Download Complete Program - Mathematics and Computer Science

CHED 1
Green chemistry: The missing element
John Warner, [email protected] Babcock Institute for Green
Chemistry, Wilmington, MA 01887, United StatesWarner Babcock Institute for Green
Chemistry, Wilmington, MA 01887, United States
Imagine if all consumers, all retailers and all manufacturers insisted on buying and selling
only non-toxic materials! The unfortunate reality is that, even if this situation were to occur,
our knowledge of materials science and chemistry would allow us to provide only a small
fraction of the products and materials that our economy is based upon. The way we learn
and teach chemistry and materials science is for the most part void of any information
regarding mechanisms of toxicity and environmental harm. Green Chemistry is a
philosophy that seeks to reduce or eliminate the use of hazardous materials at the design
stage of a materials process. It has been demonstrated that materials and products CAN
be designed with negligible impact on human health and the environment while still being
economically competitive and successful in the marketplace. This presentation will
describe the history and background of Green Chemistry and discuss the opportunities for
the next generation of materials designers to create a safer and more sustainable future.
CHED 2
Products of the Target Inquiry project: Quality inquiry materials made for and by
high school teachers that stand up to student scrutiny
Ellen J. Yezierski1, [email protected], Deborah G. Herrington2. (1) Department of
Chemistry & Biochemistry, Miami University, Oxford, Ohio 45056, United States (2)
Department of Chemistry, Grand Valley State University, Allendale, MI 49401, United
States
The National Science Education Standards, many state science standards, and the newly
released Conceptual Framework for New Science Education Standards, call on teachers to
develop inquiry-based science programs. Designing such a program can be a daunting
task. Three cohorts of high school chemistry teachers have completed a long-term
professional development program known as Target Inquiry (TI) at Grand Valley State
University. One important product of TI is a peer-reviewed collection of inquiry-based
activities for high school chemistry teachers including research-based guides for students
and teachers. Not only are these activities teacher-designed and teacher-tested, they have
also been edited by chemistry faculty and revised based on feedback from hundreds of
teachers who used the activities with more than 30,000 students around the world. An
overview of the activities, several specific examples, and instructions to access them will
be presented.
CHED 3
Chemistry and the Next Generation Science Standards (NGSS)
Melanie M Cooper, [email protected] of Chemistry, Michigan State
University, East Lansing, MI 48224, United States
The Next Generation Science Standards (NGSS) will be released in Spring 2013. They are
based on the NRC Framework for K-12 Science Education and are the first major science
and engineering standards reform initiative in almost twenty years. They reflect what we
have learned in that time about how children learn and what is needed to promote deep
meaningful learning for all students. The NGSS take the form of a set of performance
expectations, which integrate both disciplinary core ideas and science practices.
Underlying the standards is a set of crosscutting concepts that span across all the
disciplines. This presentation will discuss how the standards were developed, and how
chemistry core ideas are integrated within the standards. We will discuss the changes in
both content and pedagogy that will be needed to address the NGSS and provide
suggestions for how teachers might prepare.
CHED 4
A.S.P.I.R.E: A successful model for introducing project-based learning into at-risk
schools and neighborhood learning centers
Brian A. Salvatore, [email protected] and Physics, Louisiana State University
Shreveport, Shreveport, LA 71115, United States
The After-School Program for innovation and Respect for Education (A.S.P.I.R.E.) is a
professionally guided mentorship program, whereby LSUS faculty members guide college
students to mentor middle and high school students in their own schools and
neighborhoods. The program's curriculum emphasizes project-based learning in science,
technology, engineering, and math (STEM) in some of Louisiana's most at-risk public
schools and residential areas. This program is open to students 11-18 with the permission
of their parents. The program's emphasis on project-based learning stands in stark contrast
to how students are currently being taught in most pubic schools. We have covered a
variety of scientific areas, including medicinal chemistry, embryology, aeronautics,
fluorescence, alternative energy, rocketry, fuel cells, geology, nutrition, and the chemical
senses. This lecture will describe the program's successes and challenges along with
useful guidelines for maximizing student participation, performance, and results.
CHED 5
Baking powder and baking soda: An introduction to food science
Sally B Mitchell, [email protected] of Chemistry, East Syracuse Minoa
Central High School, East Syracuse, NY 13057, United States
This activity will introduce the science teacher to the area of food science using fun
activities with baking powder and baking soda. Lab activities and teaching notes will be
provided.
CHED 6
Molecular spectroscopy in the high school chemistry curriculum
Dick McGraw, [email protected] of Molecular Spectroscopy, Thermo
Scientific, San Jose, CA 95134, United States
Thermo Scientfic, sponsor of the ACS Conant Award for outstanding high school chemistry
teacher, presents an innovative program for high school and college/university science
teachers and chemistry instructors. Both FTIR spectrometers and UV-Vis
spectrophotometer system (including teaching materials, lab experiments and all related
materials) are made availabe free of charge for use in the teaching laboratory.
CHED 7
Energy and food: Ready-to-use resources from the Journal of Chemical Education
Laura E Slocum1, [email protected], Hillary Wilmoth2, [email protected]. (1)
National Cathedral School, Washington, DC 20016, United States (2) ACS Publications,
Washington, DC 20036, United States
This presentation will focus on the chemistry of food and how we get our energy from food.
More importantly for teachers, it will show you how it can be integrated into the curriculum
using already available teaching materials, including hands-on activities that use low-cost
materials from grocery and hardware stores. Presenters will share several ready-to-use
resources from the Journal of Chemical Education (JCE) related to the meeting's theme
“Chemistry of Energy and Food”. These give educators an opportunity to make stronger
connections for their students between the chemical world and the students' "real" world.
As time permits, participants will try out a hands-on JCE Classroom Activity related to the
theme.
CHED 8
Developing a learning progression on benefits, costs, and risks in chemical design
Steven Cullipher1, [email protected], Hannah Sevian1, Vicente Talanquer2. (1)
Department of Chemistry, University of Massachusetts Boston, Boston, MA 02125, United
States (2) Department of Chemistry and Biochemistry, University of Arizona, Tuscon, AZ
85721, United States
The ability to continue sustainable living on this planet depends on our ability to critically
analyze benefits, costs and risks (BCR) of the products that we generate and the
feedstocks that we use, as well as to appropriately reason about the outcomes of our
decisions. The ultimate intent of our research is to uncover intermediate understandings
through which learning can be deliberately directed. In this work, we present the early
stage development of a learning progression that describes the evolution of implicit
assumptions along core progress variables that account for relative degrees of
sophistication in reasoning as students advance in their education as chemists. Qualitative
analysis of pilot study data from surveys and interviews obtained from undergraduate
students at two universities in the United States has uncovered domain-general and
chemistry-specific progress variables. The product of this work informs our larger learning
progression on chemical design.
CHED 9
Investigations of language comprehension on performance in general chemistry
Samuel Pazicni1, [email protected], Daniel Pyburn1, Victor Benassi2, Elizabeth
Reilly2. (1) Department of Chemistry, University of New Hampshire, Durham, NH 03824,
United States (2) Center for Excellence in Teaching and Learning, University of New
Hampshire, Durham, NH 03824, United States
While mathematical ability has long been implicated as crucial for learning chemistry,
language ability remains largely uninvestigated. This contribution explores correlations
between language comprehension and performance in general chemistry. Structure
Building, a model that describes how linguistic information is incorporated into one's
existing knowledge base, guides our work. We demonstrate that comprehension ability
correlates strongly with chemistry course performance. An examination of variables
predicted to interact by the Structure Building Framework suggests that high
comprehension ability may be sufficient to compensate for low prior knowledge.
Intriguingly, our results also suggest that instruments used to measure comprehension
ability and math ability are not wholly independent of one another. We also report the
design and analysis of a multiple-testing intervention strategy that differentially aids those
of low comprehension ability. The effect of question type (multiple choice versus
elaborative interrogation) on this multiple-quizzing strategy has also been investigated.
CHED 10
Interactive simulation use by small groups in a large lecture setting: Student use
and perceptions
Emily B. Moore1, e[email protected], Timothy A. Herzog2, Katherine K.
Perkins1. (1) Department of Physics, University of Colorado Boulder, Boulder, CO 80305,
United States (2) Department of Chemistry, Weber State University, Ogden, UT 84408,
United States
Interactive simulations are emerging as powerful educational tools that support student
learning through scientist-like exploration and experimentation. The PhET Interactive
Simulations project has developed over 30 simulations for teaching and learning chemistry.
In this study, we investigate what students do when using a PhET simulation with no
explicit use instructions in a large lecture environment. From analysis of mouse click data,
audio recordings, and clicker question responses, we found that, during 10-minutes of
exploration with a PhET simulation, students: interacted with the majority of features
available; had content-focused discussions with intermittent off-topic conversations; and
found use of the simulation easy and productive for learning. Results suggest possibilities
for increasing the amount of effective group work in large classes using interactive
simulations with minimal instructions.
CHED 11
Using the picoSpin NMR for undergraduate work
Sarah M Dimick Gray, [email protected] of Natural
Sciences, Metropolitan State University, St. Paul, MN 55106, United States
The new picoSpin NMR allows for hands-on experimentation by undergraduate students in
departments unable to afford a traditional NMR. We have been working with the picoSpin
NMR for the past 18 months and present some of the experiments successfully performed
in both research and classroom settings as well as some of the challenges and limitations
with the instrument.
CHED 12
Using a PicoSpin NMR spectrometer in the sophomore organic lab
Brett Mayer, John Balyeat, Allen M. Schoffstall, [email protected] of
Chemistry and Biochemistry, University of Colorado Colorado Springs, Colorado Springs,
Colorado 80918, United States
Rationale for using a PicoSpin NMR spectrometer in the sophomore organic lab is two-fold;
rapid analysis and ease of interpretation. A quick generation of NMR data for a synthetic
process is desired so that every student can assess whether he or she made the desired
product and in what purity. The presence of remaining starting materials or side products
can also be determined so that each student can evaluate the relative success of the
synthetic experiment. Also, the spectra should be interpretable for students who are just
learning the basics of NMR spectroscopy in terms of the number of signals observed, the
chemical shifts, the coupling patterns and the coupling constants. A brief description of the
spectrometer and its use will be discussed. Student data will be presented for organic
synthesis experiments leading to liquid products, which are most easily accommodated
using the instrumentation.
CHED 13
A little introduction to NMR with a little NMR
Laura J Anna, [email protected] of Chemistry,
Montgomery College, Rockville, MD 20850, United States
With the acquisition of a 45MHz Picospin NMR spectrometer, students in the organic
chemistry laboratory can acquire NMR spectra of liquid compounds quickly and easily with
no sample preparation. The Picospin NMR spectrometer was used to teach the
introductory concepts of NMR interpretation including number of signals, chemical shift,
integration and multiplicity and real-time analysis of reaction products. The spectrometer
was also used to quickly analyze student samples to confirm product formation in synthesis
reactions. This presentation will highlight the introduction and ongoing efforts to further
integrate the Picospin NMR into the introductory organic chemistry laboratory curriculum.
CHED 14
Incorporation of NMR spectroscopy into organic chemistry laboratory at Butler
University
LuAnne McNulty, [email protected], Anne Wilson, John Esteb, Paul Morgan, Stacy
O'Reilly, Adam Azman.Department of Chemistry, Butler University, Indianapolis, IN 46201,
United States
Butler University has a minimum of 240 students taking organic chemistry each semester.
The introduction of NMR spectroscopy into the laboratory during the second semester is
difficult without the ability to run all samples during established laboratory periods. As a
result, students are provided with FIDs of necessary compounds. For example, during the
unknown laboratory, each student is given both proton and carbon data for a solid and a
liquid unknown. They use freeware to transform the data. As the second semester
laboratory progresses, students are given FIDs for all compounds possible from a given
laboratory, they do the data analysis for structure determination and correlate that
information to data obtained from a real GC-MS sample.
CHED 15
NMR as an effective and convenient tool for teaching reaction kinetics in
undergraduate organic laboratory courses
John A Cramer, [email protected] of Chemistry, Seton Hill University,
Greensburg, Pennsylvania 15601, United States
Although a wide range of fruitful applications of NMR spectroscopy has been achieved in a
wide range of scientific disciplines, the use of NMR as a pedagogic tool for teaching
chemical principles to undergraduate students remains relatively unexplored. NMR
spectroscopy is in fact a versatile and robust teaching tool for connecting and engaging
students with the molecular world and its operative principles. This presentation will
describe experiments where 60 MHz proton NMR spectroscopy is used to introduce
students to reaction kinetics. Many of these experiments involve performing reactions in
NMR tubes. These microscale experiments represent a safe, efficient, inexpensive, and
effective means for teaching students the principles of chemical reactivity. Monitoring the
progress of reactions performed in NMR tubes can be straightforwardly accomplished by
measuring the areas of resolved resonances of either reactants or products with respect to
time. Examples of kinetic experiments to be presented include Diels-Alder reactions and
nucleophilic substitution reactions of alkyl halides.
CHED 16
Proton coupled 13C nmr is useful for assigning chemical shifts in substituted
benzenes
Donald D Clarke, [email protected] of Chemistry, Fordham University,
New York, NY 10458, United States
1H
decoupled 13C nmr is standard & JCH data lost. 2D [1H13C] correlation recovers some
data. It fails when 1H δ's are close e.g. alkylbenzenes. Contradictory δ's for C-2 of toluene
are reported. 1H coupled 13C spectra [1DC] gave a firm answer [o>m>p]. Benzonitrile has
two C's with no H. 1DC distinguishes these. 3-nitrobenzonitrile has conflicting δ's in
databases. 1DC settles δ's and SDBS has corrected their assignments. Basis is that on a
benzene ring 1JCH [~160 Hz]>>3JCH [~10 Hz] > 2JCH [~3 Hz] > 4JCH [~1 Hz]. Latter two are
not resolved. Supported in part by an NSF grant for a 300 MHz spectrometer and by a
Faculty Research grant from Fordham University.
CHED 17
Encouraging self-discovery through in-class demonstration laboratories
Jason C Dunham, Jason W Ribblett, [email protected] of Chemistry, Ball
State University, Muncie, IN 47306, United States
Limitations in resources have prevented our department from offering a traditional
laboratory for the non-majors introductory chemistry course. Instead, the authors have
developed in-class demonstrations which provide students an opportunity to record
observations and data, analyze and graph data, and formulate conclusions as a substitute
for the traditional laboratory. Developed experiments cover introductory chemistry topics
such as physical and chemical properties, strength of intermolecular forces and phase
changes, writing balanced chemical equations, properties of ionic and molecular
compounds, and water solubility of alcohols. A typical experiment requires that students
record observations and data while the instructor performs the demonstration during the
lecture. Once all data and observations have been recorded, students are required to
analyze and/or graph their data to formulate conclusions. Each student is then required to
turn in a completed lab write-up which includes all recorded data and observations, data
analysis and conclusions, and answers to post-lab questions.
CHED 18
Integration of computational chemistry into a non-majors, general education
chemistry course
Kelly R. Gallagher, [email protected], Alyson Marmet.Department of
Chemistry and Biochemistry, SUNY College at Oneonta, Oneonta, New York 13820,
United States
Although commonly employed in courses for science majors, computational chemistry has
largely been avoided in non-majors chemistry curricula. In an effort to help students better
visualize how molecular phenomena lead to macroscopic properties, we introduced
computational techniques in our non-majors course. This approach taps into modern
students' familiarity with digital technology and provides another avenue for discussing
applications relevant to their lives. Computer models were often used in lecture and several
laboratory exercises were implemented. First, basic modeling and visualization techniques
were introduced via a computational activity that related molecular structure and vibrations
to the greenhouse effect. A subsequent coordinated experimental and computational
exercise examined solubility and hydrogen bonding in the context of melamine-based food
contamination. These activities gave students an elementary experience of computational
chemistry, provided an enhanced understanding of the role computational models play in
modern science, and facilitated the formation of connections between personal experience
and the theories discussed in class.
CHED 19
Materials science experiments for nonmajors
Jennifer E Mihalick, [email protected] of Chemistry, University of
Wisconsin Oshkosh, Oshkosh, Wisconsin 54901, United States
"Introduction to the Chemistry of Materials" is a non-majors class that teaches the
chemistry behind materials that society depends on: metals, polymers, ceramics and
semiconductors. The topics are of great relevance to students majoring in the humanities,
since human civilizations have always depended on the available materials - stone, bronze,
iron or silicon. The economic impact of materials processing and trade is of interest to
business and economics majors.
The laboratory experiments for this course introduce a variety of techniques used to
synthesize, process, and analyze different types of materials. Experiments will be
described in which students make polyester, paint, glass, and concrete; process metals
and fibers; and analyze fibers, dyes and glazes.
CHED 20
Experiential chemistry: A unique laboratory course for non-majors
Marc L Richard, [email protected], Jonathan Griffiths.Chemistry Program,
Richard Stockton College of New Jersey, Galloway, NJ 08205, United States
The presentation of chemistry by an experiential approach can be particularly exciting for
non-science majors. To a large extent, the teaching of science concentrates on the early
mastery of factual material before the students are allowed to explore the interesting
problems. The approach used in this course reverses this traditional pattern. Students are
first presented with a series of exciting experiments and are allowed to experience the
excitement of chemistry. Once their curiosity has been aroused and ask, “Why?”, they are
ready to begin to work with the underlying chemical principles. Students in Experiential
Chemistry work in the laboratory each day to develop an understanding of: the process of
doing chemistry, the nature of chemists and chemistry, and the question asking,
experimentation and communication skills essential for the practice of chemistry. The
experiences, class discussions, and writing assignments give non-science students a
unique and exciting introduction to chemistry.
CHED 21
Uptake and impacts of silver nanoparticles on Brassica rapa: A non-majors
laboratory experience
Kevin M. Metz, [email protected], Stephanie E. Sanders, Anna K. Miller.Department of
Chemistry, Albion College, Albion, MI 49224, United States
Nanoscience is one of the fast growing fields in science and engineering. Laboratory
experiments and entire courses for science majors have been developed at the
undergraduate level to study nanoscience. However, little curricular material has been
deveoped for the non-majors. Here we present a semester-long laboratory sequence
developed for a non-majors course, where students investigate the potential environmental
impacts of nanoscience. Students synthesize and characterize silver nanoparticles using
green synthetic methods. They then use the suspension of silver nanoparticles to “water”
Wisconsin Fast Plants, Brassica rapa, over a three to four week period to simulate
environmental exposure. Possible impacts are examined throughout the growth period, and
silver uptake by the plants is quantified at the end of the growth period. This lab requires
design input from the student, making it an open ended experiment. Students participating
in this class reported a renewed interest in, and greter understanding of, science.
CHED 22
Laboratory experiments for consumer chemistry
David A. Katz, [email protected] of Chemistry, Pima Community College,
Tucson, AZ 85709, United States
An integrated lecture-laboratory consumer chemistry course has been taught by this author
since 2004. The course, which is Internet based, uses a series of experiments dealing with
common materials that have been developed or modified from other sources in the areas
of soaps and detergents, food chemistry, water chemistry, cosmetics and personal care
items, over-the-counter drugs, polymers, metals, nanotechnology, dyes, papermaking, and
artist materials. Although these were aimed at the non-major students, some of the
experiments are now being incorporated into the general chemistry course.
CHED 23
First-year writing seminar on science in art and archaeology
Christopher J Stromberg, [email protected] of Chemistry and Physics,
Hood College, Frederick, MD 21701, United States
This talk describes a first-year seminar on Science in Art and Archaeology. The goals of
the first-year seminars at Hood College are to increase writing skills and information
literacy in our first-year students and to help them with the adjustment to college-level work
expectations. Each week, we cover a scientific technique used in art and archaeology. On
Mondays we cover the technique itself, including the basic chemical principles underlying
it. These periods often include demonstrations, including a series of studies on home-made
paintings using multi-spectral imaging and IR and Raman spectroscopy. On Wednesdays
we discuss a paper that used the week's techniques to solve real problems in art and
archaeology. Multiple writing assignments are given throughout the semester including
weekly literature reviews and homework sets, two three-page papers, and one 8-10 page
research paper. Through this course, students are exposed to interesting applications of
science and reading the scientific literature.
CHED 24
Catching criminals with chemistry: A non-majors course in forensics
William S. Case, [email protected] of Chemistry, University of Richmond,
Richmond, VA 23173, United States
Forensics has awakened a heightened interest in science among society at large. At the
university level, forensics provides a wonderful way to engage non-majors in a scientific
setting. At the University of Richmond we have created a non-majors chemistry course
entitled "Catching Criminals with Chemistry." The course teaches students how chemistry
can be applied to solving crimes. The nature of physical evidence is discussed, along with
the chemical techniques used to gather and analyze that evidence. The course also
introduces students to the legal aspects surrounding the introduction of evidence in court,
thus providing an interdisciplinary focus for those interested in science and law. By
combining case studies with applicable technology in the laboratory, students gain a
heightened understanding of the important roles that chemistry plays in forensics. More
importantly, non-majors leave the course with a solid understanding of a vast array of
chemical instrumentation.
CHED 25
Using milk and cheese to demonstrate food chemistry
Michael H. Tunick, [email protected] & Functional Foods Research
Unit, U.S. Department of Agriculture, ARS, ERRC, Wyndmoor, PA 19038, United States
Students usually do not realize how much chemistry is involved in making a food like
cheese, and teachers may use milk and cheese to reveal some interesting principles.
Cheese is made by lowering the pH of milk, coagulating the protein with enzymes, and
removing the whey with heat and pressure. The huge array of cheese in the world results
from variations in the procedures, leading to different chemical reactions in the curd during
processing and storage. Chemical principles are demonstrated with some simple
experiments, such as acidifying milk to precipitate casein (demonstrating the isoelectric
point) and heating different varieties to compare how far they stretch and the amount of oil
coming off (illustrating the importance of the physical state of the protein matrix). Related
experiments include adding drops of milk to a glass of water to illustrate light scattering.
Experimentation with common foods such as milk and cheese ought to elevate a
classroom's interest in chemistry.
CHED 26
Reaching the non-traditional student population via math primers in a freshman
chemistry lab course
Meagan K. Mann, [email protected], C. Drew Carrico.Department of Chemistry, Austin
Peay State University, Clarksville, Tennessee 37044, United States
At schools with a high non-traditional student population, the basic arithmetic involved in
freshman chemistry is often a major source of frustration and confusion as students try to
recall information from math courses they took five or more years before. This often leads
to students doing poorly in the course as they try to learn chemistry calculations while not
fully understanding the arithmetic involved. Presented here is a lab redesign for a nonmajors chemistry course that incorporates math primers with the pre-lab materials to help
students get a step-by-step guide on how to answer problems that are present in both
lecture and lab. A comparison and assessment of these new labs as compared to the
previously used, traditional format labs is included.
CHED 27
Tandem cross-coupling/electrocyclization cascades: A modular strategy
Katerina P. Hilleke, [email protected], David A. Vosburg.Department of
Chemistry, Harvey Mudd College, Claremont, CA 91711, United States
This talk will describe a unified synthetic strategy for the synthesis of beilschmiedic acid C,
endiandramide A, erythrophloin C, and related bioactive natural products. In each case,
acyclic building blocks have been joined in a Stille cross-coupling reaction that triggered
two electrocyclization reactions. The resulting bicyclo[4.2.0]octadiene products can be
further manipulated to generate both natural and unnatural products.
CHED 28
Synthesis of tripodal CMPO compounds for heavy metal chelation
Michael T Peruzzi1, [email protected], Eric J Werner2, Shannon M Biros1. (1)
Department of Chemistry, Grand Valley State University, Allendale, MI 49401, United
States (2) Department of Chemistry, Biochemistry and Physics, The University of Tampa,
Tampa, FL 33606, United States
Heavy metal chelation has a wide variety of applications including nuclear waste
remediation, MRI contrast agents, and chelation therapy. The TRUEX nuclear waste
remediation process currently employs carbamoylmethyl phosphine oxides (CMPOs) as
bidentate chelation agents to remove heavy, f-series metals from spent nuclear fuel.
