explanation may be that the DNA was isolated from FFPE tissue. Analysis of nucleic acids
from FFPE samples is crucial in today’s clinical research. It is known that the formalin fixation
procedure lowers the success of polymerase chain reaction (PCR) amplification because of crosslinking between protein and DNA. In addition, standard embedding protocols require heating the
formaldehyde-soaked samples. The temperatures used for embedding in paraffin cause further
molecular reactions, some irreversible [23-28]. Artifacts could be the consequence of formalin
damaging or cross-linking cytosine nucleotides, on either strand, so that the Taq DNA polymerase
would not recognize them and instead of a guanosine incorporate an adenosine (because of the socalled A-rule). Thereby an artificial C-T or G-A mutation would be created. In the present study,
some of the detected mutations regard A-G and C-T (Table 3).
A great effort was made in order conditions of HRMA and concentrations of the reagents to be
optimized. It has been proven that a careful optimization of HRMA is rewarded by high-throughput,
economy, and simple and accurate performance of HRMA. Various techniques were employed to
reduce non-specific amplification, such as increasing the annealing/extension temperature, reducing
the primer concentration, optimizing the MgCl2 concentration. In the present study, the
concentration of the salt (MgCl2) proved to be a very determinant factor of the method, as it may
increase resolution and improve clustering [29]. Moreover, high concentration of DNA template
was prohibitive in HRMA during the first applications of the method. When a few simple rules are
taken into account (i.e., avoid long fragments and multiple melt domains), designing a HRMA
screen for a gene is rather straightforward [28-31].HRMA Moreover, it seems to represent a more
sensitive approach to detect a minimal fraction of mutated cells in neoplastic tissue that, in many
cases, is not achievable by direct sequencing [32]. Among the many applications of HRMA method,
HRMA provides a convenient way to detect SNP mutations in a targeted gene without performing
full fragment sequencing. Although HRMA cannot define mutations by their melting transitions, it
can significantly reduce the DNA sequencing burden, but positive results still require sequencing
for diagnostic confirmation [27] Its ease of use, simplicity, flexibility, low cost, nondestructive
nature, superb sensitivity, and specificity, make HRMA the method of choice to screen patients for
pathogenic variants. Because HRMA is still a rather young technology, one can only expect exciting
further developments.
In spite of the problems of the quality of DNA in the present study, because it was derived from
FFPE tissues and the several tests which were needed in order to standardise the method for each
exon, HRMA remains a sensitive, scanning method that allows rapid detection of DNA sequence
variations without cumbersome post–polymerase chain reaction (PCR) methods. The HRMA
method gave us the possibility to screen most of the exons of SLCO1B3, sending for sequencing
just a part of the samples. To our knowledge, this is the first study of SLCO1B3 gene using HRMA
in FFPE tissue from patients with CRC and in comparison with immunohistochemistry. It was
difficult the interpretation of the results because of the limited number of samples (30). Accurate
determination of specificity requires analysis of large numbers of known wild-type samples. The
“gold standard’ of the HRMA method could be achieved if PCR products for each exon were
sequenced for polymorphisms variations and subsequently HRMA should be evaluated for every
exon. This would help us to interpret better our experimental data of HRMA
Archival tissue specimens, such as FFPE tissues, represent a vast source of tissue genomic DNA,
easily obtained from clinical archives. Nowadays, the medicine lives the time of “targeted
therapies” and needs to make use of all this archival tissue. In the fight against cancer, the request
for rapid and reliable mutation screening in human cancers is continuously increasing for the
definition of clinical samples and orienting targeted therapies. SLCO1B3 seems to be a quite good
target as it seems to play role in the delivery of anticancer drugs. Its pathobiological significance in
CRC may not have been yet elucidated, neither to our study. However, it seems to be an interesting
molecule. The development of targeted therapies needs attractive techniques for mutation scanning
with ease of use, high sensitivity and specificity, low cost and rapid sample turnaround. These
requirements make HRMA ideal for use in routine clinical diagnostic settings. In addition, HRMA
is an interesting method which combines biology (PCR amplification), physic (the phenomenon of
fluorescence) and mathematic (the use of the software), three sciences in one..
