Download Supplementary Information (doc 63K)

Supplemental Methods
Microarray analysis
Immunoprecipitated mRNA was collected as described above and hybridized to the Atlas Human
apoptotic cDNA microarray membrane (Clontech). Gene hybridization levels were compared
between samples to determine those messages which increase following 3A2 IP, relative to IP
with IgG control antibody.
Northern blotting
Northern blot probes were synthesized by PCR reaction off of template cDNA. HuR, GAPDH
and 18S probes have been previously described 1. GFP template (Clontech) was amplified using
the following primers: GFP-F: 5’-AGTGCTTCAGCCGCTACCC-3’ and GFP-R: 5’GCTTGTGCCCCAGGATGTT-3’. Caspase-9 template (Open Biosystems) was amplified using
the following primers: C9-Forward: 5’-GGGAGCAGAAAGACCATGGGT -3’ and C9-Reverse:
5’- ATTTGCGGCCGCTTATGATGTTTTAAAGAAAAGTT-3’. ProT template (generous gift
from T. Kobayashi
2
) was amplified using the following primers: ProTalpha-F: 5’and
GTAGACACCAGCTCCGAAATCAC-3’
TCTGCTTCTTGGTATCGACATCG-3’.
1
ProTalpha-F:
5’-
RT-PCR and RT-qPCR
Primers used for PCR to detect caspase-9, hnRNPA 1 and ProT DNA from IP/RT experiments
were synthesized by Integrated DNA Technologies (IDT), and were the following: caspase-9Forward:
5’-GCATTTCATGGTGGAGGTG-3’,
caspase-9-Reverse:
5’-
GTAGGACACAAAGATGTCAC-3’; ProT-Forward: 5’-CCAACCCAAACCATGAGAA-3’,
ProT-Reverse:
5’-GGTCACACCACAAGTAAAGTCAG-3’;
AAGGGGCTTTGCCTTTGTAACCTT-3’,
hnRNPA1-Forward:
hnRNPA1-Reverse:
5’5’-
CATTATAGCCATCCCCACTGCC-3’. Primers used for qPCR to detect caspase-9 and ProT
were also synthesized by IDT and were: qcasp9-Forward: 5’-GTTTGAGGACCTTCGACCAG3’,
qcasp9-Reverse:
5’-GCATTAGCGACCCTAAGCAG-3’;
qProT-Forward:
5’-
CTGCTAACGGGAATGCTGA-3’, qProT-Reverse: 5’-TCGACATCGTCATCCTCATC-3’
FLAG-caspase-9 plasmid production
The synthesis of FLAG-caspase-9 full length and FLAG-caspase-9 mut AREs plasmids was
performed as follows. Caspase-9 sequence was amplified by PCR, using full-length caspase-9
cDNA as the template. A BamHI site was created at the 5’-end of the PCR product, followed by
nucleotides encoding for a FLAG tag, and a NotI restriction site was created at the 3’-end. The
primers
used
for
full-length
caspase-9
were:
FLAG-C9-F:
5’-
GCAGGATCCATGGACTACAAAGACGACGACGACAAAGACGAAGCGGATCGGCGGC
TC -3’ and full-C9-R: 5’- ATTTGCGGCCGCTTTTAAAATTAATGCAATATA-3’. The PCR
fragment was cloned into the BamHI/NotI sites of pcDNA3 vector (GE Healthcare). To generate
the mutated AREs caspase-9, the same forward primer was used, with a reverse primer which
2
produced multiple mutations in ARE2 (shown in Figure 2B). This primer was: mut-C9-R: 5’ATTTGCGGCCGCTTTTAAAATTAATGCGGTGTGGGGGAAGTTGGCGGTTTTTGGGGT
TTCACTTAGAATTCA-3’. The mutations of the indicated nucleotides in ARE1 in this plasmid
were then performed by NorClone Biotech Laboratories (London, Ontario, Canada).
Gel-shift
Two synthetic oligonucleotide caspase-9 ARE cRNA probes were generated [spanning
nucleotides 1841-1870 (ARE-1) and 1944-1988 (ARE-2) of the 3’ UTR of caspase-9]. Each was
fused to a T7 promoter and transcribed in vitro as previously described 3. 50 000cpm of purified
[32P]UTP-labelled cRNA was then incubated with 500ng of either recombinant GST, GST-HuR4,
GST-HuR-CP1 or GST-HuR-CP2 protein5 and RNA-binding assay was performed as done
previously 6. Two additional probes were generated in which every uracil ribonucleotide of these
probes was mutated to a cytosine (mut-ARE-1 and mut-ARE-2), other than those in the T7
promoter region.
Kd determination by Gel-shift
Gel shift was performed as described above using 10 000cpm of purified [32P]UTP-labelled
ARE2 cRNA probe and varying concentrations of GST-HuR, GST-HuR-CP1 and GST-HuRCP2. Band intensities were quantified, and plots of bound/unbound signal against concentration
of GST-protein were generated. The slope of linear trendlines from these graphs were used to
determine experimental Kd values.
3
Polysome fractionation and Slot blot
HeLa cells were treated as described previously 7. Briefly, cells were collected and homogenized,
and then centrifuged and fractionated using a Teledyne ISCO density gradient fractionation
system (Foxy JR fraction collector with a UA-6 UV detector). Each fraction was collected from
22 drops, and 24-28 fractions were collected for each sample. To isolate proteins from each
fraction, overnight precipitation was done at -20°C with two volumes of ethanol. RNA was
extracted following the same protocol used to isolate mRNA from the IPs described above, and
samples were then analyzed by slot blot 8
4
References for Supplemental Mathods
1.