However, single CMPO units are promiscuous in their selectivity and many metals require
a greater denticity than provided by three solitary CMPOs. Our lab is currently interested in
organizing CMPO units on a tripodal cap to take advantage of the chelate effect. We are
also interested in derivatizing these ligands to increase the affinity and selectivity of metal
binding. Current efforts toward the synthesis of these compounds will be discussed.
CHED 29
Towards a rational design of a better tetracycline: Understanding zinc binding
interactions in tetracycline
Evan L Flores, [email protected], Sabrina G Sobel, Tim Leimbach.Department of
Chemistry, Hofstra University, Hempstead, New York 11549, United States
Matrix metalloproteinases (MMPs) are known to cause acne and periodontal disease and
have been implicated in cancer through remodeling of the surrounding tissues to enable
tumor growth. MMPs have an essential zinc(II) ion as part of the active site. Tetracycline
and analogues are known to be effective treatments for acne and periodontal disease. One
hypothesis involves the complexation of Zn(II) ions, thus reducing the availability of free
Zn(II) in the extracellular environment for use by MMPs; tetracycline does not competitively
inhibit MMPs with zinc already bound. The binding mode of tetracycline with metal ions has
only been speculated.
This exploratory work aims to test tetracycline and its coordination with Zn(II) ions. Titration
methods show the stoichiometry of tetracycline to zinc in a biologically relevant, pHcontrolled environment. Molecular modeling provides insight into tetracycline's coordination
to Zn(II). By understanding tetracycline's binding mode, we can further the efficacy of this
class of molecules.
CHED 30
Synthesis and biological testing of biotinylated dione-coupled platinum complexes
Katie J. Bitting1, [email protected], Abraham L. Yousef1, Robin L. Davies2, Robert
Granger1. (1) Department of Chemistry, Sweet Briar College, Sweet Briar, VA 24595,
United States (2) Department of Biology, Sweet Briar College, Sweet Briar, VA 24595,
United States
Many cancer cells over-express receptors for certain vitamins such as folic acid and biotin,
therefore attaching one of these vitamins to a cytotoxic compound (e.g. cisplatin) is a
potential method for designing useful chemotherapeutic agents with increased selectivity
and cellular uptake. The research presented herein will detail our work towards the
synthesis of biotinylated imidazophenanthroline and dipyridophenazine-based platinum
complexes. Synthetic strategies for the coupling of 1,10-phenanthroline-5,6-dione to 4acetylaminobenzaldehyde and 1,2,4-triaminobenzene compounds will be discussed along
with an EDC-mediated biotin coupling scheme. The bioactivities of the compounds against
HCT-15 cancer cells will be explored and the results presented and discussed.
CHED 31
Four-step, stereoselective synthesis of artemone
Brian C. Fielder, [email protected], David A. Vosburg.Department of Chemistry,
Harvey Mudd College, Claremont, CA 91711, United States
Artemone is an antifungal natural product from the Indian sage Artemisia pallens. We have
developed a direct, four-step synthetic route from (-)-linalool that features a stereoselective
cyclization with an organocatalyst. This synthesis uses no protecting groups, minimizes
redox manipulations, and seeks to maximize atom economy.
CHED 32
Progress towards the synthesis of the repeating pentasaccharide unit of
pneumococcal serotype 31
Nicole L Snyder1, Makenzie K Treible1, [email protected], Connor W Brown2,
Alexander D Thompson2, Megan A Schlosser2. (1) Department of Chemistry, Davidson
College, Davidson, NC 28035, United States (2) Unaffiliated, United States
Streptococcus pneumonia-based invasive pneumococcal disease (IPD) is one of the
leading causes of illness in adults and children worldwide. Streptococcus pneumoniae are
identified by capsular polysaccharide cell surface markers (serotypes) that are
distinguished by their chemical structure and antigenicity. Today, over 90 different
serotypes are known to exist. Advances in science and technology over the past 70 years
have led to the development several vaccines based on capsular polysaccharide isolates.
Combined, these vaccines account for 23 of the over 90 known serotypes. As part of our
ongoing efforts to augment existing vaccines, our group has been focusing on synthesis of
the repeating pentasaccharide unit of pneumococcal serotype 31 or PS31. Herein we
report on our ongoing efforts to overcome several of the synthetic challenges en route to
PS31, including the incorporation of galactofuranose residues substituted at the C3
position and two β-rhamnosidic linkages.
CHED 33
Synthesis of a phosphorylated, lipid-linked inositol glycan as a potential anti-cancer
agent
Vanessa Ruiz, [email protected], Marc d'Alarcao.Department of Chemistry,
San Jose State University, San Jose, CA 95192, United States
Inositol glycans (IGs) are naturally occurring, phosphorylated, inositol-containing
carbohydrates that are released by insulin-sensitive cells in response to insulin. IGs can
activate pyruvate dehydroganase phosphatase, thus stimulating aerobic metabolism.
Cancer cells are known to switch from aerobic metabolism to anaerobic metabolism even
in the presence of oxygen, a phenomenon known as the Warburg effect. This is thought to
enable cancer cells to evade intrinsic apoptosis. Our goal is determine if a synthetic IG
competent to stimulate aerobic metabolism in cancer cells, thus reversing the Warburg
Effect, can cause the cells to undergo apoptosis. Our target compound is a
pseudodisaccharide comprised of 2-glucosaminyl-alpha1,6-myo-inositol containing a 16carbon lipid chain and a phosphate group. Progress toward the chemical synthesis and
biological evaluation of this IG as an anticancer agent will be described.
CHED 34
Phospholipid remodeling as a pharmaceutical target against Candida albicans
Mariam Ayyash, [email protected], Amal Algahmi, Peter Oelkers.Department of
Natural Sciences, University of Michigan-Dearborn, Dearborn, Michigan 48128, United
States
Candida albicans is a common, commensal yeast. Over-proliferation, however, can lead to
dangerous infections especially in immunocompromised people. Treatments often involve
pharmaceuticals that compromise the integrity of the yeast's plasma membrane. We
hypothesize that inhibiting phospholipid remodeling in C. albicans will augment the effect of
these drugs. Phospholipid remodeling involves the removal of acyl chains and replacement
with different acyl species. Initially, we targeted a C. albicans gene homolog to
Saccharomyces cerevisiae gene, LPT1, which encodes for a Lysophospholipid
acyltransferase. To characterize this homolog (designated 1881), we expressed 1881 in S.
Cerevisiae, and performed in-vitro assays to determine the gene's substrate specificity.
Our results show that substrate utilization is significantly higher for unsaturated acyl-CoA
species than saturated species. We also created homozygous 1881 deletion strains of C.
albicans, which are used to perform virulence assays, LysoPL substrate specificity assays
and mass spectrometry assays for measuring the rate of phospholipid remodeling.
CHED 35
Why sustainability matters: Creating videos in a water chemistry unit
Joseph R Vincente, [email protected], Andrea Swenson,
[email protected] of Science, East Side Community High School, New
York, NY 10009, United States
It is our responsibility as educators to help students see their place in the world as active
citizens and to expect them to use their scientific knowledge to advocate for sustainable
practices. This presentation will focus on a project created by the 10th grade chemistry
teacher and school librarian in a public high school in Manhattan in which students created
3-minute Public Service Announcement videos on a water sustainability issue of their
choice. Without extensive class time given to video production, students were able to
synthesize their understanding of chemistry principles and sustainability and apply their
understanding to a social issue. This presentation will describe the process of taking a
traditional unit focused on water chemistry and transforming it to culminate in this highinterest, high-quality assessment. Attendees will receive access to easily adapted materials
for a variety of educational settings, including an assessment rubric and online examples.
CHED 36
Infusing sustainability into science lessons: Challenges and growth
Resa M Kelly, [email protected], Cristina Chang, [email protected], Ellen
Metzger, Ferdinand Rivera.Chemistry, San Jose State University, San Jose, CA 951920101, United States
The overall goal of this Google funded project was to present pre-service teachers (10)
enrolled in math and science methods courses with an orientation to climate
change/sustainability issues to inspire them to consider relevant ways that they could
incorporate sustainability threads in their lessons. The pre-service science teachers were
assigned to infuse sustainability into at least one lesson as part of their unit plan, the
culminating project of the course. Upon completion, the students presented their
sustainability lesson efforts to in-service teachers in the Bay area, SJSU education faculty
and graduate students to promote discussion and revision. Examination of their projects
revealed weak applications of sustainability and lead to further study to examine in-service
teachers' understanding of three components of sustainability as the components were
modeled in short You-Tube videos. Results from this study will be shared.
CHED 37
Incorporation of sustainability into chemistry education in Russia
Natalia Pavlovna Tarasova, [email protected] Chair [quot]Green Chemistry for
Sustainable Development[quot], D.Mendeleev University of Chemical Technology of
Russia, Moscow, Russian Federation
The first tertiary education organization (Institute of Chemistry and Problems of Sustainable
Development) that promotes ideas of sustainable development in Russia is based in the
prestigous Mendeleev University of Chemical Technology of Russia and admits students
pursuing undergraduate and graduate degrees in areas such as Chemistry, Sociology,
Ecology and Environmental Science, and Teaching Chemistry. The goal of the Institute is
to promote ideas of interdisciplinary education for sustainable development and to
incorporate fundamental science into higher education. Thankfully to continuous efforts
over last two decades the subject of Sustainable Development was brought into curriculum
of the Mendeleev University.
Several world famous scientists such as Professor Dennis Meadows, Dr. Alan Atkisson
and Dr. Bert de Vries visited the Mendeleev University with public lectures (often on
multiple occasions). These events encouraged many young students to think broadly about
the role of science and especially of Chemistry in the turbulent modern society.
CHED 38
Green Fuels Depot: Demonstrating sustainable energy conversion on a local level
Richard H Jarman, [email protected] of Health and Sciences, College of
DuPage, Glen Ellyn, Illinois 60137, United States
The Green Fuels Depot (GFD) is a collaborative project involving the College of DuPage,
the City of Naperville, Argonne National Laboratory and Packer Engineering designed to
establish a sustainable energy source based on the gasification of community-generated
yard waste. Residential brush and leaf materials will be converted into a flexible system of
energy sources, including electricity, hydrogen and ethanol to power municipal
transportation. The GFD offers the prospect of a stand-alone sustainable energy source for
urban and agricultural communities as well as remote locations that lack grid electricity.
The role of the College of DuPage in this project is threefold: to develop training and
educational materials for future GFD operators; mentor and train students in the operation
of the equipment; perform basic research on the gasification process. A broader objective
of this project is to incorporate material into chemistry curriculum to increase awareness of
sustainability throughout the student population.
CHED 39
Climate change: What is it? how will it affect us? can we reduce the impact by our
actions?
Andy Jorgensen, [email protected] of Chemistry, University of
Toledo, Toledo, OH 43606, United States
Even though climate change has been well characterized over recent years, the physical
facts and possible consequences of this phenomenon are not well-known by the public in
the United States. The opinions of many in our country have been influenced by climate
skeptics who, for various reasons, present an unscientific view of climate change. As a
result, there is a desire and interest in further education using peer-reviewed information. A
sabbatical leave at the National Council for Science and the Environment during 2008-9
permitted the development of a presentation that has been given more than 50 times in the
subsequent three years. The talk utilizes personal response devices to probe the
knowledge and opinions of audience members, which allows greater participation by
attendees and increases the impact of the message.
CHED 40
Award Address (James Bryant Conant Award in High School Chemistry Teaching
sponsored by American Chemical Society). Learning the language of chemistry
Stephen Radice, [email protected] Teacher, James Bryant Conant
Award/Edward R. Murrow High School, Brooklyn, NY 11230, United States
The 2013 James Bryant Conant Award for High School Chemistry Teacher of the year
belongs to Stephen Radice.
Presently teaching at Edward R. Murrow High School in Brooklyn, NY, his teaching load
has included Chemistry Laboratory for the Hearing Impaired, Advanced Placement
Chemistry, Regents Chemistry, Topics in Chemistry, Active Physics, Various Special
Education Laboratories including Earth Science and Living Environment. Interestingly,
when Stephen is teaching alkanes, he asks students to count from 1-10 in different
languages. His point is that students must learn the Language of Chemistry. To challenge
and inspire his students, Stephen takes his students to hear lectures by Nobel Laureates;
students go to Polytechnic University to do laboratory experiments; or a trip to the Museum
of Natural History and the Rose Center for Earth and Space. One of Stephen Radice's
former students writes: “He truly personifies both the science of chemistry and the talent of
a teacher.”
CHED 41
Teaching chemistry through ice cream
Elizabeth K Mitchell, [email protected] of Research
and Quality, Perry's Ice Cream, Akron, New York 14001, United States
Do you know how much science goes into making ice cream? From freezing point
depression to crystallization, there are many ways chemistry impacts making quality frozen
dessert products. Learn ways important chemistry concepts can be taught using food
science as a basis, because students already understand ice cream!
CHED 42
Electron Cloud Lab: Can the electron really be everywhere at once?
David J. Duncan, [email protected] OF CHEMISTRY, GANADO
UNIFIED SCHOOL DISTRICT, Ganado, AZ 86505, United States
It is difficult for beginning Chemistry students to understand the concept of an electron
"cloud", especially when introduced to how small an electron is relative to the size of the
atom. Navajo High school students use the scientific method to formulate a hypothesis and
test the hypothesis relative to an electron cloud around an atom. By the end of the lesson,
the students apply dimensional analysis to set up and solve problems. They use significant
figures, scientific notation, conversion factors and a relative size analogy for an atom. They
analyze the answers to the calculations to help understand the concepts of radial
measurements and that an electron travels in all three dimensions of the electron cloud.
The outcome of this exercise was a written lab report.
CHED 43
Green chemistry tools for the high school classroom
Amy Cannon, [email protected], Kate Anderson,
[email protected] Benign, Wilmington, MA 01887, United States
Hear about how teachers from across the country are integrating green chemistry into their
classroom with lessons and labs that inspire students to connect chemistry concepts to
their world. Learn how both food and energy topics can connect to so many chemistry and
sustainability concepts.
CHED 44
Inquiry-based lab: Vitamin C clock reaction rate
Anthony McElligott, [email protected] Academy, New
Orleans, LA 70127, United States
Have students discover the basic rules for reaction rates and find evidence to support
collision theory on their own. In this lab each group of students can design their own
experiment to investigate a different independent variable. The reaction has a clear start
and end point and also adds to student investment with the fun color changes that occur.
CHED 45
Food for thought: Safer endothermic and exothermic reactions
Clare Davis Wheeler, [email protected] Franklin High School, New Orleans, LA
70127, United States
Bring your imagination to the lab bench as you explore new ways for students to learn the
same concepts you are already teaching. Explore a green chemistry experiment that
demonstrates endothermic and exothermic reactions using an enzyme common to many
living organisms and popular candy products.
CHED 46
Polymer food chemistry: Have fun with polymer chemistry by making Mountain
DewVair
Sherri Rukes, [email protected], Liberyville High School, Libertyville, IL
60048, United States
Ever wonder how some chefs make those exciting little beads for their meals, drinks and
creative desserts? It is all about chemsitry. Learn how polymer chemistry and those
creative foods are related by learning concepts of various types of crosslinking and other
polymer chemistry properties. The session will focus on the making of Mountain DewVair
and see how a fun activity such as Gaviscon Snakes, Mountain Dewvair and others
connect food science to the basic chemistry classroom. Other topics of polymer food
chemistry will also be talked about as extensions. This will get the studetns excited and see
how cooking and baking are realated to the chemistry that they learn in the classroom.
CHED 47
Green chemistry alternative energy example: Blackberry solar cell lab
Kate Anderson, [email protected] Benign, Wilmington, MA
01887, United StatesBeyond Benign, Wilmington, MA 01887, United States
Learn how to construct a dye-sensitized solar cell using materials such as blackberries.
During the process students learn about how the materials, product and process meet the
cost, safety and performance criteria of green chemistry technology. After construction is
complete, performance is tested by measuring the voltage output of the solar cells. Wrap
up of the lesson concludes with a discussion about how the technology differs from
traditional photovoltaic solar cells and is continuing to emerge.
CHED 48
Impact of teaching metacognitive learning strategies on performance in general
chemistry courses
Elzbieta Cook1, [email protected], Eugene Kennedy2, Saundra Y McGuire1. (1) Chemistry,
Louisiana State University, Baton Rouge, Louisiana 70803, United States (2) School of
Education, Louisiana State University, Baton Rouge, Louisiana 70803, United States
This presentation discusses details of and outcomes from a 50-minute lecture focused on
learning and studying strategies presented to the general chemistry I class after exam 1.
For two consecutive years, average final course grades for the attendees of such a lecture
were a full letter grade higher than those for the non-attendees. The results of the pre-
intervention exam 1 were not significantly different for these two sub-groups, suggesting an
absence of significant differences in students' skill levels and motivation prior to exam 1.
Detailed course performance and demographic data were collected and analyzed using
analysis of covariance (ANCOVA) for the purpose of determining whether participation in
the learning strategies lecture had a significant impact on student performance. Other
variables considered were: math-ACT scores, high school GPA, hours carried, enrollment
year, transfer status, campus housing, gender, ethnicity, and age. Implications for learning
strategies instruction in general chemistry are offered.
CHED 49
Implementing a problem-based learning unit on pesticide sensors in general
chemistry: Initial outcomes for students and teaching assistants
Megan L Grunert1,2, [email protected], Kelley M Current1,2, Lloyd M
Mataka2. (1) Department of Chemistry, Western Michigan University, Kalamazoo, MI
49008, United States (2) Mallinson Institute for Science Education, Western Michigan
University, Kalamazoo, MI 49008, United States
At Western Michigan University, researchers have synthesized molecules capable of
detecting the presence of three common pesticides. Through a collaborative effort between
research groups, these molecules are being used in first-semester general chemistry
laboratory as the foundation for a problem-based learning unit. Students learn about the
process of scientific research by designing and carrying out their own experiments using
these molecules. Throughout this process, we have been evaluating affective student
outcomes through pre/post-surveys, open-response questionnaires, and interviews. We
have also been interested in the outcomes for teaching assistants, as they are asked to
take on the role of “research advisor” for this unit. Extensive data collection has occurred
with the teaching assistants, including classroom observations, classroom audio
recordings, recorded weekly meetings, and interviews, allowing us to map changes in
teaching practice and the development of an educator identity. Results from the first three
implementations will be presented.
CHED 50
Using a grounded approach to develop facet clusters for solutions chemistry
Lianne Schroeder1, [email protected], Donald J. Wink2, Stephanie A.C. Ryan1, Matthew
Lira1, Susan R. Goldman1, James W. Pellegrino1. (1) Learning Sciences Research
Institute, University of Illinois at Chicago, Chicago, IL 60607, United States (2) Department
of Chemistry, University of Illinois at Chicago, Chicago, IL 60608, United States
Based on a comprehensive review of the K-16 literature, we developed and implemented
an interview protocol to explore college chemistry students' understanding of solution
phenomena. We were specifically targeting the phenomena of identity (what is in solution),
concentration (how much is present, relative to the total amount), and reaction (what
happens when new substances are formed). Students were presented with chemical
phenomena that elicit qualitative understandings and are asked to describe what they see.
Data from these interviews were used to develop three sets of Minstrell-style facet clusters
related to solutions phenomena: identity, concentration, and reaction. This approach to
facet clusters is unique in that the development is driven by and grounded in student data
rather than an expert thought experiment. We will present our method for developing the
facets from interview data and an example of the use of the facet clusters to describe a
student's understanding.
CHED 51
Transforming the “Survey of Chemistry” class for nursing students using the
Learning Assistant (LA) model: Challenges and rewards
Konstantinos Kavallieratos, [email protected], Joseph Lichter, Christina A Burns, Lydia
Fernandez, Michelle Luzi, Justin M Torner.Department of Chemistry and Biochemistry,
Florida International University, Miami, FL 33199-0001, United States
The learning assistant (LA) model of instruction has been rapidly expanding due to
significant improvement in measured learning objectives. As part of the HHMI-sponsored
effort to reform traditional lecture classes at FIU (Grant No: 52006924), we initiated a
transformation of the “Survey of Chemistry” class based on LA-directed activities with the
following components: 1) Problem solving, aiming at maximizing group interactions and
encouraging independent thought 2) Model building and interpreting, linking written
structures of molecules to ball-and-stick molecular models 3) Real-life health application
problems tailored to nursing students and 4) Problems that seamlessly link the lecture with
the lab. Particularly significant features of this transformation are the active involvement of
LAs in the problem design and maximized direct LA-student interactions. We will present
results on student impacts based on i) direct comparison of exam performance before and
after transformation for comparable student groups, and ii) comparison of student
outcomes, separated by degree of participation in the LA-directed activities.
CHED 52
Practice-based instructional systems design model for undergraduate chemistry
laboratory experiment design
Tara Bunag, [email protected] of Natural Sciences, Online, University of
Phoenix, Tempe, AZ 85040, United States
This presentation will report an iterative model of undergraduate chemistry laboratory
experiment design based on the current practice of undergraduate chemistry laboratory
design experts (1). The model was constructed using the Delphi method to gather expert
responses, then verified through interviews with additional experts. Experts consistently
described the model as accurate and useful.
1. Bunag, T. Construction of an Instructional Design Model for Undergraduate
Chemistry Laboratory Design: A Delphi Approach. Ph.D. Dissertation [Online],
Arizona State University, Tempe, AZ, 2012.
CHED 53
Structural database for instructors: A living, online NMR FID database
Kyle A Kalstabakken, Andrew M Harned, [email protected] of Chemistry,
University of Minnesota, Minneapolis, MN 55455, United States
Structure elucidation is a fundamental skill for the practicing synthetic chemist. As students
become more comfortable with this task, they will become more self sufficient and better
able to question the identity of what is in their flask. Because of the importance of this skill,
many universities and colleges have established courses on this topic. We have developed
a web-based resource to assist instructors of these "organic spectroscopy" courses. This
website is populated by NMR FID files that can be freely downloaded by registered users.
Current offerings include FID files for 1H and 13C NMR, DEPT, 1H–1H COSY, HMQC,
HMBC, TOCSY, and 1D NOE experiments. External users can also submit their own data
for use by other instructors. By supplying users with the FID files, it will be easier for them
to emphasize certain areas of the spectrum for use during in-class discussions, problem
sets, and exams.
CHED 54
Microwave-assisted in-situ cracking of dicyclopentadiene and subsequent reaction
with maleic anhydride and the analysis of the Diels-Alder cycloaddition product via
2D-NMR and molecular modeling: A laboratory exercise for an advanced lab course
or inter-course collaboration
John G. D'Angelo, [email protected], Geoffrey M. Bowers.Division of Chemistry, Alfred
Unviersity, Alfred, NY 14802, United States
Herein, we describe the in-situ cracking of dicyclopentadiene with the subsequent reaction
of the resulting monomer with maleic anhydride in a Diels-Alder cycloaddition. The DielsAlder cycloaddition product was then hydrolyzed to the diacid product, consistent with the
traditional lab exercise in the undergraduate organic chemistry sequence. The rigid
structure of both the anhydride and hydrolyzed diacid make these products ideal
candidates for analysis by 2D-NMR and molecular modeling. Such an analysis would be
inappropriate for a large class but is ideal in a smaller, advanced lab setting or as a special
collaboration project between a small portion of a larger undergraduate organic chemsitry
lab and a physical chemistry lab. The findings and complications encountered during our
2D-NMR and molecular modeling analyses will be presented.
CHED 55
WITHDRAWN
CHED 56
Utilizing undergraduate research results in organic spectroscopy
J. Thomas Ippoliti, [email protected], Samuel J. Fish, Luke A. Kassekert, Rebecca
L. Kummer, Sarah N. Larson, Andrew K. Peterson, Nicholas A. Serratore, Olga Y.
Zamulko.Department of Chemistry, University of St. Thomas, St. Paul, MN 55105, United
States
A variety of compounds that were synthesized as part of undergraduate research projects
have been used as examples to illustrate numerous concepts in an Organic Spectroscopy
course. The compounds discussed will illustrate: Karplus curve concepts in cyclohexane
rings, fluorine splitting, inverted triplets, anisotropy effects of sterically crowded aromatic
rings, how electron donation into aromatic rings can influence proton chemical shifts, the
effect of hindered rotation on chemical shift, how intramolecular hydrogen bonding can
affect conformational preferences, and vicinal C-H coupling to N-H. An exceptionally
interesting molecule showing long range coupling to an O-H as well as demonstrating
many other concepts will serve as a multi-faceted example of how these compounds can
be used as excellent teaching tools.