Conclusions:
The results of this study are of much interest as HRMA proved to be a reliable and rapid
genotyping/scanning method for mutation detection of SLCO1B3. Moreover, it is important the
finding that the immunohistochemical negative samples proved to have accommodate mutations
which lead either to early stop codons or other conformations of the tertiary protein structures
affecting the antibody- epitope binding. In the present study, HRMA shed light in SLCO1B3 gene,
promising to reveal more in the near future.
References
1. Ferlay, J., Steliarova-Foucher, E., Lortet-Tieulent, J., Rosso, S., Coebergh, J.W.W., Comber,
H., Forman, D., Bray, F. Cancer incidence and mortality patterns in Europe: estimates for 40
countries in 2012. Eur J Cancer. 2013, 49(6):1374-403.
2. Siegel, R. L., Miller, K. D., Jemal, A. Cancer Statistics CA Cancer J Clin 2016, 66(1): 7-30.
3. Fakih, M. G. Metastatic colorectal cancer: current state and future directions. J Clin Oncol.
2015, 33 (6) 1809-1824.
4. Konig, J., Cui, Y., Nies, A. T., & Ke:ler, D. Localization and genomic organization of a new
hepatocellular organic anion transporting polypeptide. J Biol Chem. 2000, 275(30): 2316123168.
5.
Genatlas:
Gene
database.
SLCO1B3.
(2008).
[Online]. Available
from:
http://genatlas.medecine.univ-paris5.fr/fiche.php?n=10757 [Accessed: 15 May 2012]
6.
Ensembl genome browser 67: Homo sapiens - Gene: SLCO1B3 ENSG00000111700. (2012)
[online]
Available
from:
http://www.ensembl.org/Homo_sapiens/Transcript/Summary?db=core;g=ENSG00000111700;r=12:
20963636-21243040;t=ENST00000545880 [Accessed: 15 May 2012]
7.
Abe, T., Unno, M., Onogawa, T., Tokui, T., Kondo, T. N., Nakagomi, R., Adachi, H.,
Fujiwara, K., Okabe, M., Suzuki, T., Nunoki, K., Sato, E., Kakyo, M., Nishio, T., Sugita, J., Asano,
N., Tanemoto, M., Seki, M., Date, F., Ono, K., Kondo, Y., Shiiba, K., Suzuki, M., Ohtani, H.,
Shimosegawa, T., Iinuma, K., Nagura, H., Ito, S., & Matsuno, S. LST-2, a human liver-specific
organic anion transporter, determines methotrexate sensitivity in gastrointestinal cancers.
Gastroenterology 2001, 120 (7): 1689-1699.
8.
Kounnis, V., Ioachim, E., Svoboda, M., Tzakos, A., Sainis, I., Thalhammer, T., Steiner, G., &
Briasoulis, E. Expression of organic anion-transporting polypeptides 1B3, 1B1, and 1A2 in human
pancreatic cancer reveals a new class of potential therapeutic targets. Onco Targets Ther 2011, 4:
27-32.
9.
Smith, N. F., Marsh, S., Scott-Horton, T. J., Hamada, A., Mielke, S., Mross, K., Figg, W. D.,
Verweij, J., McLeod, H. L., & Sparreboom, A. Variants in the SLCO1B3 gene: interethnic
distribution and association with paclitaxel pharmacokinetics. Clin Pharmacol Ther 2007, 81(1):
76-82.
10.
Lee, W., Belkhiri, A., Lockhart, A. C., Merchant, N., Glaeser, H., Harris, E. I., Washington,
M. K., Brunt, E. M., Zaika, A., Kim, R. B., & El Rifai, W. Overexpression of OATP1B3 confers
apoptotic resistance in colon cancer. Cancer Res. 2008, 68 (24): 10315-10323.
11.
Letschert, K., Keppler, D., & Konig, J. Mutations in the SLCO1B3 gene affecting the
substrate specificity of the hepatocellular uptake transporter OATP1B3 (OATP8).
Pharmacogenetics 2004, 14(7): 441-452.
12.