Di Marco S, Mazroui R, Dallaire P, Chittur S, Tenenbaum SA, Radzioch D et al. NF(kappa)B-mediated MyoD decay during muscle wasting requires nitric oxide synthase
mRNA stabilization, HuR protein, and nitric oxide release. Mol Cell Biol 2005; 25(15):
6533-45.
2.
Kobayashi T, Wang T, Maezawa M, Kobayashi M, Ohnishi S, Hatanaka K et al.
Overexpression of the oncoprotein prothymosin alpha triggers a p53 response that
involves p53 acetylation. Cancer Res 2006; 66(6): 3137-44.
3.
Gallouzi IE, Parker F, Chebli K, Maurier F, Labourier E, Barlat I et al. A novel
phosphorylation-dependent RNase activity of GAP-SH3 binding protein: a potential link
between signal transduction and RNA stability. Mol Cell Biol 1998; 18(7): 3956-65.
4.
Brennan CM, Gallouzi IE, Steitz JA. Protein ligands to HuR modulate its interaction with
target mRNAs in vivo. J Cell Biol 2000; 151(1): 1-14.
5.
Beauchamp P, Nassif C, Hillock S, van der Giessen K, von Roretz C, Jasmin BJ et al.
The cleavage of HuR interferes with its transportin-2-mediated nuclear import and
promotes muscle fiber formation. Cell Death Differ 2010.
6.
Di Marco S, Hel Z, Lachance C, Furneaux H, Radzioch D. Polymorphism in the 3'untranslated region of TNFalpha mRNA impairs binding of the post-transcriptional
regulatory protein HuR to TNFalpha mRNA. Nucleic Acids Res 2001; 29(4): 863-71.
7.
Cammas A, Pileur F, Bonnal S, Lewis SM, Leveque N, Holcik M et al. Cytoplasmic
relocalization of heterogeneous nuclear ribonucleoprotein A1 controls translation
initiation of specific mRNAs. Mol Biol Cell 2007; 18(12): 5048-59.
8.
Lian XJ, Gallouzi IE. Oxidative Stress Increases the Number of Stress Granules in
Senescent Cells and Triggers a Rapid Decrease in p21waf1/cip1 Translation. J Biol Chem
2009; 284(13): 8877-87.
5
Supplemental Figure Legends
Supplemental Figure 1: HuR associates with multiple apoptotic-related mRNAs
HeLa cells were lysed and subjected to immunoprecipitation using anti-HuR antibody, or IgG
control. The mRNAs isolated were hybridized to the Atlas Human apoptotic array. Analysis of
the arrays provided a list of messages which showed to associate with HuR two-fold or more by
immunoprecipitation, compared to IgG control antibody. mRNAs that associated with the HuR
antibody by two-fold or more (as defined by the signal ratio on the arrays between anti-HuR and
-IgG control IPs) were tabulated.
Supplemental Figure 2: The 3’UTR of caspase-9 mRNA contains two AU-rich elements
The 3’ UTR of caspase-9 mRNA was found as displayed as NCBI Reference Sequence
NM_001229.2. The two AU-rich elements contained in this sequence are underlined and in bold
font, representing the regions of nucleotides 1841 to 1870 and 1944 to 1988.
Supplemental Figure 3: Knockdown of HuR decreases caspase-9 protein expression in MEFs
(A) MEFs cells were treated with siRNA against HuR or control siRNA for 48h, and their total
protein was collected and analyzed by western blot, using antibodies against caspase-9, HuR and
α-tubulin (loading control). (B) Quantification of band intensities was performed using
6
ImageQuant software. The asterisk indicates a significant difference in mean values. The blot
shown is representative of three independent experiments.
Supplemental Figure 4: The AREs of the casp-9 3’UTR regulate mRNA stability
This graph is a different presentation of the data shown in Figure 3F. Here, the values are
graphed on a logarithmic (base 10) scale, instead of a linear scale.
Supplemental Figure 5: MG132 inhibits proteosome activity
293T cells stably expressing a proteosome targeting signal, tagged with GFP (GFPμ) were
treated with MG132 in parallel to samples described in Figure 4C. Lysates from these cells were
analyzed by western blot probing for GFP and G3BP (loading control), and a representative
image from three independent experiments is shown.
Supplemental Figure 6: The effect of overexpressing HuR and its CPs on caspase-9 and ProT
mRNA
The effect of overexpressing GFP-HuR mutants. (A) Total mRNA was extracted from HeLa cells
48 hours after having been transfected with GFP-plasmid alone, or a plasmid containing GFPHuR, -HuR-CP1 or HuR-CP2. The mRNA was analyzed by northern blot, probing for ProT,
caspase-9 and GAPDH (loading control). (B) Shown is a representative northern of three
independent experiments. The levels of mRNA in each lane were quantified, and the levels are
7
shown as the mean with errors bars representing the SEM. Statistical analysis indicated that all
differences in RNA levels are not significant.
Supplemental Figure 7: HuR-CPs and full-length HuR can rescue Bax-induced cell death
(A) HeLa cells were transfected with siRNA against HuR (or control siRNA) as well as with
HA-Bax plasmid. 32h later, cells were provided with 50nM AP-GST, AP-HuR-GST, or 25nM
AP-HuR-CP1-GST and 25nM AP-HuR-CP2-GST. Cells were photographed 16 hours later, and
a representative phase image of these cells are shown, which is representative of three different
fields of view, each from two independent experiments. (B) The relative percentage of remaining
cells was determined by counting the number of cells present following the treatments described
above from all fields of view, and expressing this as a percentage compared to the number of
cells present on the samples treated with siHuR and AP-GST. Error bars represent the SEM of
two independent experiments.
8