CHED 57
Thematic use of ribavirin as an example to illustrate NMR principles and techniques
Brant L. Kedrowski, [email protected], William F. Wacholtz.Department of
Chemistry, University of Wisconsin Oshkosh, Oshkosh, WI 54901, United States
Ribavirin is a molecule used clinically to treat viral infections. It has a number of structural
features that make it an ideal example for illustrating a variety of NMR principles and
instrumental techniques. Ribavirin was used in a thematic fashion as a recurring example
throughout a semester-long interpretative spectroscopy course to introduce concepts that
started with the simple and progressed toward the complex. Examples included: 1)
molecular asymmetry and number of signals, 2) diastereotopic methylene proton signals,
3) observing spin-spin splitting between hydroxyl protons and neighboring protons, 4)
proton-deuterium exchange experiments with hydroxyl group protons, 5) 1D selective
decoupling experiments to assign proton signals, 6) 1D-NOE experiments, 7) temperaturedependent NMR experiments to study amide bond rotation, 8) homonuclear 2-D correlation
experiments including COSY and NOESY, 9) heteronuclear 2-D correlation experiments
including HETCOR, HMQC, or HSQC for short range C-H correlations, and FLOCK or
HMBC for long range C-H correlations.
CHED 58
Quantitative NMR spectroscopy in practical applications for student labs and
student research
Donald A Bouchard, [email protected] Instruments, Inc.,
Indianapolis, IN 46203, United States
Nuclear magnetic resonance (NMR) is an important diagnostic and research tool in virtually
every area of science today. The selectivity of magnetic resonance means NMR is a
tremendous tool for qualitative analysis in the determination of molecular structure. A
second important property is that NMR is a bulk phenomenon and can measure many
samples as is without sample preparation. Finally, the NMR response is uniform per atom,
without regard to its structural state and that external calibrations can be very simple, which
is particularly useful for a teaching laboratory or student research project. Ignoring the
fundamental qualitative aspects of NMR leads students to a myopic view of the power of
this technique. The results of projects in real world areas of nutrient content in food,
chemical components in crude and finished petroleum and chemical equilibria to be
presented can give students an enhanced view of this spectroscopic technique.
CHED 59
NMR spectroscopy at the University of St. Thomas(TX): From general chemistry to
undergraduate research
Thomas B Malloy Jr1, [email protected], Michelle A Steiger1, Lawrence B
Alemany2. (1) Department of Chemistry, University of St. Thomas, Houston, TX 77006,
United States (2) Department of Chemistry and Shared Equipment Authority, Rice
University, Houston, TX 77005, United States
An Anasazi Eft-60 60 MHz multinuclear FTNMR has allowed NMR experiments to be
incorporated throughout the undergraduate curriculum at the University of St. Thomas. In
addition to the use of NMR in the sophomore organic laboratory course, experiments have
been incorporated in inorganic, physical chemistry, biochemistry and instrumental analysis
courses. In addition, an effort has been made to involve selected freshmen in NMR
projects during their second semester. Undergraduate research has led to the development
and refinement of many of the experiments. Access to high field superconducting magnet
instruments at the Shared Equipment Authority at Rice University at very reasonable rates
has greatly enhanced opportunities for undergraduate research in NMR at the University of
St. Thomas.
This presentation will discuss the NMR for freshmen projects, the development of an
experiment illustrating the difference in time scales between NMR and Raman
spectroscopy, a 2D experiment on peptides, and how 60 MHz results led to ongoing high
field studies of unique complex effects in organofluorine compounds.
CHED 60
Writing more competitive grant proposals for NMR spectrometers
Thomas J Wenzel, [email protected], Bates College, Lewiston, Maine
04240, United States
It is possible to secure funding for NMR spectrometers through either research grants or
curriculum development grants. In particular, the National Science Foundation has two
important grant programs that provide support for NMR spectrometers. The Major
Research Instrumentation Program operates under the research directorates and is
focused on enabling research activities. The Transforming Undergraduate Education in
Science, Technology, Engineering and Mathematics Program operates under the Division
of Undergraduate Education and is focused on promoting curricular development that
enhances undergraduate student learning. Advice for writing successful grant proposals to
both of these programs is provided.
CHED 61
Chemistry and chemists within the Division of Undergraduate Education at the NSF
Joseph J. Grabowski, [email protected], David R. Brown, Herbert Richtol.Division of
Undergraduate Education, National Science Foundation, United States
The Division of Undergraduate Education (DUE) at the National Science Foundation (NSF)
offers a number of programs that, in the aggregate, are a comprehensive approach to
strengthening STEM education at two- and four-year colleges and universities. DUE
programs support improving curricula, instruction, laboratories, infrastructure, assessment,
diversity of both students and faculty, and increasingly, collaborations. Chemistry, often
considered as the 'central science' in STEM, is a major contributor to advancing DUE's four
goals of providing leadership, supporting curriculum development, preparing the workforce,
and fostering connections. While DUE can provide the funding, it is the broad Chemistry
community that allows the goals to be achieved. In addition to highlighting DUE's interests
beyond the solicitations, the role that chemists play in the support of DUE and NSF will be
featured.
CHED 62
Using threshold concepts to drive curriculum reform in biochemistry
Vicky Minderhout1, [email protected], Jennifer Loertscher1, Jennifer Lewis2, David
Green3. (1) Department of Chemistry, Seattle University, Seattle, WA 98122, United
States (2) Department of Chemistry, University of South Florida, Tampa, FL 33620, United
States (3) Center for Excellence in Teaching and Learning, Seattle University, Seattle, WA
98122, United States
Threshold concepts are concepts that when mastered, represent a transformed
understanding of a discipline, without which the learner cannot progress. For example,
equilibrium has been identified as a threshold concept in biology and is likely to be relevant
for biochemistry. Preliminary data suggest that students bring incomplete knowledge of
equilibrium into biochemistry courses and that biochemistry courses do not alter their
understanding significantly. By focusing on threshold concepts, instructors can maximize
the impact of instruction. We are beginning work with a community of biochemists,
biologists and chemists, to 1) identify threshold concepts for biochemistry, 2) design
classroom activities targeting these concepts, 3) disseminate classroom activities and
assessment tools, 4) measure changes in student understanding. Our prior work linking
assessment of student understanding of protein structure to curricular reform provides a
model of a process that uses assessment and community input in a feedback loop to
improve student learning.
CHED 63
Development of e-learning modules for analytical chemistry
Thomas J Wenzel, [email protected], Bates College, Lewiston, Maine
04240, United States
Faculty members from over 20 institutions are collaborating on an NSF-funded project to
develop active learning materials for use in the undergraduate analytical chemistry
curriculum. Materials are being designed for use in a variety of formats (e.g., classroom
activity, homework assignment, laboratory project) and in a form that can be modified to
suit the particular needs of an instructor or institution. Each module consists of a series of
inquiry-based activities or problem-based exercises. Learning objectives, appropriate
textual material and an instructor's manual that support the activity or exercise are provided
as well. Materials developed in this project will be disseminated through the NSF-funded
Analytical Sciences Digital Library (ASDL), http://www.asdlib.org. When finished, the
classroom activities and laboratory experiences will span the range of topics normally
incorporated into the undergraduate analytical chemistry curriculum. Work completed to
date, ongoing activities, and future plans for topic development will be described.
CHED 64
IONiC: Transforming education through collaborative development of materials at
the frontiers of inorganic chemistry
Sheila R. Smith1, [email protected], Sibrina Collins2, [email protected],
Joanne L. Stewart3, [email protected]. (1) Department of Natural Sciences, University
of Michigan- Dearborn, Dearborn, MI 48128, United States (2) Department of Chemistry,
College of Wooster, Wooster, OH 44691, United States (3) Department of Chemistry,
Hope College, Holland, MI 49422, United States
The Interactive Online Network of Inorganic Chemists (IONiC) was formed to share content
and best practices for teaching and learning in inorganic chemistry. Over the past five
years, we have built a website and social networking hub, VIPEr (www.ionicviper.org), a
home to more than 500 registered faculty users who share teaching resources, advice, and
evidence of student learning. An important lesson that we have learned is that in order to
get highly engaged participation on the VIPEr site, we need face-to-face contact to invest
people in the community. Over the past three years, we have hosted workshops for faculty
on content creation and effective use of VIPEr. In this project, we build on our tested
workshop strategy and enhance it with a theme we call “Back to Grad School” (B2GS).
Specifically, we will host four summer B2GS workshops that will: 1) Introduce faculty to
cutting-edge topics in several subfields of inorganic chemistry; 2) develop at least 80 high
quality teaching resources in conjunction with research experts; and 3) disseminate these
materials to the global inorganic teaching community through VIPEr.
CHED 65
Embedding undergraduate research throughout our campuses and curricula
Mitchell Malachowski1, [email protected], Kerry Karukstis2,
[email protected], Jeffrey Osborn3, Elizabeth Ambos4. (1) Department of
Chemistry, University of San Diego, San Diego, CA 92110, United States (2) Department
of Chemistry, Harvey Mudd College, Claremont, CA 91711, United States (3) Department
of Biology, The College of New Jersey, Ewing, NJ 08628, United States (4) Council on
Undergraduate Research, Washington, DC 20005, United States
This presentation will describe our NSF funded project that focuses on working with state
systems and consortia interested in embedding higher levels of undergraduate research
across their campuses. We have offered three-day workshops to seven systems/consortia
including 90 institutions and over 350 participants. Teams from each institution spend the
weekend generating a series of goals for undergraduate research that they bring back to
their campuses for vetting. Institutional goals frequently include issues related to faculty
workload, resource allocation, facilities, curriculum, student engagement, mentoring,
promotion and tenure expectations, summer activities, and grants writing, among others. In
this presentation we will discuss the focus of the workshops, the engagement of the faculty
and administrators during the weekend, the follow-up activities and the institutional and
system/consortia changes that have resulted from the workshops. Issues common to many
institutions will be discussed and suggestions made on how to adapt our findings to other
institutions.
CHED 66
PhET Interactive Simulations: Using research-based simulations to transform
undergraduate chemistry education
Emily B. Moore1, [email protected], Julia M. Chamberlain1, Robert Parson2,
Katherine K. Perkins1. (1) Department of Physics, University of Colorado Boulder, Boulder,
CO 80305, United States (2) Department of Chemistry and Biochemistry, University of
Colorado Boulder, Boulder, CO 80305, United States
The PhET Interactive Simulations project (http://phet.colorado.edu) includes a growing list
of over 30 chemistry simulations (sims). Each sim is research-based and student-tested,
resulting in sims that support student learning through inquiry – including scientist-like
exploration and experimentation. Recent PhET research includes investigations on: sim
design – how complexity affects student learning, and the unique needs of chemistry sims;
and sim use – how activity design affects student sim use, and how students use and
perceive sims in large classes. With new NSF funding, the PhET project will continue to
develop sims and study design and use. We will also work with a newly-established
chemistry Faculty Working Group towards the development of student and classroomtested supporting materials (classroom, lab, and homework activities, and clicker
questions) and professional development materials.
CHED 67
Chemistry Collaborations, Workshops and Communities of Scholars (cCWCS):
Activities and impacts
David M Collard, [email protected] of Chemistry &
Biochemistry, Georgia Institute of Technology, Atlanta, Georgia 30332-0400, United States
Over the last decade, the Chemistry Collaborations, Workshops and Communities of
Scholars program (cCWCS, www.ccwcs.org) and its predecessor (the Center for
Workshops in the Chemical Sciences) have provided over 120 workshops for faculty. The
programs have a long history of equipping faculty to modify courses and curricula through
their participation in week-long, hands-on workshops on topics such as chemistry in art,
food chemistry, computational chemistry, forensic science, energy, nanotechnology, and
NMR. Web-based communities, conference symposia and small grant programs provide
continuing support and engagement of the participants. The presentation will focus on the
evaluation of the program's impact.
CHED 68
In situ generated palladium nanoparticle assemblies and its electro-catalytic
properties towards oxidation of polyalcohols
Caitlyn McCain, [email protected], Krisanu Bandyopadhyay.Department of
Natural Sciences, University of Michigan-Dearborn, Dearborn, MI 48128, United States
There is a considerable interest for investigating a general synthesis route to generate
aggregation-resistant metal nanoparticles for catalytic applications. The present research
deals with the formation of two-dimensional arrays of palladium nanoparticles on
functionalized surfaces. Silicon and indium tin oxide (ITO) coated glass are used as
preferred substrates and are functionalized with silane molecule like
trimethoxysilylpropylpolyethyleneimine. Due to electrostatic interactions between specific
functional groups present on the modified surface and metal ions present in solution,
adsorption of ions take place on the surface, followed by a reduction step to ensure in situ
generation of surface bound nanoparticles. Surface zeta potential measurement is used to
follow the change in surface-charge during different steps of the synthetic process Atomic
Force Microscopy (AFM) provides the structural characterization of the nanoparticles.
Finally, the electro-catalytic activity of these nanoparticles assemblies are assessed for
oxidation of polyalcohols like ethylene glycol and glycerol.
CHED 69
Effect of monolayer template on generation of 2D assemblies of gold nanoparticle
Harkamal Jhajj, [email protected], Krisanu Bandyopadhyay.Department of Natural
Sciences, University of Michigan-Dearborn, Dearborn, MI 48128, United States
Gold nanoparticles have attracted much interest recently due to their unusual catalytic
properties. Our research uses organized assemblies on solid surfaces to generate gold
nanoparticles engineered for electro-catalytic application towards methanol electrooxidation, which is a key reaction for direct methanol fuel cells. In this present research,
two dimensional assemblies of gold nanoparticles are generated in situ on silicon and
indium tin oxide (ITO) coated glass surfaces functionalized with aminosaline monolayer
with different chain length and different number of nitrogen atoms present at the molecular
backbone. We have studied the effect of different aminosilane monolayer template on size
of generated gold nanoparticle and subsequent assessment as catalyst towards methanol
electro-oxidation. Atomic Force Microscopy (AFM), contact angle and surface zeta
potential measurements are used to monitor the structural development of these
nanoparticles. Further studies are conducted using Impedance spectroscopy to better
comprehend the size dependent electrochemical properties of surface generated gold
nanoparticles.
CHED 70
Metal oxide nanowire/carbon composites for hybrid supercapacitors
Ruperto G Mariano, [email protected], Sanjaya D Perera, Mark Rudolph,
Kenneth J Balkus.Department of Chemistry and the Alan G. MacDiarmid NanoTech
Institute, The University of Texas at Dallas, Richardson, TX 75080, United States
Much attention has focused on metal oxide nanostructures for use as electrodes in energy
storage devices due to their high surface areas and high Li+ion diffusion rates. Nanowire
structures are attractive as they can form binder-free electrodes, increasing capacitive
performance by eliminating binder materials in electrodes.
Additionally, carbon materials can be used as electrodes in electric double layer capacitors
(EDLCs): the use of reduced graphene oxide (rGO) as an electrode material is intriguing
due to its high electron mobility and affordability compared to carbon nanotubes (CNTs).
The performance of EDLCs can be further enhanced through combination with metal
oxides that exhibit redox activity.
In this work, we present a hybrid supercapacitor using MnO2 nanowire/V2O5
nanowire/rGO/CNT electrodes. Characterization performed using SEM/TEM to confirm
nanowire morphology, XRD to confirm crystal phases, and Cyclic Voltammetry to
determine capacitance and power/energy densities will be presented.
CHED 71
Molecular structure and energy comparisons of graphene-oxide
Erich J Beregszaszy, [email protected], Daniel B Lawson.Natural Sciences,
University of Michigan-Deaborn, D, MI 48128, United States
Graphene oxide (GO) consists of 2 dimensional sheets constructed from planar and
hexagonal CC bonds with oxygen atoms populating the surface. GO is water soluble and is
often used to as the starter material for the purposes of depositing graphene onto a variety
of surfaces. With ever growing demands in the market-place for green catalysts, the unique
electrical and chemical properties of graphite, graphene and graphene oxide offer chemical
and electrical properties that suggest a variety of applications in catalytic processes.
Unfortunately, the exact chemical structure of GO has yet to be elucidated. This work uses
computational chemistry to estimates energetically favorable structures from various
models proposed in the literature. The level of oxidation of GO is estimated by the enthalpy
of absorption of O atoms to the surface of graphene. We also look into favorability of
various other functional groups in GO including –OH, -CO, and –COOH. We compare
available experimental data from the literature with our computationally generated results
to properly assess the topography of GO.
CHED 72
Interesting luminescent properties of a Suzuki coupled fulgide switch
Kenneth Yamaguchi, Akim Abdullahi, [email protected], Usman Shahid.Department
of Chemistry, New Jersey City University, Jersey City, New Jersey 07302, United States
The fulgides represent an important class of compounds that have been shown to undergo
light-induced ring-opening and -closing states with high photochemical stabilities. We have
been interested in the incorporation of this class of photochromic compounds into n- and ptype materials with interesting photochemical properties. This paper will discuss the
bromination of 3-methylindole followed by a Stobbe condensation reaction yielded 2-acetyl3-methyl-6-bromoindole (1). The fulgide switch was synthesized via coupling between the
intermediate 1 and diethyl isopropylidene succinate. Finally the fulgide moiety was coupled
to 2-bromo-7,7-dioctylfluorene. The synthesis and characterization of the product will be
discussed as well as its luminescent properties.
CHED 73
Versatile SERS substrates using period arrays of silver conical nano-frustums
Ryan K Petit, [email protected], Jason M Montgomery.Department of Chemistry,
Florida Southern College, Lakeland, Florida 33801, United States
Systems involving arrays of periodic metallic nanostructures have been the focus of much
interest due to their ability to reliably enhance the intensity of an incident electric field
through surface plasmon excitations. These excitations occur at resonant frequencies that
are determined by a nanostructure's geometry (size, shape, and environment) and can be
therefore tuned to a desired frequency. Accordingly, periodic arrays of metallic
nanoparticles can be used for surface enhanced Raman spectroscopy (SERS)
applications, in which both the incident light and the Raman scattered light are enhanced.
Typically, one aims to tune a surface plasmon resonance midway between the excitation
wavelength and the emission wavelength of the analyte in order to adequately enhance
both wavelengths, giving rise to the well known g4 enhancement factor. In this paper, we
describe a novel structure, composed of a periodic array of layered metallic nano-frustums
(NFs) atop a this silver film, intended to support multiple resonance frequencies that
correspond to the excitation wavelength (λex), the emission wavelength (λem), and midway
between the two (λmid). Two and three dimensional finite-difference time-domain (FDTD)
calculations were utilized to analyze possible structures and geometrical parameters and to
ultimately optimize a NF structure capable of exciting at both λex = 785nm, λmid = 850nm ,
and λem = 850nm was designed. The structure exhibited maximum SERS enhancements
on the order of 100x higher than previously studied nano-post arrays.
CHED 74
Determination of the structures of imprinted polymers and xerogels: A random
docking approach
Amanda Wach, [email protected], Jiechen Chen, [email protected], Eva
Zurek.Department of Chemistry, Stat University fo New York at Buffalo, Buffalo, NY 14261,
United States
A method for the computational determination of the binding motifs in molecularly
imprintedpolymers and xerogels is proposed. A RandomDock extension to the open source
molecular editorAvogadro is employed in order to generate multiple random geometries of
the templatesand monomers which are subsequently optimized using dispersion corrected
density functional theory.Analysis of the most stable structures obtained shows that they
maximize the number ofintramolecular hydrogen bonds in the tetracycline molecule. In
addition, hydrogen bonding interactions between thesilane and the TC and ETC molecules
are observed. The bonding between the silanes and ATC/EATC, on the other hand, is
unspecific and primarily due to dispersion. Systems with tetraethoxysilane as the monomer
show the lowest, most favorable binding energy compared to other silanes.
CHED 75
WITHDRAWN
CHED 76
Preparing students for greener workplaces through microwave chemistry
Michael J. Karney, [email protected], Grace S. Vanier.Life Sciences Division,
CEM Corporation, Matthews, NC 28106, United States
As the industrial and academic chemistry labs of tomorrow evolve, so must the curricula of
universities. With the principles of green chemistry presenting both financial and chemical
advantages, there has been a focus on improving the efficiency of new and existing
industrial reaction pathways according to these principles. With the spread of this new way
of thinking about chemistry, microwave reactors have also spread into every discipline of
chemistry. Microwave reactors have long been tied to green chemistry because of their
efficiency and ability to perform novel reactions. Educating students in the technique and
practice of microwave green chemistry prepares them for successful careers, equipping
them with advantages both on their resumes and in the laboratory. This presentation will
introduce pedagogy and laboratory experiments designed to encourage growth in the
realm of teaching microwave green chemistry.
CHED 77
Results and evaluation of a green approach to Knoevenagel–Doebner condensation
reaction in a second-year organic chemistry laboratory class
Koushik Banerjee, Ruchi Patel, [email protected], Peng Hao.Department of
Chemistry, Physics and Astronomy, Georgia College and State University, Milledgeville,
GA 31061, United States
As part of our efforts to minimize the use of toxic chemicals in organic chemistry
instructional laboratories, a newly developed Knoevenagel–Doebner reaction in a multistep
sequence to 2'-bromostyrene was developed and applied over a period of four semesters.
The conventional base used during this reaction used to be pyridine, which is a highly toxic
compound. We have been able to replace pyridine with a nucleophilic catalyst, DMAP, as
well as discover and apply a microwave-mediated route. Herein, we will present the results
and evaluations of this green reaction in second-year organic chemistry laboratory carried
out during the past year.
CHED 78
Sustainable polymers in the organic chemistry laboratory: Synthesis and
characterization of a fully renewable, degradable polymer from δ-decalactone and Llactide
Jane E. Wissinger1, [email protected], Debbie Schneiderman1, Marc Hillmyer1, Tomohiro
Kubo1, Michael Wentzel2, Chad Gilmer2. (1) Chemistry, University of Minnesota,
Minneapolis, MN 55455, United States (2) Chemistry, Augsburg College, Minneapolis, MN
55454, United States
The importance of green and sustainable polymers is highlighted in a new experiment
developed for incorporation into the organic chemistry laboratory curriculum. δDecalactone, a naturally occurring cyclic ester used by the food and flavor industry for its
coconut fragrance and taste, was polymerized by ring opening transesterification
polymerization (ROTEP) under acidic conditions with a diol initiator. The synthesis is
notable for its solvent free, room temperature reaction conditions as well as the ease at
which the catalyst can be removed from the polymer. 1H NMR analysis of the resulting
viscous product was used to determine the monomer conversion obtained and calculate
the molecular weight of the telechelic poly(δ-decalactone) formed. Continuation of the
experiment involved chain extension with L-lactide to yield a flocculent copolymer material.
Subsequent annealing resulted in a transparent, pliable, polymer film. The well resolved 1H
NMR peaks of the two component monomers facilitate a quantitative analysis of polymer
composition. The use of 100% renewable feedstocks and green reaction conditions to
produce an environmentally friendly polymer with interesting properties exemplifies modern
advances in sustainable polymer chemistry in the classroom.
CHED 79
Green Chemistry Commitment: Transforming chemistry education
Amy S Cannon1, [email protected], John C Warner2, Kate Anderson1. (1)
Beyond Benign, Wilmington, MA 01887, United States (2) Warner Babcock Institute for
Green Chemistry, Wilmington, MA 01887, United States
This presentation will describe the history and progress for a new program titled the Green
Chemistry Commitment. The program is a departmental commitment designed for higher
educational institutions as a voluntary, flexible framework for chemistry departments to
adopt green chemistry theory and practice. The Commitment is centered on student
learning objectives that take into account topics such as green chemistry and toxicology,
which have traditionally been absent from chemistry programs. College and university
chemistry departments sign on to the Commitment, indicating that they value the student
learning objectives and committing to working towards implementing the student learning
objectives within their own departments. The Commitment is designed so that each
institution can adopt the student learning objectives through different means, recognizing
that each department will have different resources and different capabilities.