Mahagita, C., Grassl, S. M., Piyachaturawat, P., & Ballatori, N. Human organic anion
transporter 1B1 and 1B3 function as bidirectional carriers and do not mediate GSH-bile acid
cotransport. Am J Physiol Gastrointest Liver Physiol. 2007, 293(1): G271-G278.
13.
Kalliokoski, A. & Niemi, M. Impact of OATP transporters on pharmacokinetics. Br J
Pharmacol. 2009, 158(3): 693-705.
14.
Kim, R. B. Organic anion-transporting polypeptide (OATP) transporter family and drug
disposition. Eur J Clin Invest. 2003, 33(Suppl 2): 1-5.
15.
Lockhart, A. C., Harris, E., Lafleur, B. J., Merchant, N. B., Washington, M. K., Resnick, M.
B., Yeatman, T. J., & Lee, W. (2008). Organic anion transporting polypeptide 1B3 (OATP1B3) is
overexpressed in colorectal tumors and is a predictor of clinical outcome. Clin Exp Gastroenterol.
2008, 1:1-7.
16.
Tsujimoto, M., Hirata, S., Dan, Y., Ohtani, H., & Sawada, Y. Polymorphisms and linkage
disequilibrium of the OATP8 (OATP1B3) gene in Japanese subjects. Drug Metab Pharmacokinet.
2006, 21(2): 165-169.
17.
Boivin, A. A., Cardinal, H., Barama, A., Pichette, V., Hebert, M. J., & Roger, M. Organic
anion transporting polypeptide 1B1 (OATP1B1) and OATP1B3: genetic variability and haplotype
analysis in white Canadians. Drug Metab Pharmacokinet. 2010, 25(5): 508-515.
18.
Galani V, Alexiou GA, Miliaras G, Dimitriadis E, Triantafyllou E, Galani A, Goussia A,
Kanavaros P, Trangas T. Expression of Stem Cell Marker Nestin and MicroRNA-21 in
Meningiomas. Turk Neurosurg. 2015;25(4):574-7.
19.
Schwarz, U. I., Meyer zu Schwabedissen, H. E., Tirona, R. G., Suzuki, A., Leake, B. F.,
Mokrab, Y., Mizuguchi, K., Ho, R. H., & Kim, R. B. Identification of novel functional organic
anion-transporting polypeptide 1B3 polymorphisms and assessment of substrate specificity.
Pharmacogenet Genomics 2011, 21(3): 103-114.
20.
Sissung, T. M., Troutman, S. M., Campbell, T. J., Pressler, H. M., Sung, H., Bates, S. E., &
Figg, W. D. Transporter pharmacogenetics: transporter polymorphisms affect normal physiology,
diseases, and pharmacotherapy. Discov Med. 2012, 13(68): 19-34.
21.
Nagai, M., Furihata, T., Matsumoto, S., Ishii, S., Motohashi, S., Yoshino, I., Ugajin, M.,
Miyajima, A., Matsumoto, S., & Chiba, K. Identification of a new organic anion transporting
polypeptide 1B3 mRNA isoform primarily expressed in human cancerous tissues and cells.
Biochem Biophys Res Commun. 2012, 418(4): 818-823.
22.
Hamada, A., Sissung, T., Price, D. K., Danesi, R., Chau, C. H., Sharifi, N., Venzon, D.,
Maeda, K., Nagao, K., Sparreboom, A., Mitsuya, H., Dahut, W. L., & Figg, W. D. Effect of
SLCO1B3 haplotype on testosterone transport and clinical outcome in caucasian patients with
androgen-independent prostatic cancer. Clin Cancer Res. 2008, 14(11): 3312-3318.
23.
Do, H. & Dobrovic, A. Limited copy number-high resolution melting (LCN-HRM) enables
the detection and identification by sequencing of low level mutations in cancer biopsies. Mol
Cancer 2009, 8(82) p. 82.
24.
Williams, C., Ponten, F., Moberg, C., Soderkvist, P., Uhlen, M., Ponten, J., Sitbon, G., &
Lundeberg, J. A high frequency of sequence alterations is due to formalin fixation of archival
specimens. Am J Pathol. 1999, 155 (5): 1467-1471.