CHED 80
Green organic chemistry at Kingsborough Community College
Homar S Barcena, [email protected], Pei Shan Chen.Physical
Sciences, Kingsborough Community College, Brooklyn, NY 11235, United States
Green experiments were adapted for the Organic Chemistry I and II curricula at a
community college setting. A new laboratory book was prepared for both courses. Students
were introduced to principles of green chemistry, green metrics, safety, and hazards
assessments. Where possible, contextual references to the environment and human health
were linked to the labs. Students were evaluated from pre-labs, post-labs, and keeping
laboratory notebook. These pedagogies show that green chemistry effectively engages
student interest and appreciation of the subject matter, and that green Organic curricula
can be effectively implemented at community colleges.
CHED 81
Teaching green chemistry in the developing world
Roseann K. Sachs1,2, [email protected], Seng Samphors1. (1) Department of
Chemistry, Royal University of Phnom Penh, Phnom Penh, Cambodia (2) Department of
Chemistry and Biochemistry, Messiah College, Mechanicsburg, PA 17055, United States
During the 2009-2010 academic year, a new laboratory course in Green Chemistry was
developed at the Royal University of Phnom Penh, in Phnom Penh, Cambodia. This
university is the oldest public institution of learning in Cambodia, but is still recovering from
the losses incurred during the Khmer Rouge and subsequent years of civil war. In this new
course, students were asked to think critically, work in groups, but sometimes
independently, analyze their data and prepare laboratory reports, all while learning ways to
do chemistry in a more sustainable way. Designed for third year university students, this
course included six experiments, one of which was research focused and challenged the
students in significant ways, being previously unexposed to laboratories of this type. A
number of group exercises were developed and used to encourage critical thinking about
the experiments, analysis of chemical risk, and green chemistry, all within the Cambodian
context.
CHED 82
Undergraduate research and the Green Chemistry Commitment: Training students to
serve society as scientists and professionals
Edward J. Brush, [email protected] of Chemical Sciences, Bridgewater
State University, Bridgewater, MA 02325, United States
One of the learning objectives of the Green Chemistry Commitment states that chemistry
majors should be able to “serve society in their professional capacity as scientists and
professionals through the articulation, evaluation and employment of methods and
chemicals that are benign for human health and the environment.” This goal can be
accomplished through incorporating green chemistry principles into undergraduate
research projects. The benefits of undergraduate research have been well documented,
but when combined with green chemistry principles an unusually strong synergy was
created. Our green chemistry research group begins their research experience as part of
our freshman summer bridge program. Group activities include study and application of the
12 Principles of Green Chemistry, research and general discussion meetings, and
semester and summer grants that are driven by student proposals. Besides training in
basic chemistry research, we have observed the evolution of a student culture centered on
green chemistry and sustainability.
CHED 83
Chemistry of Cajun cooking competition
Justin S. Miller1, [email protected], Gavin L. Sacks2, [email protected]. (1) Department
of Chemistry, Hobart and William Smith Colleges, Geneva, NY 14456, United States (2)
Department of Food Science, Cornell University - NYSAES, Geneva, NY 14456, United
States
Finalist teams from the “Communicating Chemistry: Cajun Cooking” (C4) competition will
present their take on the chemistry of Cajun cuisine. The entries will relate to the regional
cuisine of New Orleans, interpreted broadly. Entries may focus on a well-known Cajun
dish; a technique important to regional cooking; or on chemical transformation that unites
the cuisine.
CHED 84
Chemist + Chef = Recipe for culinary chemistry delight
Holly Sebahar, [email protected], Bryan Woolley.Department of Chemistry,
University of Utah, Salt Lake City, UT 84112, United States
Culinary Chemistry at the University of Utah is designed to demonstrate the beauty,
relative simplicity, and relevance of science to an aspect of everyday life that everyone
loves and appreciates. The ultimate desired outcomes of this course are to convince
students that science can be fun and thought-provoking without being analytically complex,
to stimulate students' interest in science as it relates to food and cooking, to educate
students about nutrition and the health consequences arising from what we eat, and to
encourage students to become more conscientious consumers. The course is team taught
by a professional Chef and an Organic Chemist. The majority of class periods are held at a
professional kitchen where the students perform a great deal of cooking themselves. This
team taught approach adds much complexity and flavor to the course. The students learn
traditional concepts such as acid/base chemistry, intermolecular attractions, and physical
properties. They are also exposed to the history of food, specialized cooking techniques,
and professional equipment such as steam ovens and induction cooktops. Examples of the
recipes, course assignments, and student feedback are described.
CHED 85
Chemistry in the public eye: Social media, active displays, and immediate open
access
Jeffrey J Bodwin, [email protected] of Chemistry, Minnesota State
University Moorhead, Moorhead, Minnesota 56563, United States
Chemistry is a fascinating and fun science that all too often is sequestered behind closed
doors in labs that have a mysterious, complex & intimidating aura. As educators, we often
try to make chemistry more accessible in the classroom, but often students already have a
negative view of chemistry before they ever attend their first class. The open-science
movement has developed in part to address some of these problems and has been greatly
aided by social media and other publicly accessible (both physically and intellectually)
venues. Various social media strategies and other web-based outreach/open-science
activities will be presented, as well as preliminary assessment of their effectiveness.
CHED 86
Undergraduate teaching laboratory exercise for the analysis of caffeine and
benzoate in beverages
Corina E Brown1, [email protected], Peter Karnilaw2, Richard M Hyslop3. (1)
Chemistry and Biochemistry, University of Northern Colorado, Greeley, CO 80639, United
States (2) Chemistry and Biochemistry, University of Northern Colorado, Greeley, CO
80639, United States (3) Chemistry and Biochemistry, University of Northern Colorado,
Greeley, CO 80639, United States
An HPLC method for the analysis of caffeine and benzoate in beverages was developed
for use in an undergraduate teaching laboratory. The method involves the simultaneous
preparation of caffeine and benzoate standards as well as simultaneous analysis of the two
analytes. Separation is accomplished using a C-18 column with an isocratic mobile phase
of methanol:acetate buffer using UV detection. Quantification is linear over the range of 50250 ppm for caffeine and 100-500 ppm for benzoate. Beverages containing either caffeine,
benzoate, or both are degassed if carbonated with dilution with appropriate dilution prior to
analysis. Standard preparation, sample preparation, and analysis of both can be
accomplished within a typical three-hour laboratory period.
CHED 87
What's wrong with a diet root beer float? Freezing point depression studies with
beverage sweeteners
Roderick S Black, [email protected], Andrew D Spaeth, Lianna Dang, Dustin
Moseley.Department of Chemistry, University of Kansas, Lawrence, KS 66045, United
States
The smooth texture of a multi-phase treat like the “ice cream soda” can be disrupted by ice
crystals near its solid/liquid interface. Thus, the freezing point of a beverage can be
important for successful pairing with a frozen dessert, especially for low-solute-molality diet
beverages, which freeze at higher temperatures than their conventionally sweetened
counterparts. In an undergraduate Chemistry Club activity outside of the conventional
science laboratory, students make ice cream sodas and use their scientific knowledge to
illuminate texture and flavor critiques of diet and conventionally-sweetened desserts. In a
related general chemistry exercise, students study the significance of colligative properties
in multi-phase dessert design by determining the freezing points of sucrose and artificial
sweetener solutions. Advanced experiments assess the average molar masses of mixedsweetener products. Student enthusiasm for the study of colligative properties is fostered
by examining the impact of concentration on selection of appropriate beverages for chilled
desserts.
CHED 88
Teaching chemistry at a technical college through practical field work: Milwaukee
River project
Scott A. Schlipp, [email protected], Janice L. McCann, Dinah Nelson, Chris
Emcke.Department of Natural Science, Milwaukee Area Technical College, Milwaukee, WI
53215, United States
Milwaukee Area Technical College (MATC) chemical technician students collect river water
samples from five predetermined sites along the Milwaukee River that encompass
Milwaukee County's watershed. MATC students conduct field analysis at these river sites
to collect data for phosphorus, pH, dissolved oxygen, nitrates, nitrites, flow rate,
temperature, and the use of solid phase microextraction (SPME) for the detection of
pesticides through gas chromatography mass spectrometry (GC/MS). The river samples
are also analyzed for heavy metals by inductively coupled plasma (ICP), nitrates and
nitrites by ion chromatography (IC) and visible spectroscopy for phosphorus by the
ascorbic acid method. All field and laboratory analysis is performed by the MATC chemical
technician students at MATC. This project is designed to teach two-year students the
methodology of a research project through a hands on approach. MATC students learn to
analyze the results and prepare their findings for a presentation in a poster format.
CHED 89
Characterization map of scientific text: A tool designed to improve chemistry
students' scientific writing
Salete L Queiroz1, [email protected], Jane R. S. Oliveira2. (1) Institute of Chemistry,
University of São Paulo, São Carlos, São Paulo 13561-200, Brazil (2) Department of
Chemistry, Federal University of São Paulo, São Carlos, São Paulo 13565-905, Brazil
Despite substantial evidence that writing can be an effective tool to promote student
learning and engagement, writing-to-learn practices are still not widely implemented in
chemistry disciplines in Brazil, particularly at research universities. To address these
issues, we undertook an initiative to design a tool to improve undergraduate chemistry
students' scientific writing: Characterization Map of Scientific Text. The Characterization
Map is mainly based on Bruno Latour's Science in Action (Latour, 1987). The Map has
structural and rhetorical aspects of the scientific writing, as well as textual elements related
to these aspects.
In addition we applied this tool in inorganic and organic chemistry disciplines offered to
undergraduate students in Brazilian universities. The main objective of this paper is to
investigate its functioning as a facilitator in improving scientific writing of the students and
as a scientific texts analysis tool.
Latour, B (1987). Science in action: how to follow scientists and engineers through society.
Cambridge: Harvard University Press.
CHED 90
Measuring student understanding of acid-base reactions using the Acid-Base
Concept Inventory (ABCI)
Jana Jensen, [email protected], Stacey Lowery Bretz.Department of Chemistry and
Biochemistry, Miami University, Oxford, Ohio 45056, United States
The purpose of this study is to identify misconceptions that students have about acid-base
reactions. Our research questions include: (1) How do students identify acid-base
reactions? (2) What features stand out to students as essential in acid-base reactions?
Thirty-four students were interviewed from high school, general chemistry 1 & II, organic
chemistry I & II, and a graduate level organic chemistry seminar regarding their
classification schemes for 13 reactions. A 28-item Acid-Base Concept Inventory (ABCI)
was developed using student interviews. The distracters within the inventory come directly
from student explanations of how particles interact in reactions. The ABC Inventory was
pilot tested with 1,199 students in high school, general chemistry, and organic chemistry
courses. Results from a final study with a national sample of general chemistry students
will be presented.
CHED 91
Using advanced statistical analyses in chemical education research: Applications of
structural equation modeling, cluster analysis, and multinomial logistic regression
Jeffrey R Raker1, [email protected], Kimberly J Linenberger1, [email protected],
Kristen Murphy2, Thomas A Holme1. (1) Department of Chemistry, Iowa State University,
Ames, Iowa 50011, United States (2) Department of Chemistry & Biochemistry, University
of Wisconsin - Milwaukee, Milwaukee, Wisconsin 53201, United States
Advanced statistical analyses including structural equation modeling, cluster analysis, and
multinomial logistic regression provide education researchers with additional methods for
testing hypotheses about binary, ordinal, and continuous data. This poster will present
results from three studies conducted by the ACS Examinations Institute. 1.) The use of
structural equation modeling to gage the impact of objective and subjective exam item
complexity on student performance. 2.) The use of cluster analysis to identify levels of
chemistry faculty familiarity with assessment terminology. 3.) The use of logistic regression
to understand the differences on several assessment instruments between students
enrolled in several different general chemistry courses. We will present a brief background,
the types of questions that can be answered, and how to interpret the results for each
method.
CHED 92
Developing an instrument to measure meaningful learning in the undergraduate
chemistry laboratory
Kelli R Galloway1, [email protected], Taylor Owings2, Marcy Towns2, Stacey Lowery
Bretz1. (1) Department of Chemistry and Biochemistry, Miami University, Oxford, OH
45056, United States (2) Department of Chemistry, Purdue University, West Lafayette, IN
47907, United States
While there exists a large literature discussing the importance the undergraduate teaching
laboratory, there is remarkably little data on its impact, including student perspectives
regarding their laboratory experiences. Student perspectives need to be understood in
order for teaching and learning in the undergraduate laboratory to improve. Novak's Theory
of Meaningful Learning states that the cognitive, affective, and psychomotor domains must
be integrated for meaningful learning to occur. Therefore, for students to learn meaningfully
in the laboratory, they must not only be cognizant of each domain, but also achieve
integration of three domains. In order to investigate students' meaningful learning in the
laboratory, an instrument was developed to measure student expectations and experiences
with regard to performing laboratory experiments. The items for the survey were inspired
by existing instruments including the CSCI, ASCI, ASCIV2, CHEMX, MCAI, CLAI, C-LASS,
and CASPiE lab scales due to their direct incorporation of one or more meaningful learning
domain(s). The Meaningful Learning in the Lab Inventory has been pilot tested with
general, organic, and physical chemistry students at both a large Midwestern research
university and a moderate size Midwestern liberal arts university. Results from the pilot
testing will be presented.
CHED 93
Education abroad in the sciences: Dickinson College's Norwich Science Program
R. David Crouch1, [email protected], Brian Brubaker2. (1) Department of Chemistry,
Dickinson College, Carlisle, PA 17013, United States (2) Center for Global Study and
Engagement, Dickinson College, Carlisle, PA 17013, United States
Although participation in education abroad programs by U.S. undergraduates has doubled
in the past ten years, students majoring in the sciences continue to participate in much
smaller numbers than their peers in the arts & humanities, foreign languages and social
sciences. At Dickinson College in the 1990s, science majors rarely went abroad despite a
high overall level of participation in the college's robust portfolio of programs. The College
sought to increase education abroad opportunities for science majors through the creation
of a program that specifically met the needs of these students, allowing them to progress in
large, hierarchical majors at the host university. This poster describes the current program
for science students -including those majoring in chemistry and biochemistry - that
Dickinson offers at the University of East Anglia in Norwich, United Kingdom.
CHED 94
Active reading documents (ARD's) as a tool to promote student learning through
meaningful reading of class material
Santiago A Toledo, [email protected] of Chemistry, Texas Lutheran
University, Seguin, TX 78155, United States
A common struggle for educators of chemistry is to be able to promote student interaction
with the textbook and other class material prior to coming to class. This work discusses the
use of Active Reading Documents (ARD's) as a tool to promote and build accountability
around the students' need to engage actively with the reading before class. The ARD's
goal is to help students develop basic understanding, at different cognitive levels, of the
material before they first encounter it. This allows the instructor-student time to be spent
not lecturing over the book content, but facilitating and promoting higher level learning. A
detailed rubric for grading the ARD's will be discussed and student generated examples
will be shared. In addition, a brief description will be provided of Marzano's Taxonomy
which is the theoretical framework from which the learning objectives for this student
activity are derived.
CHED 95
Integrating current scientific research topics and literature into analytical chemistry
courses at a primarily undergraduate institution
Niina J Ronkainen, [email protected] of Chemistry and Biochemistry,
Benedictine University, Lisle, IL 60532-0900, United States
Teaching chemical concepts and process skills in a context that is relevant to students'
lives is an effective pedagogical approach. It is important that undergraduate students
become exposed to the critical analysis and interpretation of scientific data before entering
graduate or professional programs. The incorporation of scientific research literature and
topics into three Analytical Chemistry courses at a Primarily Undergraduate Institution will
be described. The pedagogical approach, course content, learning objectives, and testing
using context based questions will be explained.
CHED 96
Periodic pyramid of the elements
William Tandy Grubbs, [email protected], Jennifer N Hennigan.Department of
Chemistry, Stetson University, DeLand, FL 32723, United States
The maximum number of electrons that can occupy the successive electronic shells of the
atom, given by 2, 8, 18, and 32 for the first four shells, are shown in this work to be related
to the triangular numbers from mathematical number theory. This geometric relationship
suggests an alternate method for arranging elements in terms of periodicity. The resulting
three-dimensional 'periodic pyramid' is highly symmetric in shape, and the overall structure
of the pyramid can be separated into shell and sub-shell contributions. Examining the
pyramid's structure is arguably a pedagogically useful classroom activity, as it gives
students an opportunity to further ponder periodicity and to grapple with the shell model of
the atom.
CHED 97
Comparison of student learning retention using audience response devices
Jeffrey A Jenson, [email protected], Hafed A Bascal.Department of Physical Science,
The University of Findlay, Findlay, United States
For some time now, audience response devices (clickers) have been used in a classroom
setting. In my classes, clickers have been used for the administration of in class quizzes for
a number of years. Students enjoy this form of quiz rather than the old paper quizzes
primarily because of the instant feedback they get. Clickers can also be quickly graded and
uploaded to the learning management system, making my job easier.
One aspect of learning that needs to be addressed is retention of information from the time
it is presented in class to the time of the final examination. Many students memorize
information for exams and then quickly forget the information. Methods have been
developed to discourage memorizing but have they worked?
This poster will provide data on retention of the same questions asked on the ACS final
examination. The students will not be told any details of the ACS exam to keep its integrity
intact. In this way student retention of information can be obtained.
CHED 98
Building bridges: Integrating mathematics, science, and engineering on the South
Plains
Laci Singer, [email protected], Erin Oliver, [email protected], Dominick J.
Casadonte.Department of Chemistry & Biochemistry, Texas Tech University, Lubbock, TX
79409, United States
“Building Bridges” is Texas Tech University's National Science Foundation GK-12 program,
focusing on the integration of mathematics, science, and engineering in graduate research
and in the K-12 environment. This is accomplished by creating STEM Cohorts, where
STEM Graduate Fellows pair with math or science Teacher Fellows at the same school.
The organization of the program at TTU is designed to 1) facilitate the research activities of
the Graduate Fellows, 2) develop professional experiences for both Graduate and Teacher
Fellows, 3) encourage collaborative design and implementation of an integrated curriculum,
and 4) create cyber-capable dissemination platforms for nationwide outreach through a
distance-learning classroom environment. Through their experience in the “Building
Bridges” GK-12 program, the STEM Graduate Fellows, Teacher Fellows, and K-12
students gain an enhanced understanding of the interconnectedness of STEM disciplines
in research and academia. The model developed is one that can be easily replicated to
further interdisciplinary STEM education.
CHED 99
Science of art: From creation to authentication to preservation
Kassy A Mies, [email protected], Sayyeda Zeenat A. Razvi.Department of Chemistry,
Physics, and Geoscience, Meredith College, Raleigh, North Carolina 27607, United States
The Chemistry Program at Meredith College has developed a new travel course, “ The
Science of Art: from Creation to Authentication to Preservation.” This course was taught as
a part of the College's Study Abroad Program in Sansepolcro, Italy during the summer of
2012. This five week course fulfilled the natural science elective for non-science majors for
the general education curriculum and was developed by a chemistry faculty member and a
senior chemistry major. The goal of this course was to apply basic scientific theories to
understand the creation, authentication, and preservation of art using Italy as classroom.
We used a combination of in-class lectures, hands-on activities, debates, field trips, and
student presentations to demonstrate the interwoven nature of art and chemistry. Here we
will focus on the course modules used to connect Italian art to fundamental chemical
principles: Basic Chemistry; Atoms and Light; Compounds; and Solvents, Solutions, and
Solubility.
CHED 100
Development of a photographic gallery of crystallization techniques and the errors
associated with them
J. Martin E. Quirke1, [email protected], Jonathan C. Quirke2, Mayra Exposito1, Lilia San
Miguel1. (1) Department of Chemistry and Biochemistry, Florida International University,
Miami, Florida 33199, United States (2) Department of Chemistry and Biochemistry,
Oberlin College, Oberlin, Ohio 44704, United States
Laboratory textbooks and manuals contain very few high quality photographs, if any, to
reinforce the narrative. Also, they do not show what happens when students fail to follow
their instructions on techniques. Thus, students may not understand the need to follow
instructions. This photographic presentation surveys a range of techniques including single
solvent, mixed solvent and vapor phase diffusion crystallizations, together with the errors
associated with them. Fundamental methods are demonstrated by crystallizations using Pd
(II) octaethylporphyrin, Zn(II) octaethylporphyin, acetamide and 1,2,3,4tetraphenylnapthalene. Samples were chosen to illustrate different facets of the techniques
and phenomena such as the generation of different crystal forms. Common errors including
incorrect solvent selection, misuse of decolorizing charcoal, improper hot filtration are
shown. In addition to reinforcing the need to follow experimental technique, the galleries
are useful in assisting students to diagnose the cause of any mistakes that they have
made.
CHED 101
Student goals for undergraduate laboratory
Marcy H Towns2, [email protected], Taylor Owings2, Stacey Lowery Bretz1, Kelli Rush
Galloway1. (1) Department of Chemistry and Biochemistry, Miami University, Oxford, OH
45056, United States (2) Department of Chemistry, Purdue University, West Lafayette, IN
47907, United States
Reviews of laboratory research have suggested the need for further articulation of faculty
goals for laboratory. Along side of that research lies the need to understand student goals
for laboratory and the interaction between the goals of faculty and students. We have
recently embarked upon project designed to elucidate and probe the student goals for
undergraduate chemistry laboratory. Students in general chemistry, organic chemistry, and
physical chemistry laboratory courses were surveyed at the beginning and end of the
semester about their goals and how they expected to achieve them. Results from this study
will be shared.
CHED 102
Council on Undergraduate Research: A faculty development organization
Robert E. Bachman, [email protected] of Chemistry, Council on
Undergraduate Research, Washington, DC 20005, United StatesDepartment of Chemistry,
The University of the South, Sewanee, TN 37383, United States
Collaborative student-faculty research, scholarship and creative activities, commonly
referred to as undergraduate research, has been increasingly recognized as a high impact
educational practice in numerous studies of effective pedagogies. The Council on
Undergraduate Research (CUR) is the leading national voice of faculty engaged in
research with undergraduates. This presentation will highlight CUR's structure and the
many services CUR offers to faculty currently working with undergraduate students in
research, or interested in beginning such work.
CHED 103
NSF S-STEM scholarship and support mechanisms: A cohort-based summer bridge
program in chemistry
Kate J Graham, Edward J McIntee, [email protected], Paige M
Armbrister.Department of Chemistry, College of Saint Benedict/Saint John's University,
Saint Joseph, MN 56374, United States
The College of Saint Benedict/Saint John's University (CSB-SJU) was awarded an NSF SSTEM grant in August 2011. The primary goal of the FoCuS Scholarship and Support
Program is to increase the number of students, particularly high achieving students from
groups historically underrepresented in science completing a major in chemistry or
biochemistry at CSB-SJU. FoCuS provides scholarships and an infrastructure to support
our FoCuS students (and all of our majors) throughout their college careers. These efforts
will improve our retention of the FoCuS scholars. We have planned a support system for
these students utilizing several key activities. This presentation will focus on cohort-building
activities during our summer bridge program that have proven to be crucial for the retention
of FoCuS students.
CHED 104
Chemistry self-concept, chemistry achievement, and instructional methods in high
school chemistry classrooms
Sara E Nielsen, [email protected], Ellen J Yezierski.Chemistry and Biochemistry,
Miami University, Oxford, OH 45056, United States
Student beliefs, though less often studied than achievement, are an important part of
students' success in chemistry. Prior research has shown that students' beliefs about their
ability to do chemistry affect their performance and persistence in chemistry. Albert
Bandura's Social Learning Theory considers a reciprocal relationship among three
determinants that affect students: personal, behavioral, and environmental. In this study
the personal determinant is represented by student self-concept, the behavioral
determinant is represented by student achievement, and the environmental determinant is
represented by the instruction students receive. The determinants are measured with the
Chemistry Self-Concept Inventory, content quizzes, and the Reformed Teaching
Observation Protocol, respectively. To investigate the nature of the relationships among
the three determinants, a longitudinal study is being conducted with high school chemistry
students. An analysis of several rounds of self-concept, achievement, and instructional
methods data will be presented.
CHED 105
POGIL activities that use climate change to teach general chemistry
Daniel King1, [email protected], Jennifer E Lewis2, Karen Anderson3, Douglas
Latch4, Susan Sutheimer5, Gail Webster6, Cathy Middlecamp7, Richard Moog8. (1)
Department of Chemistry, Drexel University, Philadelphia, PA 19104, United States (2)
University of South Florida, United States (3) Madison College, United States (4) Seattle
University, United States (5) Green Mountain College, United States (6) Guilford College,
United States (7) University of Wisconsin, Madison, United States (8) Franklin and
Marshall College, United States
Climate change is a topic that is familiar to most students. It is also a topic that relates to
many topics covered in general chemistry. Through an NSF-funded project, we are
developing a series of in-class POGIL (Process Oriented Guided Inquiry Learning)
activities that use climate change topics to teach general chemistry concepts. It is expected
that these new activities will help engage students in learning fundamental general
chemistry concepts. We will also be investigating student discourse collected during the
activities. This information will inform revisions of the activities so that they better promote
both the development of scientific concepts and how these relate to socio-economic and
environmental issues. A set of activities have been written and are being tested during the
2012-2013 academic year. The key features of the activities and feedback on their use will
be described in this presentation.
CHED 106
History of chemistry capstone course: New solutions to an old problem
Alan J Rodríguez, [email protected], Ingrid Montes.Department of Chemistry,
University of Puerto Rico, Rio Piedras, Puerto Rico 00976, Puerto Rico
Courses on the History of Chemistry have been, in the past, the source of heated debate in
terms of their profit and relevance to the chemistry curriculum. Based on the number of
publications on the topic, the teaching of these courses reached its peak almost 40 years
ago and has been decaying ever since. Nonetheless, in the last few years, a couple of
papers have been published on the topic, hinting to a renewed interest on the discipline. To
attend this, a capstone course has been designed that integrates both graduates and
higher-level undergraduate students in a non-traditional experience that fosters creativity,
problem solving skills, general knowledge, and teamwork. The course has been
implemented and found out to successfully attend the shortcomings of the traditional
design. The preliminary results are very promising. The design, methodology and
preliminary findings will be detailed.
CHED 107
Increasing student retention in chemistry and other STEM majors through the
Collaborative Learning Program
Mandy M. Raab1, [email protected], Matthew A. Fisher2, Stephen M.
Jodis1. (1) Herbert W. Boyer School of Natural Sciences, Mathematics, and Computing,
Saint Vincent College, Latrobe, PA 15650, United States (2) Department of Chemistry,
Saint Vincent College, Latrobe, PA 15650, United States
The Collaborative Learning Program (CLP) at Saint Vincent College focuses on the
problems faced by many undergraduate institutions in capturing and maintaining a
student's enthusiasm for a chosen STEM discipline long enough to reach graduation. CLP
is designed to increase student mastery of course concepts and persistence in majors such
as chemistry and biochemistry through the use of collaborative learning environments held
outside of class and led by student facilitators. Discussions include real-world applications
to course concepts. In its fourth year, the program has successfully reached important
benchmarks related to student participation in CLP sessions and retention in STEM majors.
We will present an overview of the CLP program and data related to program impact,
including a comparison of course pass rates for General and Organic Chemistry with prior
historical data.
CHED 108
Impact on facilitators of involvement in Saint Vincent College's Collaborative
Learning Program
Bettie A. Davis1, [email protected], Mandy M. Raab2, Matthew A. Fisher1. (1)
Department of Chemistry, Saint Vincent College, Latrobe, PA 15650, United States (2)
Herbert W. Boyer School of Natural Sciences, Mathematics, and Computing, Saint Vincent
College, Latrobe, PA 15650, United States
The Collaborative Learning Program (CLP) at Saint Vincent uses outside of class
collaborative learning sessions led by student facilitators to increase student mastery of
concepts in science courses such as general chemistry and general biology. Student
facilitators are responsible not only for leading the sessions but also planning and
developing the activities used. While a number of studies have looked at the effectiveness
of peer-led sessions for students taking general or organic chemistry, much less attention
has been given to the impact of serving as a facilitator on a student's knowledge and
understanding of the material, ability to communicate this knowledge, and goals for future
pursuits. This poster will present initial results of interviews conducted with past and
present facilitators that focus on these questions.
CHED 109
Predictors of student success in general chemistry courses
Sarah J. Pilkenton1, [email protected], Catherine F. Dignam1,
[email protected], LaDonna Bridges2, Michelle Sterk Barrett2. (1) Department of
Chemistry and Food Science, Framingham State University, Framingham, MA 01701,
United States (2) Center for Academic Support and Advising, Framingham State
University, Framingham, MA 01701, United States
Enrollment in first year chemistry courses for science and engineering majors have
experienced a marked growth at Framingham State University. Enrollment increases have
led to University wide discussions regarding student success in all STEM gateway courses.
It is desired that the number of students who withdraw from the course or who earn grades
of D or F be reduced without compromising the quality of the education provided. In an
effort to better understand what types of qualities a successful first-year chemistry student
exhibits, a study has been undertaken to identify predictors of student success in general
chemistry courses based on student SAT mathematics and reading scores and student
performance on math placement exams. A significant correlation between student scores
on the mathematics and reading scores on the SAT and the Accuplacer mathematics exam
and student success in freshman chemistry courses has been observed. It is the hope that
this information will be used in two ways (1) to better inform advising and prerequisite
policies and (2) to develop appropriate support and preparative programs geared toward
students who have predictors that correlate with a high probability for unsuccessful
completion of general chemistry.
CHED 110
Hands-on STEM education and enchanted experiences for students with blindness
or low vision (BLV)
Roger Tower, [email protected] Science, West Lafayette,
Indiana 47906, United States
Commonly relegated to note taker or secretary, a student with BLV often is not given the
hands-on learning opportunities provided for their peers. Roger Tower presents his
experiences from the Enchanted Hills Summer Camp (EHC) for the Blind and the
importance of inclusion of students with disabilities in science courses. In partnership with
the San Francisco Lighthouse for the Blind, EHC empowers individuals to find strength,
confidence and independence while enjoying nature, making friends, and meeting other
people with disabilities. Set deep in the hills of Napa Valley, campers conducted
experiments in their local environment with the accessible data collection tool, Talking
LabQuest. Explored are the values of an educational summer camp experience for all
students' growth and interest in academic material. Learn how accessible science,
technology, engineering, and mathematics (STEM) can be, with the right tools and
methodologies.
CHED 111
Multi-Sensory Science Teacher Education Research Laboratory (the MISTER Lab) at
Illinois State University
Cary A Supalo, [email protected], Illinois State University, Normal, IL 61790,
United States
This research laboratory has been founded on the premise that multi-sensory science
approaches to teaching enhances student learning. This entity is committed to student
engagement and the full integration of all students including those with special needs. This
research laboratory focuses on the acquisition and testing of hands-on learning tools in all
areas of science. Further, the uses of virtual laboratory modules along with haptics
interfaces are areas of interest. Through the multi-sensory inputs and outputs of scientific
concepts, it is believed this will make science more inclusive for all learners. The MISTER
Lab is committed to universal design approaches to teaching science and we are
interested in collaborations with other researchers who are equally committed. The use of
text-to-speech interfaces for students with blindness or low vision (BLV) is another primary
area of interest. We believe hands-on tactile and audio outputs complements and
reinforces science learning for all students.
CHED 112
Design and implementation of general chemistry curriculum for pre-service teachers
Pong Kau Yuen1, [email protected], Diana, Cheng Man Lau2. (1) Faculty of Science and
Technology, University of Macau, Macau (2) Faculty of Management and Administration,
Macau University of Science and Technology, Macau
Chemistry is an important science subject and the effectiveness of chemical education is
critical to the advancement of scientific literacy of students. Chemical education is the
central part of the science education. In order to fulfill the requirements for the minor
program in science education, the general chemistry curriculum have been designed and
implemented for the Macau's pre-service teachers. The purpose of this paper is to review
the mechanism of designing chemistry curriculum and introduce the objectives, the
content, the teaching approach and the assessment of the chemistry courses for the preservice teachers in Macau.
CHED 113
Influence of student-created technique videos on long-term retention of student
technique
Mitzy A Erdmann, [email protected], Joe L March.Department of Chemistry,
University of Alabama at Birmingham, Birmingham, AL 35205, United States
Video capable cellular phones have become increasingly important in documenting
everyday life events. This trend presents educators with an exciting opportunity to extend
this capability into the introductory laboratory. Having already shown the feasibility of
having students create technique videos with previously owned hand-held devices, the
authors focused on gains in student technique following completion of the video
assignment. Short-term gains of student technique using (1) an analytical balance and (2)
a Mohr pipet have been previously reported. Long-term retentions was determined and
compared to previously collected short-term retention findings. An experimental group
created a pipet video while a control group created a balance video. Gains in students'
ability to record volumes using the correct significant figures or minimize error when using
an analytical balance were compared to pre-activity and at the end of the term. This talk
will discuss the results of the Pre- /Post- analysis and outline future directions for the
project.
CHED 114
Chemistry and scientific reasoning: Development and implementation of classroom
activities
Justin H. Carmel, [email protected], Yasmin Jessa, [email protected], Ellen J.
Yezierski.Department of Chemistry and Biochemistry, Miami University, Oxford, OH 45056,
United States
A goal of many chemistry classes for non-science majors is to not only teach content in a
context that is pertinent to students' daily lives, but also to encourage them to think
critically. Scientific reasoning (SR), an important subset of critical thinking important to
scientists, includes being able to examine data, make inferences and generate hypotheses.
Typical gains in students' SR ability have been quantified through use of the Lawson
Classroom Test of Scientific Reasoning with a historical control. Results have guided the
design of the instructional treatment: A series of 15 content-rich, reasoning-focused
interventions using a guided inquiry framework. This pedagogical approach has been
previously shown to help students' improve their SR skills. Activities were designed to align
seamlessly with the course curriculum based on Chemistry in Context, an American
Chemical Society publication. A detailed explanation of the nature, development, and
testing of the interventions will be presented.
CHED 115
Using the Redox Concept Inventory (ROXCI) to assess student misconceptions
across the particulate and symbolic domains
Allie Brandriet, [email protected], Stacey Lowery Bretz.Department of Chemistry &
Biochemistry, Miami University, Oxford, OH 45056, United States
Students lack a firm understanding of a topic usually taught during the first semester of
general chemistry: oxidation-reduction reactions (redox). Although students construct
knowledge from the data obtained by their senses, many textbooks and teachers focus
heavily on symbolic equations and rules for determining oxidation numbers as the tools for
learning redox concepts. Students can be left with memorized definitions, a superficial
understanding, and misconceptions about a complex topic that has a strong particulate
foundation. In order to elicit student ideas about oxidation-reduction on a large scale, the
Redox Concept Inventory (ROXCI) was created based on 39 semi-structured interviews
with undergraduate students. Preliminary data will be collected from general chemistry and
organic chemistry students in fall 2013. Findings from the pilot implementation of the
inventory will be discussed.
CHED 116
Analysis of student performance on the Molecular Attractions Concept Inventory
Michael P Bindis, [email protected], Stacey Lowery Bretz.Department of Chemistry
and Biochemistry, Miami University, Oxford, OH 45056, United States
The Molecular Attractions Concept Inventory (MACI) has been implemented with national
samples of high school and undergraduate chemistry students. The MACI assessed
student understanding of intermolecular forces with questions developed from student
responses to interviews involving paper chromatography experiments. The inventory was
revised into the current form after a pilot study with a smaller sample of undergraduate
students. Results of performance of high school and undergraduate students will be
presented, along with statistical measures that illustrate the reliability and validity of MACI.
In addition, alternate conceptions of students with regard to intermolecular forces and
paper chromatography will be presented.
CHED 117
Informing practice from assessment results: The assessment as scientific inquiry
framework
Jordan T Harshman, [email protected], Ellen J Yezierski.Department of Chemistry
and Biochemistry, Miami University, Oxford, OH 45056, United States
Formative assessment research in science focuses heavily on design, implementation, and
validation, but does not elaborate on how teachers should use results of assessments to
enhance their teaching practice. This study posits an original framework built from a
framework by Calfee and Masuda called the Assessment as Scientific Inquiry (ASI)
framework. This framework attempts to elaborate on a step not previously addressed in
formative assessment research: The transition from interpretation of data to the
instructional decision that is made. Interviews seeking to probe beliefs about original
assessments were conducted with several chemistry teachers from a national sample.
Interviews aimed to elicit chemistry teachers' beliefs regarding the role of assessment, their
interpretation of assessment results, and their justification for the decisions made per that
interpretation. In addition, teachers completed the Science Teacher Efficacy and Beliefs
Instrument (STEBI) to probe teachers' outcome expectancy. Results regarding the criteria
used to determine a conclusion and decision based on the results of teachers' original
assessments will be presented.
CHED 118
WITHDRAWN
CHED 119
Development of a rogue's gallery that illustrates practical errors and potential risks
in filtration
J. Martin E. Quirke1, [email protected], Jonathan C. Quirke2, Lilia San Miguel1, Mayra
Exposito1. (1) Department of Chemistry and Biochemistry, Florida International University,
Miami, Florida 33199, United States (2) Department of Chemistry and Biochemistry,
Oberlin College, Oberlin, Ohio 44704, United States
Laboratory textbooks and manuals rarely illustrate what happens when students fail to
follow instructions on techniques. Thus, students may not understand why it is necessary
to follow instructions. This presentation focuses on errors and, more importantly, the
potential risks resulting from improper filtration technique. Fundamental techniques are
demonstrated using filtrations for several compounds. However, the principle foci will be
filtrations during the recrystallizations of aspirin and acetanilide because these experiments
are a common feature in core organic chemistry laboratory classes. The challenges and
dangers of hot filtration and vacuum filtration are explored. Among the topics covered are
selection of appropriate filter paper, use of sintered glass filters, fluting filter paper, the
need for clamping side-arm flasks, vacuum filtration of hot solutions. The potential of the
galleries for as a testing tool for pre-laboratory testing exercises are also discussed.
CHED 120
Minding the gap: The role of general chemistry in organic chemistry student
success
Suazette Reid Mooring, [email protected] of Chemistry, Georgia State
University, Atlanta, United States
Organic Chemistry is generally considered a gatekeeper course and the failure rate of the
two-semester sequence is high. Our goal is to determine the factors that lead to successful
completion and understanding of organic chemistry and to implement interventions to
increase student success in organic chemistry. To this end, we are investigating how
students' understanding of certain general chemistry concepts affects their performance in
organic chemistry. As a first step, chemistry faculty that teach both general and/or organic
chemistry were asked their opinion on what general chemistry topics they viewed as
important to student success in organic chemistry. Faculty completed a survey to rate
commonly presented topics in general chemistry and participated in an interview regarding
the role of general chemistry in student success in organic chemistry, and to discuss the
rating of general chemistry topics in the survey. The results of the faculty survey and
interview are presented.
CHED 121
Volunteer-based recruitment of future STEM teachers
Gary Lewandowski1, Daniel J McLoughlin2, [email protected]. (1) Department of
Mathematics and Computer Science, Xavier University, Cincinnati, Ohio 45207, United
States (2) Department of Chemistry, Xavier University, Cincinnati, Ohio 45207, United
States
This project explores the premise that community service-oriented STEM majors are more
likely to be interested -and more successful - in teaching in high-need districts. Xavier
University has a history of strong student volunteer contributions to the community.
Through an initial NSF Noyce Grant, we will use a community engagement process to
identify students that would not have otherwise pursued a teaching career. This process
includes connecting an introductory education course to urban education; recruiting STEM
majors to tutor in area schools; and creating a summer internship program that provides
students with experience teaching STEM topics to underrepresented minorities from local
K-12 schools. Both public and private schools are involved, further building on partnerships
that will facilitate teacher placement in high-need schools. The summer internships are
residential and create a learning community for interns. Competitive Noyce Scholarships
will help community service-oriented students complete licensure in their fourth or fifth
year.
CHED 122
Students' understanding of bonding as measured by the Bonding Representations
Inventory (BRI)
Cynthia J. Luxford, [email protected], Stacey Lowery Bretz.Department of Chemistry
and Biochemistry, Miami University, Oxford, OH 45056, United States
High school teachers and general chemistry instructors use multiple representations
including, Lewis Structures and 3-D manipulatives, to teach the concept of bonding. As
students learn to interpret these representations, misconceptions can develop. The
Bonding Representations Inventory (BRI) was developed to aid teachers in measuring the
prevalence of misconceptions about bonding representations that were detected through
student interviews. The BRI was administered to both AP and Non-AP high school
chemistry students as well as General Chemistry students. The prevalence of some
misconceptions as well as evidence towards the validity and reliability of the data collected
with the BRI will be presented.
CHED 123
Do they bite off more than they can chew? Why do chemistry majors leave?
Jessica M Fautch1, [email protected], Randi Shedlosky-Shoemaker2. (1) Department of
Physical Sciences, York College of Pennsylvania, York, Pennsylvania 17403, United
States (2) Department of Behavioral Sciences, York College of Pennsylvania, York,
Pennsylvania 17403, United States
In the past decade, undergraduate programs in science, technology, engineering, and
math (STEM) have experienced lower enrollment rates and higher and quicker attrition
rates. In an effort to determine what factors may predict which students persist in the
STEM majors, relative to students who move to other majors, we are conducting a
longitudinal study following chemistry (STEM) and psychology (non-STEM) majors during
their first year of college. This interdisciplinary study is a preliminary investigation into why
students choose to leave STEM majors. Participants complete surveys at three time points
and academic performance is recorded at five time points. Following this pilot study, the
research will be extended to other STEM programs in an effort to be more inclusive of all
STEM majors across campus. Additionally, data collected from the pilot study may help
design interventions for identifying students who struggle in STEM majors, possibly leading
to increased retention college-wide.
CHED 124
Promoting science with K-12 students through southern West Virginia
Joshua H Kim, [email protected], Emily M Wood, Micheal W Fultz.Department of
Chemistry, West Virginia State University, Institute, West Virginia 25112, United States
Undergraduate students at WVSU have been incredibly active over the last academic year
enhancing science education throughout the southern West Virginia region. These actives
include working with all age groups in the K-12 public and private schools and community
groups. These students have become “Ambassadors for Science” and are mentoring
younger students on how to reach into the community. New like science bowls and
sponsoring lab days at elementary schools have been established and older programs in
public education are reinvented with the help of able minds and generous fundraising
activities. New ideas and relentless pursuit of excellence will continue as long as
enhancing science education through hand-on activities is needed.
CHED 125
Study of the traditional science programs through surveys, focus groups, and a
workforce conference
Micheal W Fultz1, [email protected], Gail Mosby2, Frank Vaughan3, Gary Adams4. (1)
Department of Chemistry, West Virginia State University, Institute, West VIrginia 25112,
United States (2) Department of Sociology, West Virginia State University, Institute, West
Virginia 25112, United States (3) Department of Political Science, West Virginia State
University, Institute, West Virginia 25112, United States (4) Office of Sponsored Programs,
West Virginia State University, Institute, West Virginia 25512, United States
Upon being awarded an NSF-Historically Black College or University (HBCU) grant for a
study on the performance of the College of Natural Sciences and Mathematics the college
performed a multistep process to collect the best information available. This study included
a survey series on current students, prospective students, faculty and staff on the strengths
and weaknesses of the College, new programs and concentrations that should be offered,
career preparation, and community outreach. The second study was a series of focus
groups with all majors individually, faculty, alumni, and current employers on how we can
strengthen the college. The third step was a workforce conference bringing academia and
industry together too better communicate how we can better work together to strengthen
the region. This study will greatly alter the way the college will recruit, retain, and train
students.
CHED 126
Using Panopto to create media for chemistry classes via screen capture
John G. D'Angelo, [email protected] of Liberal Arts and Sciences, Division of
Chemistry, Alfred University, Alfred, NY 14802, United States
We have been using the screen capture program Panopto to create various course
adjuvants for organic and general chemistry courses. Among the uses are to create
preparative videos for group work assignments, video-based homework keys and recording
live lectures for archiving. Panopto has also been used to create deomonstration videos of
how to use electronic resources such as chemical drawing programs and Scifinder Scholar.
Preliminary feedback from students and difficulties encountered will be presented.
CHED 127
Analysis of novices' understanding of events in electrolytic solutions
Juliet A Hamak, [email protected], Resa M Kelly.Department of Science
Education, San Jose State University, San Jose, CA 95112, United States
A central component of learning general chemistry involves understanding equations and
formulae to solve problems. Often times, students are deemed competent in their
understanding of chemistry concepts when they are able to solve algorithmic problems.
This belief has been challenged by researchers (Kelly et al., 2009; Sirhan, 2007; Pinarbasi
& Canpolat, 2003; Smith & Metz, 1996) who have studied students' difficulties in making
connections between the algorithmic problem solving methods and the dynamics of
chemical reactions. The question is what do students really understand about the
conceptual nature of laboratory activities, and how do they draw connections to formulae
and equations? Prior to learning about precipitation reactions, where symbolic equation
patterns are emphasized, some teaching materials suggest having students examine the
electrolytic behavior of substances to inform students of the submicroscopic details of
substances. The goal of this study was to learn the kinds of key features and
misconceptions first semester general chemistry students portrayed in their written, drawn
and oral descriptions of substances tested for conductivity. Data collection involved student
volunteers completing worksheets and performing several simple microscale solution
conductivity activities using aqueous solutions of varying conductivity. The students were
observed and interviewed while performing the demonstrations to gain insight into their
understanding and ability to make connections between the macroscopic (visible to the
naked eye) and submicroscopic (atomic level) aspects of the laboratory activities. Insights
from this study, including implications for teaching and animation design will be shared.
CHED 128
Counterfeit drugs: Teaching three organic chemistry laboratory techniques using a
two week scenario
David Soulsby, [email protected] of Chemistry, University of
Redlands, Redlands, CA 92374, United States
Two thematically linked discovery-based first semester organic chemistry laboratory
experiments have been developed that introduce extraction, crystallization, and melting
point using a counterfeit drug scenario. In the first week students use filtration and acidbase extractions to separate their possible counterfeit drug into three separate compounds.
At this stage a simple chemical test establishes the identity of one of the compounds. In the
second week of the experiment students crystallize the remaining compounds and use
melting point to determine their identities from a list of possible candidates. Each student
then determines whether they have analyzed a counterfeit or genuine drug. By integrating
this scenario at the beginning of our laboratory sequence we have found that our students
have a better understanding of extraction, crystallization, and melting point, and are better
able to apply these techniques to later experiments.
CHED 129
Incorporation of liquid chromatography-mass spectrometry into the undergraduate
chemistry curriculum
Kevin H. Bennett, [email protected] of Chemistry, Hood College, Frederick,
Maryland 21701, United States
Liquid Chromatography-Mass Spectrometry (LC-MS) instrumentation has been intergraded
into the undergraduate chemistry curriculum at Hood College. The goal of this work was to
improve student understanding of separation and detection methods through experiments
involving a wide range LC-MS techniques. Concept development experiments in our lowerlevel classes provided students a foundation of separation and detection knowledge. As
students progressed through the curriculum they expanded and reinforced key concepts in
increasingly more complex and detailed experiments. Experiments were developed for
General Chemistry, Organic Chemistry, Quantitative Analysis, Instrumental Analysis,
Physical Chemistry, and Biochemistry. Additionally an experiment was developed for
inclusion into the non-science majors College Honors program. Research projects in the
Departments of Biology and Chemistry and Physics have also been impacted by access to
LC-MS instrumentation. Challenges of integration of complex instrumentation across the
curriculum will be discussed.
CHED 130
WITHDRAWN
CHED 131
Greenhouse gases capture and storage: Chemistry for clean air
Odette Esam, Aleksey Vasiliev, [email protected] of Chemistry, East
Tennessee State University, Johnson City, TN 37614, United States
Greenhouse gases from industrial sources in atmosphere contribute to greenhouse effect
leading to climate change. The experiment was developed for visualization of technology of
their sequestration and storage. In the model equipment for carbon dioxide capture, CO 2
was adsorbed on porous materials obtained in our laboratory by grafting and sol-gel
synthesis. By the first method, the materials were prepared by immobilization of organic
trimethoxysilanes containing amino groups on the surface of porous silica gel. The second
method was based on polycondensation of the same monomers in acidic media in
presence of a surfactant. A mixture of CO2 with nitrogen passed through the reactor filled
with an adsorbent at room temperature. Then, the temperature of the reactor was
increased to 120 °C, CO2 desorbed from the adsorption sites and was captured by a
barium hydroxide solution. The effectiveness of each adsorbent was calculated from the
mass of precipitated barium carbonate.