25.
Do, H., Krypuy, M., Mitchell, P. L., Fox, S. B., & Dobrovic, A. High resolution melting
analysis for rapid and sensitive EGFR and KRAS mutation detection in formalin fixed paraffin
embedded biopsies. BMC Cancer 2008, 8(142), p. 142.
26.
Vorkas, P. A., Poumpouridou, N., Agelaki, S., Kroupis, C., Georgoulias, V., & Lianidou, E.
S. PIK3CA hotspot mutation scanning by a novel and highly sensitive high-resolution small
amplicon melting analysis method. J Mol Diagn. 2010, 12(5): 697-704.
27.
Li, B. S., Wang, X. Y., Ma, F. L., Jiang, B., Song, X. X., & Xu, A. G. Is high resolution
melting analysis (HRMA) accurate for detection of human disease-associated mutations? A metaanalysis. PLoS One. 2011, 6 (12) p. E28078.
28.
Erali, M., Voelkerding, K. V., & Wittwer, C. T. High resolution melting a:lications for
clinical laboratory medicine. Exp Mol Pathol. 2008, 85 (1): 50-58.
29.
Kapabiosystems. (n.d.). Introduction to High Resolution Melt Analysis. [online] Available
from:
http://www.kapabiosystems.com/public/pdfs/kapa-hrm-fast-pcrkits/Introduction_to_High_Resolution_Melt_Analysis_Guide.pdf. [Accessed: 21 October 2011]
30.
Ruskova, L. & Raclavsky, V. The potential of high resolution melting analysis (hrma) to
streamline, facilitate and enrich routine diagnostics in medical microbiology. Biomed Pap Med Fac
Univ Palacky Olomouc Czech Repub. 2011, 155(3): 239-252.
31.
Vossen, R. H., Aten, E., Roos, A., & den Dunnen, J. T. High-resolution melting analysis
(HRMA): more than just sequence variant screening. Hum Mutat. 2009, 30 (6): 860-866
32.
Taylor, C. F. Mutation scanning using high-resolution melting. Biochem Soc Trans. 2009, 37
(2): 433-437.
33.
Picard, N., Yee, S. W., Woillard, J. B., Lebranchu, Y., Le Meur, Y., Giacomini, K. M., &
Marquet, P. The role of organic anion-transporting polypeptides and their common genetic variants
in mycophenolic acid pharmacokinetics. Clin Pharmacol Ther. 2010, 87(1): 100-108.
34.
Laitinen, A. & Niemi, M. Frequencies of single-nucleotide polymorphisms of SLCO1A2,
SLCO1B3 and SLCO2B1 genes in a Finnish population. Basic Clin Pharmacol Toxicol. 2011,
108(1): 9-13.
35.
Chew, S. C., Singh, O., Chen, X., Ramasamy, R. D., Kulkarni, T., Lee, E. J., Tan, E. H., Lim,
W. T., & Chowbay, B. The effects of CYP3A4, CYP3A5, ABCB1, ABCC2, ABCG2 and SLCO1B3
single nucleotide polymorphisms on the pharmacokinetics and pharmacodynamics of docetaxel in
nasopharyngeal carcinoma patients. Cancer Chemother Pharmacol. 67(6): 1471-1478.
36.
Galani V, Alexiou GA, Miliaras G, Dimitriadis E, Triantafyllou E, Galani A, Goussia A,
Kanavaros P, Trangas T. Expression of Stem Cell Marker Nestin and MicroRNA-21 in
Meningiomas. Turk Neurosurg. 2015;25(4):574-7.
37.
Nakanishi, T. & Tamai, I. Genetic Polymorphisms of OATP Transporters and Their Impact
on Intestinal Absorption and Hepatic Disposition of Drugs", Drug Metab Pharmacokinet. 2012,
27(1): 106-121.
A.
B1. SLCO1B3-201
B2. SLCO1B3-001
Figure 1:
A. SLCO1B3 is located in chromosome 12 (2p12–31.7 to 12p12–37.2) (GeneCards. SLCO1B3.
Genomic Location. 2012)
B1. The map of the transcript SLCO1B3-201.