CHED 132
WITHDRAWN
CHED 133
Green acetylation of ferrocene using conventional microwave synthesis
Sarah E. Goergen, goer01[email protected], Chase T. Gerold,
[email protected], Ted M. Pappenfus, [email protected] of
Science and Mathematics, University of Minnesota, Morris, Morris, MN 56267, United
States
The acetylation of ferrocene is a highly researched topic in the undergraduate laboratory
setting involving a Friedel-Crafts reaction. Previous methods for acetylating ferrocene use
conventional thermal heating or laboratory grade microwave ovens and Nafion (an
expensive polymer). Since microwave synthesis is becoming increasingly popular in
laboratory experiments for their reduced solvent use and quick reaction times, a practical
and inexpensive lab was developed. This method uses a conventional microwave and a
solvent free, one-pot microscale reaction. When compared to previous methods, this
method is more undergraduate-level friendly due to the convenience of the procedure and
availability of the materials. The goal of the experiment was not to completely acetylate
ferrocene, but to have a mixture of ferrocene, acetylferrocene, and diacetylferrocene. By
having a mixture, students are able to purify and characterize their reaction mixture using
numerous techniques, including column chromatography, TLC, HPLC, GC-MS, FT-IR, and
NMR. Using response factors calculated during the developmental stage, a 1:1:1
ferrocene:acetylferrocene:diacetylferrocene mixture, students are able to use HPLC to
determine the relative amounts of these compounds in their crude reaction mixture. The
process by which acetylferrocene was synthesized will be integrated into the organic
chemistry laboratory curriculum at the University of Minnesota, Morris.
CHED 134
Quantum interference: How to measure the wavelength of a particle
Joseph M. Brom, [email protected], University of St. Thomas, St. Paul,
MN 55105, United States
We describe a quantum experiment suitable for an upper-division laboratory course in
physical chemistry. The experiment consists of preparing an initial quantum state of a
photon using a laser source, single-slit apparatus. At the detector, students measure the
probability that the photon will pass through the single-slit with momentum component px =
p sin Θ, where p is the momentum and Θ is the scattering angle of the photon. Due to the
fact that the initial quantum state of the photon is a superposition of position eigenstates,
quantum interference effects are directly observed and measured. Performing a Fourier
transform of the photon wavefunction from position space to momentum space allows the
student to measure the so-called wavelength of the quantum particle, i.e., the photon.
CHED 135
Using a guided inquiry and experimental approach to teaching buffers in general
chemistry
Teresa L. Longin, [email protected] of Chemistry, University of
Redlands, Redlands, CA 92373-0999, United States
Buffers are important in chemistry, biology, and environmental studies. Understanding
what buffers do and why, how to design and prepare buffers, and the limits on buffering
capacity are vital concepts. In this approach, a guided inquiry activity leads students
through a theoretical understanding of buffers and ends with students designing a buffer
system to
achieve a specific pH. This segues into a lab experiment in which the students use their
design to prepare and adjust a buffer solution to the desired pH. They add aliquots of
strong acid or base to their buffer while monitoring pH to directly determine the buffering
capacity of their system. The combination of guided inquiry and laboratory experiment
engages the students in learning the fundamentals of buffers and provides them with
hands-on experience in creating and testing buffers, reinforcing the concepts.
CHED 136
Cost-effective titration instrumentation for the chemistry laboratory using
inexpensive open-source microcontrollers
An-Phong Le, [email protected], Jonathan Smith.Department of Chemistry and Physics,
Florida Southern College, Lakeland, Florida 33801, United States
Computer-interfaced instrumentation is commonplace in research laboratories, but their
integration into high school and undergraduate laboratories can be costly (putting further
strain on already tight budgets). The recent availability of inexpensive microcontrollers
presents opportunities to develop this instrumentation in-house at a fraction of the financial
cost of commercially available alternatives, but this comes at a cost of time and so-called
“sweat equity.” To this end, we are interested in developing and distributing plans for
inexpensive computer-based instruments for the instructional laboratory. As a
demonstration, we have interfaced a standard pH electrode and a homebuilt infrared drop
counter to an ArduinoTM microcontroller to create a data logger capable of recording both
titrant delivered and solution pH in real-time. These sensors can be assembled by
students, and the adaptation and improvement of these devices could be an exciting
enrichment activity for students interested in electronics or as projects for industrial arts
classes.
CHED 137
Microbial secondary metabolism in the biochemistry teaching lab
Tanya L. Schneider, [email protected] of Chemistry, Connecticut
College, New London, CT 06320, United States
A semester-long project-based series of laboratory experiments was developed in order to
engage students in the second semester of introductory biochemistry. The lab project
centered on characterizing microbial enzymes important for the biosynthesis of clinically
used secondary metabolites, therefore linking the lab experience to the overall course
focus on metabolism. Students were able to make choices and develop portions of the
project, and learned current techniques such as site directed mutagenesis, affinity
purification of proteins, and enzyme activity assays. The class responded favorably to the
project topic, understanding that they were investigating novel areas of inquiry and
investing more in their work than when assigned more formulaic lab experiments.
CHED 138
Linking chemistry and biology courses through research on anticancer ruthenium
complexes
Laura K Stultz1, [email protected], Pamela K Hanson2. (1) Department of Chemistry,
Birmingham-Southern College, Birmingham, AL 35254, United States (2) Department of
Biology, Birmingham-Southern College, Birmingham, AL 35254, United States
Numerous studies have shown that undergraduate research significantly enhances a
student's educational experience. Here we describe an NSF-funded project aimed at
integrating research into introductory and upper-level chemistry and biology courses at
Birmingham-Southern College. Specifically, undergraduates in a 100-level chemistry
course synthesize anticancer ruthenium complexes and characterize the stability of these
drugs under a variety of experimental conditions, such as variable pH, temperature, and
ion concentration. Students in a 100-level cell and molecular biology course then use
budding yeast as a model organism to quantify the mutagenicity and toxicity of these drugs
under similar conditions. Results from these introductory courses will shape the
experimental design process for upper level biology and chemistry students who will
conduct phenomic screens, measure drug uptake, and analyze drug-DNA interactions. We
anticipate that this approach to STEM teaching and learning will lead to a measurable
improvement in the ability of students to articulate cross-disciplinary concepts.
CHED 139
Rearrangement reactions of epoxides derived from (R)-pulegone in an advanced
organic laboratory
Larry G. French, [email protected] of Chemistry, St. Lawrence University,
Canton, NY 13617, United States
Diastereoisomeric epoxides are prepared from (R)-pulegone, isolated from pennyroyal
earlier in the course, via reaction with hydrogen peroxide under basic conditions. Students
then explore two rearrangement reactions of these epoxides; one catalyzed by a protic acid
and the other by a Lewis acid, and determine the major product(s) from each reaction. The
p-toluene sulfonic acid mediated process affords predominately 2-hydroxy-5-methyl-2-(1methylethenyl)-cyclohexanone as a mixture of two diastereoisomers. Treatment with boron
triflouride etherate affords a single product, (5R)-2,2,5-trimethyl-1,3-cycloheptadione, in
high yield.
CHED 140
Photographic evidence for the mechanism and regiochemistry of Markovnikov and
anti-Markovnikov additions of hydrogen bromide to alkenes
Jesse E. Pulido1, [email protected], David A. Becker1, Jonathan C.K. Quirke2, J. Martin. E.
Quirke1. (1) Department of Chemistry and Biochemistry, Florida International University,
Miami, Florida 33199, United States (2) Department of Chemistry and Biochemistry,
Oberlin College, Oberlin, Ohio 44074, United States
This is part of an ongoing project to provide photographic evidence for the
outcome/mechanisms of most core organic chemistry reactions. 11-Undecenoic acid was
used to probe anti-Markovnikov reactions with colorful evidence for radicals obtained using
an azulenyl nitrone radical trap prior to addition of HBr. After adding gaseous HBr to the
substrate in the presence of benzoyl peroxide, the product was isolated and characterized
as the expected 11-bromoundecanoic acid. Photographic evidence for the product was
obtained by melting point, positive Finkelstein test and a negative test with ethanolic
AgNO3. Challenges in obtaining the Markovnikov adduct are discussed. For Markovnikov
addition, 2-ethyl-1-butene reacted with gaseous HBr to form 2-bromo-2-ethylbutane.
Photographic evidence was obtained by boiling point, negative Finkelstein test and
formation of a precipitate with ethanolic AgNO3. Challenges of obtaining the anti-
Markovnikov product by repeating the reaction in the presence of peroxide are discussed.
Pedagogical benefits of the work are described.
CHED 141
Exploring electrolytic products of water for the quantitative analysis of supplement
tablets
Christopher J Scanlon, [email protected], Rajeev B
Dabke.Chemistry, Columbus State University, Columbus, GA 31904, United States
An undergraduate experiment for the analysis of vitamin C in a commercial supplement
tablet is presented. In this experiment, we constructed an electrolysis cell. Electrolytically
produced I2(aq) oxidized ascorbic acid to dehydroascorbic acid. Starch was used as a
visible indicator to detect the end point of the titration. A measured volume of potassium
hydrogen phthalate (KHP) was added to the cathode compartment. Electrolytically
generated OH-(aq) neutralized KHP. Phenopthhalein was used as a visual indicator.
Electrolysis process was continued until corresponding end point is reached in both
compartments. From the amount of KHP added to the cathode compartment, the moles of
OH-(aq) and moles of I2(aq) generated in the anode compartment were determined. From
the stoichiometric relations, moles of ascorbic acid in a supplement tablet were quantified.
Detailed experimental procedure, construction of the electrolysis cell, and results will be
presented.
CHED 142
WITHDRAWN
CHED 143
Evaluating the evidence: Determining the course of a Diels-Alder reaction using
visible spectroscopy
Jonathan Rhoad, j[email protected] of Chemistry, Missouri
Western State University, Saint Joseph, MO 64507, United States
An essential skill for chemists is analyzing evidence to determine the outcome of the
reaction. Too often our teaching lab experiments predict for the students what that
evidence should look like, and the students can determine “did I get the right answer?” In
this experiment students react p-benzoquinone with cyclopentadiene. The visible
absorbance of the reaction at several wavelengths is observed using a Microlab®. The
students are then asked to determine what reactions are occurring.
CHED 144
Study of the methyl formate decomposition
Hafed A Bascal, [email protected], The University of Findlay, Findlay, Ohio
45840, United StatesChemistry, The University of Findlay, Findlay, Ohio 45840, United
States
The thermodynamic data of oxygenated species, such as methyl formate, are not as well
studied as those of standard hydrocarbon fuels. However, these data are of essential in the
development of chemical kinetic models, particularly in the combustion of oxygenated
fuels. As most of the available rate parameters are derived from the study of conventional
hydrocarbon fuels. Moreover, oxygenated fuels can exhibit unfamiliar bond dissociation
energies, especially these bonds that are in close proximity to the electronegative oxygen
atoms. In this work calculated thermodynamics data of the major species in the
decomposition of Methyl Formate will be presented.
CHED 145
Incorporating nanotechnology based laboratory experiments into first semester
general chemistry
David S Heroux, [email protected], Benjamin Murphy.Chemistry, Univ. of Maine
at Farmington, Farmington, ME 04938, United States
Many colleges and universities are now implementing an Atoms-First methodology to first
year chemistry instruction. This change provides a great opportunity to incorporate
nanotechnology-based experiments. The use of nanotechnology-based laboratories
addresses two issues. First, since Atoms-First teaching constitutes building upwards from
electrons, to atoms, to molecules and then to reactions, many traditional, early firstsemester labs are best used later in the semester. This is not the case with many
nanotechnology-based experiments, which can be understood without thorough exposure
to general chemistry topics. Secondly, nano-based experiments introduce students to
exciting and modern applications of chemistry in ways not typically illustrated in traditional
early semester labs. Therefore, the use of nanotechnology based experiments allow the
instructor to lay fundamental principles of chemistry in lecture while students do
experiments in lab that builds interest in chemistry. The experiment presented in this poster
could also be adapted to any general chemistry courses.
CHED 146
Development of an advanced NMR-centered undergraduate interpretive
spectroscopy course
William F. Wacholtz, [email protected], Brant L. Kedrowski,
[email protected] of Chemistry, University of Wisconsin Oshkosh,
Oshkosh, WI 54901, United States
Most senior-level undergraduate interpretive spectroscopy courses offer a curriculum
taught from an organic-centric perspective that covers the three basic spectroscopic
techniques of infrared (IR), gas chromatography-mass spectrometry (GC-MS), and nuclear
magnetic resonance (NMR). Our approach was to team teach an interpretive spectroscopy
course using both an inorganic and organic perspective focusing more on NMR
spectroscopic techniques as the central tool for structural analysis and identification.
Throughout the course inorganic as well as traditional organic examples were employed in
all lecture, laboratory and assessment aspects of the course. Through an integrated lecture
and laboratory experience, which employed online (D2L ©) examples of real-world analysis
problems, students were introduced to increasingly more sophisticated spectroscopic
techniques. The course was structured such that technique-based laboratory experiences
were interspersed with unknown identification-based problems. A syllabus and course
materials with laboratory experiments will be presented and made available at the poster
session.
CHED 147
iExperiment: Incorporating mobile technologies into the chemistry laboratory
Diana Hoover, [email protected] of Natural and Health Sciences, Seton Hill
University, Greensburg, PA 15601, United States
Technology has revolutionized the collection, recording, and analysis of data. iPads and
laptop computers can be used in the teaching laboratory for recording and plotting
experimental data in real-time. A grant from the Spectroscopy Society of Pittsburgh was
used to purchase portable instruments manufactured by Vernier. These instruments
operate with LoggerPro software that can be installed on student-owned laptops. The
incorporation of portable instrumentation and mobile technology into chemistry laboratory
courses at a private, four-year liberal arts university will be highlighted in this poster.
CHED 148
Incorporation of a “design thinking” facilitated activity to improve student learning
in undergraduate chemistry courses
Teresita Munguia, [email protected], Charles A Smith,
[email protected] of Chemistry, Our Lady of the Lake University, San
Antonio, Texas 78207, United States
Students in both advanced and introductory chemistry courses at Our Lady of the Lake
University performed an activity assimilated from “Design Thinking” in order to sequester
hurdles which hinder their learning in an OLLU Chemistry course. In the activity students
began by gaining empathy by interviewing another student in the class. The paired
students defined and identified hurdles that prevented academic success in their chemistry
course. Students conceived multiple solutions and presented their solutions or prototypes
to the class. Favorite prototypes were then incorporated into the course the following
semester.
CHED 149
Simple continuously extracting steam distillation apparatus for the organic
laboratory
Karl P. Peterson, karl.peter[email protected], Ross Jilk.Department of Chemistry, University
of Wisconsin-River Falls, River Falls, WI 54022, United States
A simple and efficient apparatus for steam distillation that is based on an inexpensive
modification to a standard fractional distillation apparatus and a separatory funnel has been
developed. The apparatus has been successfully used to isolate essential oils from three
natural sources. Eugenol has been isolated from ground cloves as part of a multi-week
project in our freshman organic chemistry laboratory course. Students isolate the essential
oil by steam distillation, analyze the oil using thin-layer chromatography, separate the
components of the oil by acid-base extraction, evaluate the antibacterial activity of the
crude oil and the separated components using a Kirby-Bauer assay, and then characterize
that antibacterial component (eugenol) using GC-MS, IR and 1H NMR. Additionally, we
have isolated cinnamaldehyde from ground cinnamon and anethole from ground anise
seeds. In each case the essential oil is isolated in a form that is pure enough to allow for
characterization by GC-MS, IR and 1H NMR. We have used this exercise as a follow-up to
the introduction to spectroscopy in our sophomore organic laboratory course.
CHED 150
Nucleophilic substitution reactions using phosphine nucleophiles: An introduction
to 31P NMR
Paul A Sibbald, [email protected] of Chemistry, Stetson University,
Deland, Florida 32723, United States
The use of nuclear magnetic resonance spectroscopy (NMR) to monitor reactant to product
ratios is a commonly used technique in modern synthetic chemistry. However this
approach is not often utilized when introducing nucleophilic substitution reactions in
undergraduate labs as these reactions are traditionally taught prior to discussing modern
spectroscopy techniques such as NMR. This limits an instructor's ability to illustrate
important concepts such as relative electrophile and nucleophile reactivity through
quantitative means.
A new undergraduate lab is described using 31P NMR spectroscopy to monitor product
formation for a number of different alkyl halide electrophiles and phosphorus nucleophiles.
Students are able to use reactant to product ratios obtained by simple 31P NMR to explore
the relative reactivates of these compounds.
CHED 151
Student bonding and coordination
Carolina Costa Farris, Carson De-Priest, [email protected], Lisa Orr,
[email protected], Andrew Cornell, [email protected], Jerry Darsey.Department of
Chemistry, University of Arkansas at Little Rock, Little Rock, AR 72204, United States
With the support from the Chemistry Department, the Student Organization of the
American Chemical Society at the University of Arkansas at Little Rock (UALR) has
continued to grow in strength and size around the campus. This year, the goal of the
organization has been to increase student involvement. By continuing with previously
implemented programs, such as the partnership between the university and a local school,
encouraging student involvement with undergraduate research, and providing free tutoring
services, UALR ACS remains as an important chapter of the lives of the Chemistry majors
and minors in Little Rock. With the participation of faculty members and graduate students,
our monthly meetings provide relevant Chemistry topics to undergraduate students, who
enjoy free lunches and networking opportunities during the meetings. Our organization is
also participating in events such as the Color Run, a national 5km race which supports
charitable organizations.
CHED 152
Project-based experiments in the quantitative analysis lab: Determination of the
calcium content in an “artifact”
Sara E Hubbard, [email protected] of Chemistry, Ouachita Baptist
University, Arkadelphia, Arkansas 71998, United States
In the quantitative analysis laboratory, we seek to aid students in the development of their
laboratory skills while also exposing them to real-world topics. This project requires
students to research possible methods for calcium determination and discuss the pros and
cons of each. Each group of students submits a project proposal for the determination of
calcium in an “artifact” using two methods of analysis. Techniques include EDTA titration,
gravimetric analysis, AA, and UV-Vis absorption. The groups spend several lab periods
performing their analyses, culminating in an oral presentation of their findings to their
classmates and the faculty. This capstone to the quantitative analysis lab experience
allows students to bring their wet and instrumental lab skills together while learning to
compare the effectiveness and efficiency of techniques for a real-world sample that limits
the amount of analyte they can use.
CHED 153
Statistical analysis of the efficacy of online learning in general chemistry at the
University of Washington
Jan Irvahn2, Jacob Parikh1, Andrea Carroll1, Philip J Reid1, Colleen F Craig1,
[email protected]. (1) Department of Chemistry, University of Washington, Seattle,
Washington 98195, United States (2) Department of Statistics, University of Washington,
Seattle, Washington 98195, United States
We present the results of a linear regression of exam scores for students in general
chemistry versus performance in two online learning systems: WebAssign, which presents
problems in a traditional manner, and ALEKS (Assessment and LEarning in Knowledge
Spaces), which is an adaptive, tutorial-based system. Comparisons are made for students
taking the same general chemistry course, taught by the same instructor, in the same
quarter in subsequent years, where WebAssign was used one year, and ALEKS the next.
We find that in WebAssign, a 1 point difference in homework score corresponded, on
average, to a 0.46 point difference in final exam score (95% CI: 0.36, 0.56). In ALEKS, a 1
point difference in homework score corresponded, on average, to a 1.06 point difference in
final exam score (95% CI: 0.98, 1.15). Controlling for gender and SAT scores did not
change the overall conclusion.
CHED 154
Development of a reciprocating college and university speaker series between local
sections in Georgia
Kevin M. Bucholtz, [email protected] of Chemistry, Mercer
University, Macon, GA 31204, United States
An American Chemical Society Local Section Innovative Programs (IPG) grant was
awarded to develop a reciprocating speaker series at the undergraduate colleges and
universities in central and southern Georgia (Local Sections 410, 416, 454). These three
local sections do not have chemistry Ph.D. granting institutions in their section but are
characterized by 12 smaller undergraduate institutions including three Historically Black
Colleges and Universities (HBCUs) and a women's college. Implementation of the program
has resulted in participation by six colleges and universities in three sections (410, 416,
454). During the spring semester of 2012, a total of ten seminars by six speakers were
given as a result of the program. This program has provided an excellent opportunity for
faculty to interact with other faculty from similar schools and provides students with a
broader exposure to chemical research topics.
CHED 155
Utilizing 31P NMR spectroscopy in undergraduate general chemistry courses as an
early introduction to modern chemical characterization
Richard M. Coulson, John T. York, [email protected] of Chemistry, Stetson
University, DeLand, FL 32723, United States
NMR spectroscopy is widely regarded as one of the most important tools in modern
chemistry. However, while many laboratory experiments teach students the details of 1H
and 13C NMR spectroscopy at the sophomore organic chemistry level, few tools exist for
introducing students to this crucial technique at the introductory general chemistry level.
We present here a new laboratory experiment in which first-semester general chemistry
students collect and interpret the 31P NMR spectra of a series of different PR3 compounds
(where R = aryl and alkyl substituents). By interpreting and comparing 31P NMR spectra,
students gain insight into important NMR concepts including chemical shift, peak
integration, and the use of internal standards, while avoiding much of the potential
confusion involved in the similar study of 1H NMR spectra. This early introduction to
modern NMR spectroscopy prepares students for the use of the technique in more
advanced ways in subsequent courses.
CHED 156
Establishing new bonds: The ACS-RUM family
Sherry Rivera, [email protected], Jorge Rullán, [email protected], Natasha
Santos-Piñero, [email protected], Félix Rodríguez, [email protected],
Samantha González, [email protected], Héctor Ocasio,
[email protected], Orlando Vázquez, [email protected], Jamil Silva,
[email protected], Diego Navarro, [email protected], Nilka Rivera,
[email protected] of Chemistry, University of Puerto Rico, Mayaguez,
Puerto Rico
The American Chemical Society has been in our Campus since 1954, making this year its
58th anniversary. Since then, we have been helping our members develop their academic
and professional skills. This year we have taken the unification of the chapter, which has
more than 120 members, as our mission. We do so through a series of activities involving
chemistry and its different faces and increasing the participation of every member, not only
in the activities, but also in their planning and organization. Those include, but are not
limited to, conferences, workshops, the National Chemistry Week, new members Initiation
Ceremony, school demonstrations, charities and social activities. Doing all these activities
we all work together as a big family. Throughout the year, we have seen the promising
development and unification of the members, forming the family we have sought for.
CHED 157
Optimizing trade-offs: The integrated lecture-laboratory in instrumental analysis
Nolan T Flynn, [email protected] of Chemistry, Wellesley College,
Wellesley, Massachusetts 02481, United States
Instrumental analysis courses enable students to gain an understanding of instruments
used to probe chemical systems. These courses often provide a detailed understanding of
the underlying principles of electronics and circuitry, data acquisition and processing, and
relevant figures of merit while working with a variety of instruments. Many of the skills and
much of the content presented in the instrumental analysis class is, by its very nature,
hands on. However, the traditional format of separate lectures and laboratories makes
maximizing time for these experiences challenging. To mitigate this difficulty, we have used
the integrated lecture/lab format, blending hands on activities, including those akin to lab
experiments, with lecture/discussion. Using two 3 hour blocks per week has provided
ample opportunity for active student learning. We will present salient outcomes for both
instructor and students.
CHED 158
WITHDRAWN
CHED 159
Thermodynamic study of solute partitioning: A second-semester chemistry
experiment
William Steel, [email protected] Sciences, York College of Pennsylvania, York,
PA 17405, United States
The partitioning behavior of molecular iodine in liquid-liquid systems composed of water
and an organic solvent has been used in the general chemistry laboratory curriculum to
explore the concepts of thermodynamics. Working in small groups, students use UV-vis
spectroscopy to observe and quantify the iodine partitioning in several systems (in the form
[I2]org/[I2]aq), each of which begins with a different concentration of dissolved iodine. Further,
each group conducts their work at a unique temperature. Compiling and analyzing the
class' temperature-dependent data allows students to calculate the enthalpy and entropy
changes that accompany the movement of molecular iodine across the liquid-liquid
interface. Optional features of the experiment include comparison to thermodynamic values
calculated from molecular modeling programs and utilization of different liquid-liquid
interfaces to observe the effect of the organic solvent on the resulting behavior.
CHED 160
What are the core chemistry concepts?
T. Wade Killingsworth, [email protected] of Chemistry and
Biochemistry, California State University Chico, Chico, CA 95929-0210, United States
What are the most valuable, fundamental, deep, central chemistry concepts? A review of
some publications on this topic will be presented. A proposed answer to the above
question will be given in the form of a list and a map. Issues with and uses of the list and
map will be discussed.
CHED 161
Power of affective factors (self-efficacy, motivation, and gender) to predict chemistry
achievement with the benefits of knowledge surveys on metacognition level
Xin Wu1, [email protected], Elzbieta Cook2. (1) College of Education, Louisiana State
University, Baton Rouge, LA 70803, United States (2) Department of Chemistry, Louisiana
State University, Baton Rouge, LA 70803, United States
Self-efficacy, gender, and motivation are subjective predictors of students' academic
achievement. Self-assessment prompted by knowledge surveys involves
metacognition,i.e., students' awareness of how they learn. Knowledge surveys can be used
to measure changes in students' achievement level and to assist students in content
review and inspire reflection on one's ability to learn. In this work, we combine the above
predictors into the survey to determine whether achievement in general chemistry can be
forseen. Our research was conducted on 700 students enrolled in General Chemistry I
classes (Chemistry for science majors) at Louisiana State University. The online survey
was administered during the last week of classes. Data were analyzed via descriptives,
correlation, linear and multiple regression statistical analyses with the correlation of grades
on Exam 1 and the final exam. The three predictors are ranked in terms of their
significance in predicting achievement in chemistry.
CHED 162
Physical chemistry lab experiment: Silver nanoparticles influence on the fluorescent
properties of ruthenium(II) tris(bipyridine) chloride
Timothy R Brewer, [email protected], Eastern Michigan University,
Ypsilanti, Mi 48197, United States
A physical chemistry laboratory was designed to synthesize various sizes of silver
nanoparticles and study their effects on the fluorescence of the dye ruthenium(II)
tris(bipyridine) chloride. Nanoparticles were synthesized in the size range from 10 to 50 nm
using previously published methods. The fluorescent quenching effect of different sizes of
nanoparticles was investigated through the use of a Stern-Volmer plot of fluorescence
intensity versus concentration of nanoparticle. Experimental results indicated a sizedependent quenching constant with larger nanoparticles exhibiting a larger quenching rate
constant. The other significant experimental result was that for a constant concentration of
nanoparticles, the fraction of dye absorbed on larger nanoparticles increased as the size of
the nanoparticles increased. These results can be attributed to the nanoparticle's surface
area.
CHED 163
Kinetics of reaction of potassium hydroxide with 2,6-bis(3-bromobenzylidene)
cyclohexanone in 50% acetonitrile - 50% water
Nicole Berry, [email protected], Eric Reinheimer.Chemistry, Cal Poly Pomona,
Pomona, California 91768, United States
The current interest in the synthesis of α,β-unsaturated dibenzylidene ketones such as (2E,
6E)-2,6-bis(3-bromobenzylidene)cyclohexanone 1 is their antitumor properties. Although
there is sufficient literature supporting these properties, there are a limited number of
reactivity studies of such compounds. The goal of this project focuses on kinetic studies of
1 . Kinetic data will be collected using UV-Vis spectroscopy which will follow the reaction of
1 with varying concentrations of potassium hydroxide solutions in aqueous acetonitrile to
determine the reactivity of the β-carbon. Preliminary kinetic results will be presented.
CHED 164
Expanding knowledge of chemistry at Roger Williams University and the
surrounding community
Christina Fontana, [email protected], Courtney Dennis, [email protected],
Stephen O'Shea, Clifford Murphy.Department of Chemistry, Roger Williams University,
Bristol, Rhode Island 02809, United States
Roger Williams University Student Affiliates began the academic year with a school-wide
exhibition of homemade liquid nitrogen ice cream to garner student interest in chemistry
and the RWU ACS affiliate chapter as a social outlet. The affiliates attended RI ACS local
section fall meeting at which Dr. John P. Jasper spoke about industrial batch auditing and
process patent protection. As part of the group's effort to promote chemistry, at RWU late
night programming Roger After Dark we presented chemistry demonstrations; elephant
tooth paste, super conductor, flame test. Additionally the RWU ACS chapter produced a
week long mural display to educate students on sources of renewable energy through
chemistry. We have extended our outreach activities to include performing chemistry
demonstrations at local high schools students via in-class demonstrations focusing on
green chemistry such as a looking into phosphate versus non-phosphate cleaning
products.
CHED 165
WITHDRAWN
CHED 166
Regulated expression of green fluorescent protein in Escherichia coli: An advanced
biochemistry lab
Steven J Cok, [email protected] of Chemistry and Food Science,
Framingham State University, Framingham, MA 01701, United States
The advanced biochemistry course at Framingham State University includes an experiment
on regulation of gene expression. In order to enhance the students' understanding of
regulation of gene expression and promote student driven experimental design, we have
used the pGlo gene expression vector from BioRad to evaluate regulation of the arabinose
operon by various carbohydrate sources. The gene encoding green fluorescent
protein(GFP) was under the control of the arabinose operon. Student designed
experiments were generated to measure increased expression of GFP by arabinose,
determine the stereospecificty of regulation and test whether other common sugars
affected gene expression. Extensions of this laboratory exercise included testing
repression of GFP expression by glucose in a concentration dependent manner. Evaluation
of student success and potential pitfalls will be presented.
CHED 167
SCIENCountErs: Teaching and learning science at the local boys and girls clubs
Elvin A. Morales, [email protected], M. Francisca Jofre, John W. Moore, Andrew E.
Greenberg.Department of Chemistry, University of Wisconsin: Madison, Madison,
Wisconsin 53705, United States
The SCIENCountErs outreach program is organized and run between the Institute for
Chemical Education (ICE) and the Boys and Girls Clubs (B&GC). The program was
established in 2005 in collaboration with the UW–Madison Nanoscale Science and
Engineering Center (NSEC). The aim of SCIENCountErs is to inspire and excite a diverse
audience of future scientists and engineers. These goals are achieved by presenting
hands-on science and engineering activities, using a guided-inquiry approach. This
presentation will go over the program's goals, pedagogical model, impact on the
community, and plans for statewide and nationwide expansion.
CHED 168
Introducing quality assurance practices in the analytical chemistry instructional
laboratory
Sharyn Miller, [email protected], Dan Sykes.Forenisc Science Program and Department
of Chemistry, The Pennsylvania State University, University Park, Pennsylvania 16802,
United States
Quality assurance is an important routine practice in industry-oriented environmental and
toxicology labs. In academia, analytical chemistry curricula often provide a cursory
overview of such practices in lecture and even less exposure in the laboratory. A laboratory
experiment was developed around the analysis and quantitation of synthetic cannabinoids
in herbal incense products using GC-MS which introduces students to the theory and
practial application of quality assurance as practiced in industry. The experiment employs
external and internal standards for quantitation and the use of check, performance,
recovery and surrogate standards for method validation.
CHED 169
Implementation of a framework for effective chemistry demonstrations
Jerome E Haky1, [email protected], Donna Chamely-Wiik1, Mari Heghinian1, Deborah
Louda2, Nancy Romance3. (1) Department of Chemistry and Biochemistry, Florida Atlantic
University, Boca Raton, Florida 33431, United States (2) College of Medicine, Florida
Atlantic University, Boca Raton, Florida 33431, United States (3) Department of Teaching
and Learning, Florida Atlantic University, Boca Raton, Florida 33431, United States
As part of a National Science Foundation's GK-12 program that enables graduate students
in science, technology, engineering and mathematics (STEM) to interact with students and
teachers in K-12 science classes, we have developed a framework for creating
pedagogically sound Chemistry demonstrations that allows for easy implementation and
flexibility. This SQER3 framework, Survey, Question, Experiment, Recite, Reflect and
Review, is an interactive, question-driven model that draws clear parallels to actual science
practices. This approach also enables students to extend their investigations through
cyclical rounds of additional questions and experiments. We have adapted several
conventional demonstrations to the SQER3 framework. Preliminary results in high school
classes indicate that utilizing this model is effective in enhancing student learning of
chemistry concepts and principles.
CHED 170
Kinetic vs. thermodynamic control: Slow movement to a new paradigm
David Oostendorp, [email protected], Adam Moser.Division of Molecular and
Life Sciences, Loras College, Dubuque, IOWA 52001, United States
Organic Chemistry textbooks have long used the addition of HBr to 1,3-butadiene as a
classic example of kinetic vs. thermodynamic control. At high temperatures the
thermodynamically favorable 1,4-addition product predominates. At low temperatures, the
less stable 1,2-addition product predominates. The traditional explanation for this is that the
activation energy of the 1,2-addition is lower, thus its rate is faster. Some texts, citing a
1979 experiment by Eric Nordlander, are stating that the real reason is what is being called
a proximity effect. We are currently charting and will report on the movement towards this
explanation in textbooks. We are using experimental and computational methods to further
refine the role the two explanations play in the reaction.
CHED 171
Integrating electronic data collection and web-based storage into a protein
denaturation experiment in the biochemistry teaching laboratory
Scott M Tremain, [email protected] of Chemistry, University of Cincinnati,
Blue Ash College, Blue Ash, OH 45236, United States
A vital component in the biochemistry laboratory curriculum is absorbance and
fluorescence spectrophotometry. Our traditional biochemistry experiments utilize singlewavelength spectrophotometers that are not capable of collecting absorbance spectra data
efficiently. Furthermore, a fluorimeter is not readily available. The MeasureNet electronic
data collection system consists of a central computer connected to a network of 15 student
workstations. Each workstation (outfitted with various probeware) records real-time data
that can be saved and uploaded to a web-based storage site accessible to the student from
anywhere. This project describes the integration of MeasureNet into an experiment
isolating the fluorescent protein phycocyanin. A dual-beam colorimeter probe is used to
monitor the change in fluorescence upon denaturation of phycocyanin.
CHED 172
Crime scene science: Lab driven liberal arts and science class
Shawn G Garrett, [email protected] of Chemistry, Minnesota State
University Moorhead, Moorhead, Minnesota 56563, United States
Forensic science is a multidisciplinary field applying the basic sciences of physics, biology
and especially chemistry to legal matters. Interest in crime scene investigations has led to
many forensics high school courses and upper division courses for advanced college
science students. However, at Minnesota State University Moorhead we have targeted
college undergraduate students in offering a course in crime scene science. This laboratory
driven class requires students to conduct forensic evidence analyses while learning the
underlying science. This course is for non-science majors and assumes limited science
and math backgrounds. All laboratories are presented as unsolved crimes; the labs
activities include physical, microscopic and chemical analyses of hair and fiber, document
analyses, fingerprint and impression development, DNA profiling and blood typing, glass
and soil evidence analyses, identification of possible drug evidence and a final crime scene
investigation involving evidence collection at a simulated crime scene, laboratory analysis
of the evidence and a crime scene report. Basic science topics include measurements, use
of proper standards and controls in experimental design, physical and chemical properties
and changes, classes of chemical reactions, biological molecules and basic biochemistry.
The course outline, more details on activities and resources, and how the basic science
and forensic science have been combined to fulfill science transfer requirements will be
presented. Initial student reactions will be shared, along with ideas for future course
modifications and assessments.
CHED 173
Project iPad: Integrating iPads into organic chemistry
G. Robert Shelton, [email protected] of Chemistry, Austin Peay State
University, Clarksville, TN 37044, United States
This project aims to advance and promote general conceptual understanding in organic
chemistry using different methods aided by iPads and Apps. Preliminary ideas are currently
being field-tested by the PI's this academic year. Some units are a self guided exploration
of a topic, while others are a larger guided inquiry where small group results are shared
instantaneously with the classroom. Each chapter or unit within a semester of organic
chemistry will ultimately have either a small group and/or classroom intervention centered
around the iPad. The introduction of Apple's iPad and its ability to sustain and promote
student inquiry and active learning will be discussed.
CHED 174
Fostering an induction into authentic research in the freshman/sophomore
sequence
Matthew L Miller1, [email protected], David P Cartrette1, Kenneth Emo2. (1)
Department of Chemistry & Biochemistry, South Dakota State University, Brookings, South
Dakota 57007, United States (2) Departmen of Education, University of Minnesota-Morris,
Morris, Minnesota 56267, United States
This two-year NSF funded (1044419) project created a model of laboratory instruction with
the goal of increasing student interest in early involvement in research within the
department of chemistry and biochemistry. The primary methods to create interest included
using advanced instrumentation, inquiry methods, and collaboration. The implementation of
this plan was unique in that students from two different chemistry laboratory courses (firstand second-year) were enrolled simultaneously in the same laboratory period. Activities
were implemented requiring students from two different courses to work collaboratively
toward answering a specific question. We will present how selected activities were
integrated across both courses. Data were collected via surveys, observations, and a
critical thinking examination (NSF CCLI) and analyzed to identify changes in student
interest in research. We will present initial findings from the data to assess the role played
by this model of instruction on increased research interest.
CHED 175
2012 ACS Global Innovation Grant Award: Computational Chemistry Teaching and
Research Laboratory at Kenyatta University, Nairobi, Kenya
Lewis Whitehead1, [email protected], Heather Burks1, Brigitta Tadmor2,
Nina Dudnik3, Evans Ogwagwa Changamu4. (1) Global Discovery Chemistry, Novartis
Institutes for Biomedical Research, Cambridge, Massachusetts 02139, United States (2)
Education, Diversity & Inclusion, Novartis Institutes for Biomedical Research, Cambridge,
Massachusetts 02139, United States (3) Seeding Labs, Boston, Massachusetts, United
States (4) Department of Chemistry, Kenyatta University, Nairobi, Kenya
At the 2012 spring ACS in San Diego the International Activities Committee announced the
approval of a plan to award Global Innovation Grants to ACS technical divisions. We have
been awarded the first Global Innovation Grant and present a progress report on our
activities.
CHED 176
Augmenting in-lab demonstration with QR codes for smartphones
David Collins, [email protected], Timothy Lee.Department of Chemistry, SUNY
Cortland, Cortland, NY 13045, United States
Surveys and anecdotal evidence suggest that smartphone usage among college students
approaches 75%; implementing this technology into the instructional laboratory can
leverage much of the benefits (on-demand information and tools) with lesser impact from
the distractions they present. We present a set of QR codes which can be incorporated into
handouts or lab manuals. These QR codes provide students with immediate access via
smartphone app to short demonstration videos illustrating common general chemistry
laboratory techniques.
CHED 177
Early instruction in NMR through improved coordination of laboratory and lecture
topics in introductory Organic Chemistry
William E. Brenzovich Jr., [email protected], Vernon Miller, W. Gary Hollis
Jr..Department of Chemistry, Roanoke College, Salem, VA 24153, United States
With access to a 400 MHz NMR spectrometer with an autosampler, Roanoke College has
been actively pursuing opportunities to further integrate the use of NMR spectroscopy in
the introductory organic lab. We strongly believe that NMR should be introduced early in
the lab program to maximize hands-on experience, but have found that students lack the
required comprehension of organic structure to fully understand the technique in the early
experiments . To realize our goals, we have recently explored and implemented several
models to better integrate the teaching of NMR concepts in lab and lecture to allow for
early instructional use of NMR in the organic lab, including earlier instruction on NMR
concepts in lecture and a less rigorous use of NMR in early lab experiments. We will
present an overview of the recent modifications made to the organic curriculum, and
assess future directions for curricular development.
CHED 178
Institute for Accessible Science: Increasing laboratory independence for students
with disabilities
Greg J. Williams1, [email protected], Bradley S. Duerstock1,2, Susan M. Mendrysa3,
Lisa M Hilliard4, Wilella Burgess4, Loran Carleton Parker4. (1) Weldon School of
Biomedical Engineering, Purdue University, West Lafayette, Indiana 47907, United
States (2) School of Industrial Engineering, Purdue University, West Lafayette, Indiana
47907, United States (3) Department of Basic Medical Sciences, College of Veterinary
Medicine, Purdue University, West Lafayette, Indiana 47907, United States (4) Discovery
Learning Research Center, Purdue University, West Lafayette, Indiana 47907, United
States
Persons with disabilities are under-represented both in STEM degrees and careers. Many
programs have been established to increase the number of students with disabilities
(SWDs) obtaining STEM degrees on the assumption that this would translate into their
greater representation in the STEM workforce. However, the techniques and tools which
enable them to complete a degree are not necessarily transferrable to the workplace. For
instance, in chemistry lab courses students who are visually impaired rely on lab partners
to conduct most of the experimental work.
The mission of the Institute for Accessible Science (IAS) at Purdue University is to develop
and disseminate methods and technologies which enable SWDs to function more
independently in university laboratories and beyond. This poster will describe some of
IAS's ongoing projects and present case studies of two students with visual impairments
whom the IAS assisted to develop solutions to barriers they encountered in labs.
CHED 179
Demonstration of chemical and physical principles through group construction of
side by side freshwater and saltwater barometers
Richard W Gregor, [email protected] of Chemistry, Rollins College, Winter
Park, FL 32789, United States
An engaging re-creation of the 17th Century work of Torricelli and von Guericke, where
students use a four story parking garage to build a water barometer from simple materials,
is described. A novel aspect of the experiment is the simultaneous erection of a saturated
sodium chloride barometer. The experiment introduces the following topics: pressure,
density, solubility, boiling point, vacuum, vapor pressure, Dalton's, and Henry's Laws. The
10.4 m height of the water barometer offers a more easily visualized comparison to the 8.8
m for the saltwater barometer, than to either a mercury barometer or values from a weather
service. This offers immunity from the difficult systematic corrections which would
otherwise make comparisons frustrating, especially for novices. The experiment is suitable
for students from high school through advanced college level, depending on the level of
sophistication used in analysis. As part of the experience, we create a video documenting
the activity.
CHED 180
Threading flavones through the undergraduate chemistry laboratory curriculum
David M Collard, [email protected], James C. Morris, David L. Jenson,
Mary E. Peek, Stefan A. France.School of Chemistry & Biochemistry, Georgia Institute of
Technology, Atlanta, Georgia 30332-0400, United States
A curriculum “thread” in which students revisit aspects of a particular topic throughout the
laboratory sequence over the four-year bachelor degree curriculum blurs the boundaries
between traditional “divisional” laboratories and provides opportunities for inquiry-based
activities and research-based learning. In the “Threading Flavones” project (supported by
NSF award DUE 1044034) we are developing experiments in which students prepare a
library of compounds and characterize their structure, chemical properties and biological
activity in a series of exercises spread across organic, analytical, physical and biochemistry
laboratory classes. The project is designed to better integrate learning and create the
context, relevance and redundancy needed to promote student-focused learning goals
such as retention of key concepts throughout the curriculum, critical thinking, development
of laboratory and technical writing skills, and collaborative problem solving. The project
includes faculty workshops to promote collaborative curriculum development and adoption.
CHED 181
Medicinal chemistry research at Texas Tech University Health Sciences Center
School of Pharmacy
Teresa Carlisle, Paul C Trippier, [email protected] of Pharmaceutical
Sciences, Texas Tech University Health Sciences Center, School of Pharmacy, Amarillo,
Texas 79106, United States
The Department of Pharmaceutical Sciences at Texas Tech University Health Sciences
Center (TTUHSC) School of Pharmacy in Amarillo is establishing a medicinal chemistry
research concentration. The department seeks to build on internationally renowned
researchers in cancer biology and pharmacology of the blood brain barrier.
Research area concentrations are in the design and evaluation of compounds that
demonstrate activity to combat cancer and explore the tumor microenvironment, potential
therapeutics for central nervous system diseases, and chemical neuroscience probes.
The acquisition of a new NMR spectrometer will complement the departments HPLC, and
LCMS core equipment, providing excellent facilities for synthetic medicinal chemistry.
Newly refurbished laboratories are currently under construction with state of the art
chemical and biological hoods.
We are currently accepting applications for our graduate program in pharmaceutical
sciences. Interested students are encouraged to explore the program website:
www.ttuhsc.edu/sop/graduateprogram. For additional information and questions about
admissions email [email protected].
CHED 182
Designing quantum dot solids for next-generation solar cells
Matt Law, [email protected] of Chemistry, University of California, Irvine,
Irvine, CA 92697-2025, United States
In this talk, I will provide an overview of ongoing efforts to design lead salt quantum dot
(QD) thin film absorbers for next-generation QD photovoltaics, with particular emphasis on
recent accomplishments and future opportunities in this area. Basic requirements for QD
absorber layers include efficient light absorption, charge separation, charge transport, and
long-term stability. I will first discuss several methods used to make conductive QD films by
solution deposition and ligand exchange. Studies of carrier mobility as a function of basic
film parameters such as inter-QD spacing, QD size, and QD size distribution have led to a
better understanding of charge transport within highly disordered QD films. Efforts to
improve carrier mobility by enhancing inter-dot electronic coupling, passivating surface
states, and implementing rudimentary doping will be highlighted. Engineering the inter-QD
matrix to produce QD/inorganic or QD/organic nanocomposites is introduced as a
promising way to optimize coupling, remove surface states, and achieve long-term
environmental stability for high-performance, robust QD films. To obtain large photocurrent
from QD solar cells, it is critical to increase the minority carrier diffusion length to rival the
optical absorption length, possibly by harnessing band-like transport through extended
electronic states. The relative roles of superlattice order, energy disorder, and surface
states in this regard will be summarized. The talk will conclude with comments on the
prospects for controlled doping and rational p-n junction formation in QD systems.
CHED 183
From scientific discovery to commercial success: How great innovators cross this
chasm and achieve a triple play
Kirk Froggatt, [email protected] Leadership Institute, University of
Minnesota, Minneapolis, MN 55455, United States
Scientific expertise is absolutely necessary, but not sufficient to excel as an innovator and
cross the chasm from lab research to commercial success. In this session we will explore
several principles, tools and practices to supplement your technical expertise and help you
navigate the “three C's” of innovation: the broader context (the innovation ecosystem), the
capability required for a commercially viable solution (the business model), and the
collaboration practices necessary to execute the business model successfully. These
principles and practices will be illustrated through case studies where scientific R and D is
translated into innovative solutions with “triple play” results: a win for the customer, win for
the business, and a win for the environment.
CHED 184
Energy and the individual: The artificial leaf
Daniel G. Nocera, [email protected] of Chemistry, Massachusetts Institute of
Technology, Cambridge, MA 02139-4307, United States
This talk will focus on recent advances in developing sustainable and affordable energy
sources for every individual. An "artificial leaf" that is capable of mimicking photosynthesis
has been developed. In the the presence of sunlight, this leaf splits H2O into H2 and O2,
which can be harnessed by a fuel cell for energy production. Inexpensive to manufacture
and produced from Earth-abundant materials, this artificial leaf has great potential for
commercial applications. The transformation of this chemistry to a viable business venture
will illustrate the unique challenges that solar energy technologies face in the marketplace.
CHED 185
Providing international and multicultural perspectives for the education of
undergraduate science students
Morton Z. Hoffman, [email protected] of Chemistry, Boston University,
Boston, MA 02215, United States
How can science undergraduates gain a global perspective? Although they can enroll
directly in a university in another country, there are a number of serious deterrents, such as
language, prerequisites, and calendar. A study abroad experience is another option, but
science students (especially chemistry majors and pre-medical concentrators) have
historically been extremely underrepresented; they do not believe it can be done within
their seemingly inflexible programs of study, the administrative obstacles appear daunting,
and the faculty are not necessarily supportive of the idea. An alternative is to have the
science courses taught in English at a foreign site. The Boston University science study
abroad programs in Dresden, Germany (since Fall 2006), Grenoble, France (since Fall
2009), and Madrid, Spain (since Fall 2012) are models that afford a student the opportunity
to study abroad for a full semester as a science major (e.g., chemistry, biochemistry,
biology, pre-health professions, etc.) while avoiding the common obstacles.