B2. The map of the transcript SLCO1B3-001.
Figure 2: Immunohistochemical staining of colon adenocarcinoma tissue
Sample . There is cytoplasmic expression of the antibody in neoplastic and not in normal epithelial
tissue. A: X40, B: X100
Table 1: Oligonucleotide primer sequences to carry out HRMA of the SLCO1B3 coding region
Annealing
Amplicon temperature
Exon Forward primer
Reverse Primer
size (bp)
(0C)
5'5'CATCATTGGACTCATAAAAA GAAATGTTTTAATTAGACAA 151
45
CAAA-3'
CCTCGAC-3'
1
5'5'57
AACAGGTGATCATTTCAAA AATCCATTGCAGCGTCTTGT- 150
CCA-3'
3'
2
5'5'52
ATGTTCTTGGCAGCCCTGT- AAAGTTACCAATTTCAAAGC 150
3'
TTCC-3'
3
5'5'TTCTAGGAAATTTGCTTGTG TGGCTCAGAGCTGTTTAACA
ATTG-3'
CTTA-3'
164
4
5'5'50
CAAAATGTTCAATTTCATGT TTTTTCTACTATCTCAGGTGA 152
TGC-3'
TGTTCC-3'
5
5'5'57
AAAGTAAAACACTCTCTTG TCCAGGGAATGTAATCATGA
TCTCGAT-3'
AA-3'
219
6
5'5'48
ACAGGTAGTTTGAATGCAAT TGCACTTAAAAGACACTATC 150
AGGA-3'
ATGG-3'
7
5'5'55
CGATTTTTGACTGGCTTCTT CAATTCCAAGTTGACAATGA
TT-3'
ATG-3'
315
8
5'5'55
TCCAGTCTTTGAAAAGCAT ACCCAACAAAAAGTTAGCAT 161
CC-3'
GA-3'
9
5'5'55
AGAATGGGTGAATTTGGTT TGCACATAATCTTTTAATTTG 365
GA-3'
ATGG-3'
10
5'5'55
CCCTCTCCTTATCCCCTTGT- GGAGAGGAGAAAAAGTGAA
3'
AACT-3'
287
11
5'5'55
TTGGCAAATGTATTTGTTAA CATGACAATGTTTTACAGGAT 256
TATTTC-3'
CA-3'
12
5'5'50
TGACATGTATTATTTCTTTGC AGTGTTCTTATAACCATTGAC
CTTT-3'
TGGAA-3'
100
13
5'5'50
TCTCATGTTGCAGGAGGAATTGTGTTTACGACAACTTACC 150
-3'
CAAA-3'
14
5'363
15a 5'-
15b
16
TCGACTCTCTATTTTCTCTTT TCCATTGGTCCACTGTAAGTA
TCACA-3'
AA-3'
5'5'TCCAACATTCTTTACTTACA GGTTGGAAGAAGATCCATCG 459
GTGGA-3'
-3'
5'5'GTGCATTTATCGCCACATTG- TTCATGCCTGAGGGAAACTT3'
3'
166
Table 2: The program of the Lightcycler® 480 Instrument.
Detection
Block Type Reaction
Format
Volume
SYBR Green I
96
20 μl
Programs
Program name Cycles
Analysis Mode
Pre-Incubation
1
None
Amplification
55
Quantification
High Resolution 1
Melting Curve
Melting
Cooling
1
None
Temperature Targets
Target (0C)
Acquisition Hold
Ramp
Acquisitions
Mode
(hh:mm:ss)
Rate (0C/s) (per 0C)
(96 wells)
Pre- Incubation
95
None
00:10:00
4.4
Amplification
95
None
00:01:00
4.4
Primer
None
00:01:00
2.2
dependent*
72
Single
00:01:00
4.4
High Resolution Melting
95
None
00:01:00
4.4
40
None
00:01:00
2.2
65
None
00:00:01
1/1
95
Continuous 25
Cooling
55
Table 3: Immunohistochemical expression of OATP1B3 (Score scale (0, 1+, 2+, 3+) reflecting
antibody product expression intensity), and the type of mutation identified by HRMA in each case.