CHED 186
Overview of Macau's tertiary chemical education
Pong Kau Yuen1, [email protected], Diana, Cheng Man Lau2. (1) Faculty of Science and
Technology, University of Macau, Macau (2) Faculty of Management and Administration,
Macau University of Science and Technology, Macau
Education and chemistry are important subject areas which have strong impacts on our life
and our future. Chemical education plays a critical role in fostering students' science
literacy and promoting the sustainable society. Currently Macau is undergoing a series of
education reforms. Nevertheless, the Macau's chemical education is rarely discussed and
researched. The purpose of this paper is to review the development of chemical education
at the tertiary level in Macau, analyze the characteristics of chemistry curriculum and
explore the possible reforms in chemical education.
CHED 187
Establishing a cultural network through chemical education
Patricia Morales Bueno1, [email protected], Carmen Valdez Gauthier2,
[email protected]. (1) Department of Sciences - Chemistry Section, Pontifical
Catholic University of Peru, Lima, Lima, Peru (2) Department of Chemistry, Florida
Southern College, Lakeland, Florida 33813, United States
This paper describes the experiences of two chemical educators who originally met as
undergraduate students in the chemistry program at the Pontifical Catholic University of
Peru (PCUP) in the 1970s and now teach college level chemistry -one in Peru and one in
the United States. The characteristics, strengths and weaknesses of teaching chemistry in
Peru and in the United States will be compared and discussed including the potential
influence of cultural differences on teaching effectiveness. Collaborative efforts to involve
both Peruvian and American students in problem solving exercises using social networking
sites will be discussed. The importance of e-global experiences for students who are not
able to participate in study abroad programs will also be discussed.
CHED 188
Participation of foreign-educated faculty in undergraduate chemistry education
Santiago Sandi-Urena, [email protected], Matthew Sestilio, Todd Gatlin, Adrian VillaltaCerdas.Department of Chemistry, University of South Florida, Tampa, Florida 33620,
United States
Chemistry faculty demographics have changed considerably over the past three decades.
Although minorities and women continue to be underrepresented in faculty positions, the
proportion of foreign-born professors has increased substantially. The diversity that this
brings is celebrated and in terms of research it pays dividends. It also gives students
access to a global perspective that may be beneficial in their professional practice.
However, in most cases these professors have completed their K-16 education in
educational systems substantially different from that in the US and the influence of this
unfamiliarity has seldom been discussed. Moreover, chemistry assistant professors receive
little to no instructional training before immersing in undergraduate education. There is very
little work done to investigate the consequences that unfamiliarity with the system, lack of
training, conflict of expectations, cultural and communication factors and other related
aspects may have on foreign-born professors and undergraduate students' experiences.
This presentation intends to present some data and start a discussion around this topic.
CHED 189
Multicultural perspectives on chemical design
Gabriela A Szteinberg1, [email protected], Steven Cullipher1, Courtney Ngai1,
Hannah Sevian1, Heilen Arce2. (1) Chemistry Department, University of Massachusetts
Boston, Boston, Massachusetts 02125, United States (2) Chemistry Department,
University of Costa Rica, San Pedro, San Jose, Costa Rica
There has been a recent surge of interest in developing learning progressions of central
ideas that can serve as curriculum models and assessment frameworks in educational
settings. The analysis, synthesis, and transformation of chemical substances have many
benefits for modern societies. However, social, political, economic, and environmental
costs and risks need to be taken into account when making decisions involving the
application of chemical design. To explore the role that culture and context may play in
individuals' thinking about chemical design, we have expanded our study of a learning
progression in chemical design with students in an urban university by including students at
a university in Costa Rica. We will present results based on similarities and differences
students from the U.S. and Costa Rica demonstrate when prompted to think and reason
about chemical structure and property relationships, and the benefits, costs, and risks
associated with designing chemical processes.
CHED 190
Who teaches matters: OXIDE's role in advancing multicultural perspectives in
research-active chemistry departments
Shannon Watt, [email protected], Rigoberto Hernandez.School of Chemistry
and Biochemistry, Georgia Institute of Technology, Atlanta, GA 30332-0400, United States
The persistence of undergraduate and graduate students in chemical careers is influenced
daily by the faculty role models who shape their educational and research environments.
While the demographics of the U.S. and student populations are evolving at everaccelerating rates, faculty diversity and the academic culture experienced by individuals
from under-represented groups change at a significantly slower pace. In order to fully
utilize our nation's intellectual capacity, it is critical to establish faculty demographics and
educational environments that not only reflect but also embrace the composition and multicultural realities of our society in terms of gender, race-ethnicity, sexual orientation, and
disability status.
The Open Chemistry Collaborative in Diversity Equity (OXIDE) aims to reduce inequities
that have historically led to disproportionate diversity representation on academic faculties
by leading an ongoing national conversation between chairs of leading doctoral-granting
chemistry departments, representatives from diversity communities, and social scientists
with diversity-related expertise. This presentation will discuss OXIDE's activities, which are
driven by:



social science research;
the chairs' and departments' needs and experiences; and
the demographic data from over 75 leading chemistry departments that are collected
annually by OXIDE and published in Chemical and Engineering News.
CHED 191
Introduction to POGIL and The POGIL Project
Rick Moog, [email protected] of Chemistry, Franklin and Marshall
College, Lancaster, PA 17604, United States
POGIL (Process Oriented Guided Inquiry Learning) is a student-centered, group learning
strategy for teaching chemistry (and other sciences) at all levels. The POGIL Project
(www.pogil.org) is an organization focused on promoting the use of these types of
approaches at both the college and high school levels across the country. This
presentation will introduce the fundamental principles of POGIL, and will describe the
professional development opportunities and curricular materials available from The POGIL
Project.
CHED 192
Process oriented guided inquiry learning (POGIL) in general chemistry: The thrill of
victory and the agony of defeat
Gary D DeBoer, [email protected] of Chemistry and Physics, LeTourneau
University, Longview, TX 75602, United States
Performance and attitudinal outcome measures of the use of POGIL in the general
chemistry classroom are quite varied depending on class size, and student preparation.
Apparent increases in retention were observed when using POGIL versus traditional
lecture in two comparative smaller second semester classes, though class size and student
skill levels were also factors. Attitudinal responses to a non-traditional classroom approach
were positive for the small second semester class. In larger, first semester classes,
performance outcome measures were comparable for POGIL and lecture; however,
attitudinal measures to a POGIL approach were negative. As a result of these findings, a
hybrid approach combining lecture and POGIL activities is now used in both semesters of
general chemistry, with a greater lecture component in the first semester. Performance
outcomes measures for the hybrid approach appear to be consistent with previous years,
and attitudinal responses have been more positive than either a lecture or a POGIL
approach. This presentation will be of interest to any student, faculty, or administrator
interested in classroom pedagogy and retention at the secondary or tertiary level. Go to
<www.letu.edu/people/garydeboer> for more information on the speaker.
CHED 193
POGIL in introductory organic chemistry: Using electron energies to build
understanding of molecular reactivity
R Daniel Libby, [email protected], Moravian College, Bethlehem,
PA 18018, United States
Undergraduate chemistry students learn about electron energies in the context of atomic
structure. However, they next consider electron energies when they deal with quantum
mechanics in physical chemistry. All other energy considerations deal with overall changes
in bulk materials (ΔH or ΔG) for reactions or phase changes. In organic chemistry students
are introduced to “stabilities,” “reactivities” or “electrons availability” in reactions with no
connection to energies of structures. It is not surprising that they develop little sense of how
energies of structures control reactivity. My POGIL approach to intro organic starts with the
atomic energy levels, which are familiar from general chemistry, and helps students use
acid pKa values to judge the relative energies of electrons in molecules. Students can then
readily identify the highest energy electrons in a reaction system and use them to predict
sites of reaction and either relative rates or relative equilibrium constants for reactions.
CHED 194
POGIL and science writing in an interdisciplinary course on climate change
Charity Lovitt, [email protected] of Chemistry, Seattle University, Seattle,
WA 98122, United States
An interdisciplinary course on the chemistry and controversy of climate change was
developed for non-science majors. Students entered the course with a variety of
backgrounds in chemistry which made it difficult to pace material. The POGIL method
proved to be a useful tool for this class because strong students in each group could coach
weak students, allowing the instructor to focus on correcting misconceptions in the class.
Students used the POGIL method of Exploration, Model, Application to understand
chemistry topics of spectroscopy, Lewis structures, and stoichiometry while also using the
method to interpret complex graphs on climate change research. Students learned about
the scientific method by exploring data, creating models, and applying their model to
correct misconceptions in climate change. The culminating project was the creation of a
scientific document to train employees at the local public science center on misconceptions
in climate science.
CHED 195
Pilot POGIL (Process Oriented Guided Inquiry Learning) in CHE 115 General
Chemistry I in a HBCU institution
George H Armstrong, [email protected], Tougaloo College,
Tougaloo, MS 39174, United States
Abstract
Two courses of CHE 115 General Chemistry I were taught simultaneously. One course
was taught using the traditional lecture method and the other course was taught using the
POGIL method. The courses were compared to determine the effectiveness of POGIL in
General Chemistry I. Assessment tools were the American Chemical Society (ACS)
“Toledo Chemistry Placement Examination” (pre-test), the ACT math scores of entering
Fresh Persons, and the ACS test for General Chemistry I (post-test). Relative
performances in General Chemistry I, percent of students passing with a grade of C in
CHE 115, and comparative success of students in General Chemistry II were used to
determine the success of POGIL. Presently, the pilot has run for three semesters. While
the number of students for each course was too small for statistical analysis, the following
trends seem to be apparent: 1) The success of the POGIL students (pass with a grade of C
or higher) is better, and 2) the POGIL students do as well or better in General Chemistry II,
which is taught with the traditional lecture method.
CHED 196
Developing a robust POGIL model to teach the thermodynamics of biochemical
reactions to nursing students
Diane M. Dean, [email protected], Ellen Anderson.Department of Chemistry, University of
Saint Joseph, West Hartford, Connecticut 06117, United States
The inquiry approach to science education has been recommended by the National
Science Foundation (NSF) and the American Association for the Advancement of Science
(AAAS) for several decades. Process-oriented Guided-inquiry Learning (POGIL) is a
pedagogy that was developed to teach introductory chemistry as a response to the
recognized need by NSF and AAAS. It was expanded to biochemistry for major courses in
the last 5 years. Nursing and allied health students constitute a population that has not
benefitted from this pedagogy revolution. Making foundational coursework relevant to the
student through inquiry exercises is critical for retention. The objectives taught include:
describing the thermodynamic reasons for the irreversible reactions in glycolysis. The
model described in this work visually explains the thermodynamic changes that occur
during the ten reactions in glycolysis. Improved retention will enhance the student's ability
to transfer this foundational knowledge to later coursework and professional practice.
CHED 197
Facilitating chemistry using POGIL and student responders
Susanne M Lewis, [email protected] of Natural and Physical
Science, Olivet College, Olivet, MI 49076, United States
In the author's second year of teaching in a tenure-track position, organic chemistry lecture
was converted to Process Oriented Guided Inquiry Learning (POGIL) using the published
materials for this content area. The rational for changing from traditional lecture to POGIL
will be discussed as well as accounts of successes, frustrations, and modifications, and
how student responders (“clickers”) are used to manage the class material.
CHED 198
Computer simulations and guided-inquiry tutorials: The Next Generation Project
Thomas J. Greenbowe1, [email protected], John I. Gelder2, Michael R.
Abraham3. (1) Department of Chemistry, Iowa State University, Ames, IA 50011, United
States (2) Department of Chemistry, Oklahoma State University, Stillwater, OK 74078,
United States (3) Department of Chemistry, The University of Oklahoma, Norman, OK
73019, United States
Computer simulations, if properly integrated into an instructional module, can potentially
provide teachers with a powerful teaching tool. The Next Generation Computer Simulation
Project integrates the use of computer simulations with guided-inquiry tutorials. "Before",
"During", and "After" class activities and tutorials are being used to help teachers identify
topics students find difficult and can help students gain a better understanding of concepts.
One purpose of the tutorials is to help students develop a model of a system. A model can
be used to help students explain and predict behavior of matter. Using a learning cycle,
students can improve their model and understanding of the chemical concept. Computer
simulations can help students structure and to carry out an experimental design to answer
a question. Students can work in groups to quickly collect, analyze, and graph data. The
pooled data and graphs can help students see a pattern. Instructors can introduce the
concept. Students can do a problem incorporating a higher-level application of the model.
Thus, the learning cycle plays a central role in uniting a computer simulation with a
specially designed tutorial. Computer simulations can also include visualizations of the
behavior of matter at the particulate level. A beta version of an electrochemistry computer
simulation will be presented along with an example of how a computer simulation
accompanied by a POGIL-like tutorial can help students gain a better understanding of
electrochemistry.
CHED 199
AP Chemistry 2013 and Beyond incorporates a guided-inquiry approach in the
classroom and in the laboratory
Marian L. DeWane2, [email protected], Thomas J. Greenbowe1. (1) Department of
Chemistry, Iowa State University, Ames, IA 50011, United States (2) Department of
Extension, University of California - Irvine, Irvine, CA 92697, United States
The AP Program has spent several years reviewing and redesigning the AP Chemistry
Curriculum. This new course focuses on student understanding of chemistry while
simultaneously developing students' analytical reasoning and inquiry-based skills. AP
inquiry instruction incorporates any teaching method designed to encourage students to
construct and to discover knowledge with an understanding of how scientists study the
natural world. AP lab investigations align with best practices described in America's Lab
Report, which promotes a student involvement, inquiry-based design. The teacher edition
of the new AP Chemistry lab manual and a special Curriculum Module on implementing
Guided-Inquiry in the Classroom will be available in 2013. This presentation will outline the
content of these two new resources. Similarities and differences between the AP Chemistry
approach and the POGIL/SWH approaches will be discussed.
CHED 200
Helping students succeed in organic chemistry with peer-evaluated presentations,
study baskets, and social media
Ekaterina N. Kadnikova, [email protected] of Chemistry, University of
Missouri - Kansas City, Kansas City, Missouri 64110, United States
I will share my experiences with “Elementary Organic Chemistry,” a one-semester
comprehensive course designed for students in the six-year BA/MD program. One of my
goals is to teach future doctors to understand and appreciate the fundamental role of
organic chemistry in modern medicine. Thus, “Molecules-in-Medicine” unit provides the
students with an overview of pharmaceutical and medicinal chemistry and their role in drug
development. It culminates in student presentations on the organic chemistry of smallmolecule drugs. This unit allows students to discover for themselves how far they have
grown in this course. Peer-reviewing each other's presentations is another unique
experience. Success of this endeavor ignited my interest in further innovations. “Study
baskets” filled with workbooks are now available for check-out at the library and at the
dorms. Finally, using social media as a teaching tool proved to be a great success. Our
Facebook discussion group has been very popular with students.
CHED 201
Flipped organic chemistry classroom at a small comprehensive college: Organic
chemistry upside down
Jessica M Fautch, [email protected] of Physical Sciences, York College of
Pennsylvania, York, Pennsylvania 17403, United States
The “flipped” classroom is an approach to teaching that involves active learning while
increasing student responsibility and improving comprehension. The flipped, or inverted,
model takes traditional lecture from in-class to outside the classroom in the form of online
lectures or tutorials. Work traditionally completed as homework is carried out through
engaging group activities and instructor-guided problems during class. Techniques used to
flip an undergraduate organic chemistry course, including “vodcast” lectures, electronic
homework, and “warm-ups”, are discussed. In-class discussion and problem-solving are
also investigated as means to facilitate deeper learning of organic chemistry. Student
learning outcomes in a flipped organic chemistry course are predicted to include efficient
problem solving skills and the ability to verbally explain the material to one's peers. When
an inverted classroom model is applied to organic chemistry, we anticipate increased
comprehension and retention of the material, as well as improved performance on
summative assessments (exams).
CHED 202
Reducing lecture and increasing impact in an organic I course: Design and
assessment
Kimberly Cossey, [email protected] of Chemistry and Physics,
Georgia College & State University, Milledgeville, GA 31061, United States
Imagine an organic chemistry classroom where instead of listening to a lecture, students
are leading a discussion based off their readings. Imagine students studying, but instead of
making flashcards and lists, they are engaging in complex problems and devising
strategies to complete them. This vision was used to design my current organic I course.
Using backward course design, an organic I course has been restructured so that rather
than lecturing over every concept, the professor helps students to prioritize concepts,
provides problem solving strategies, and fills-in key details as needed. Active learning
strategies (adapted from POGIL and PBL methods) have been used to engage students in
critical thinking and application tasks. Assessment will focus on traditional outcomes (e.g.
solving synthetic and mechanistic problems), as well as secondary outcomes, such as
critical reading. This talk will focus on the design and initial assessment (1 class section) of
the course.
CHED 203
Pedagogical focus for training peer leaders to improve comprehension in organic
chemistry
Connie Gabel, [email protected] of Chemistry, Metropolitan State
University of Denver, Denver, Colorado 80217, United States
Peer leaders receive instruction on how to lead group study sessions for organic chemistry
using a constructivist framework. Dynamic interactions between students as well as with
the peer leader encourage participation among the students. Peer leaders are selected
based on their command of organic chemistry in addition to their ability to interact well with
peers in a group study setting. The peer leaders are taught the importance of using neural
scaffolding to help control student frustration when learning organic chemistry concepts.
Another key technique incorporated in training peer leaders is learning to initiate the
construction of knowledge using the Socratic method. Working problems on the board and
in small groups helps students to solve problems beyond the zone of proximal
development with the assistance of a more capable peer. These methods facilitate the
creation of a scholarly learning community for improving comprehension in organic
chemistry. Results indicate a significant difference.
CHED 204
Indicators of success in organic chemistry
Kevin M. Bucholtz1, [email protected], Mark F. Owens2. (1) Department of
Chemistry, Mercer University, Macon, GA 31204, United States (2) Department of
Economics and Finance, Middle Tennessee State University, Murfreesboro, TN 37132,
United States
A student's success in organic chemistry is a complex and multi-faceted problem that has
many variables for whether a student succeeds or subscribes to the “weed out” reputation
of the course. The course is challenging for many students because of the difficulty of the
material and the traditionally qualitative foundation of the curriculum. A variety of statistical
methods have been used to analyze six years of data from a single institution to better
understand these variables. The data identifies indicators of student success from the
organic chemistry course, the chemistry curriculum as a whole and pre-college
performance. With this data, it has provided the foundation to enhance and improve
pedagogical approaches in organic chemistry.
CHED 205
Engaging students in publishing on the internet early in their careers
Antony J. Williams1, [email protected], Valery Tkachenko1, Colin Batchelor2, David
Sharpe2, Jon Steele2. (1) Cheminformatics, Royal Society of Chemistry, Wake Forest, NC
27587, United States (2) Cheminformatics, Royal Society of Chemistry, Cambridge, United
Kingdom
As a result of the advent of internet technologies supporting participation on the internet via
blogs, wikis and other social networking approaches, chemists now have an opportunity to
contribute to the growing chemistry content on the web. As scientists an important skill to
develop is the ability to succinctly report in a published format the details of scientific
experimentation. The Royal Society of Chemistry provides a number of online systems to
share chemistry data, the most well known of these being the ChemSpider database. In
parallel the ChemSpider SyntheticPages (CSSP) platform is an online publishing platform
for scientists, and especially students, to publish the details of chemical syntheses that
they have performed. Using the rich capabilities of internet platforms, including the ability to
display interactive spectral data and movies, CSSP is an ideal environment for students to
publish their work, especially syntheses that might not support mainstream publication.
CHED 206
Evaluation of photo-induced crosslinking of thymine polymers using FT-IR and
chemometric analysis
Kris McDonough1, [email protected], Rebecca Koelln1, Kiara Dupuy1, Jennett
Chenevert1, Getey Anwar1, Monica Khun1, Caroline Coughlin1, Deepa Kumarjiguda1,
Santiago Bortolato2, Debora Martino2, Rich Gurney1. (1) Department of Chemistry and
Physics, Simmons College, Boston, MA 02115, United States (2) Instituto de Desarrollo
Tecnológico para la Industria Química (INTEC) (UNL -CONICET), Santa Fe, Santa Fe
S3000GLN, Argentina
In recent years there has been a great interest in the design and construction of micro and
nanostructures having functional responses to external stimulus, such as pH, temperature
and light, especially for use as microsensors and controlled release systems.
Copolymers containing thymine residues 4-vinylbenzyl thymine (VBT) and ionic styrene
derivative 4-vinylbenzyl triethyl ammonium chloride (VBA) of varying compositions were
evaluated. Comparable to naturally-occuring DNA chains, UV irradiation induces the
formation of cyclobutane dimers between neighboring thymine residues, resulting in threedimensional crosslinking of copolymer chains. The photo-dimerization kinetics for the
copolymers have been investigated using grazing-angle specular-reflectance FourierTransform infrared spectroscopy, complemented by Multivariate Curve ResolutionAlternating Least Squares (MCR-ALS) methods. The study allows the sequential
estimation of the contribution to the total signal due to different species, which can be used
to calculate the crosslinking rate.
CHED 207
Impact of alkyl group on aggregation and fluorescence quenching for a homologous
series of squaraines targeted for photovoltaic devices
Victor M Murcia1, [email protected], Susan D Spencer2,3, Bi Zhu1, Brandon Cona1, Patrick
Heaphy1, Jeremy A Cody1, Christopher J Collison1,2,3. (1) School of Chemistry and
Materials Science, Rochester Institute of Technology, Rochester, New York 14623, United
States (2) Microsystems Engineering, Rochester Institute of Technology, Rochester, New
York 14623, United States (3) NanoPower Research Laboratory, Rochester Institute of
Technology, Rochester, New York 14623, United States
Squaraines offer a small molecule alternative for spectral harvesting in the near infrared
region of the solar spectrum, where there exists a large supply of photon density that can
be leveraged in tandem organic photovoltaic devices. Squaraine molecules exhibit
panchromaticity, high extinction coefficients and a high stability to oxidation, and therefore
have stimulated recent high levels of investigation. We study a series of squaraines
synthesized in our group, where there are some molecular packing anomalies in the solid
state, which we propose will impact the efficiency of organic solar cells. We demonstrate
that the packing geometry of di-hydroxy-anilinic squaraines may depend predominantly
upon the branching at the second carbon on the alkyl sidechains. We provide supporting
evidence along with the power conversion efficiency data, which points towards new
strategies for improving device efficiencies.
CHED 208
Chemical treatment of wastewater from a leather tanning facility
Jessica S George, [email protected], Heather J Shipley.Civil and
Environmental Engineering, University of Texas at San Antonio, San Antonio, TX 78249,
United States
The process of leather tanning produces harmful pollutants. In order to meet regulatory
standards, this study explored chemical treatment methods to successfully and efficiently
reduce the concentrations of harmful pollutants in the wastewater. Multiple wastewater
streams representative of various stages in the tanning and wastewater treatment
processes were initially characterized and subsequently treated through means of chemical
coagulation and adsorption. Through a series of jar test experiments, use of multiple
industry-grade polymers as chemical coagulants greatly reduced chromium concentrations
and turbidity levels. The wastewater streams were also subjected to adsorption
experiments to see chromium and nitrogen removal efficiency of metal oxide nanoparticles
and activated carbon at varying concentrations over a 24hr period. Though poor adsorption
of chromium occurred by both the nanoparticles and activated carbon, the activated carbon
was successful in reducing nitrogen levels by over 90%. Having tested different methods
for wastewater treatment, the use of polymers as coagulants was deemed the most
successful at removal of chromium and improvement in clarity.
CHED 209
How much caffeine is in your cup? Quantifying caffeine for a local coffeeshop
Katie M. Fredo, [email protected], Kimberly Cossey.Department of Chemistry,
Physics, and Astronomy, Georgia College and State University, Milledgeville, Georgia
31061, United States
The primary goal of this research is to determine the amount of caffeine in coffee from a
local coffee shop in Milledgeville, Georgia. Blackbird Coffee coffee shop has requested
information on the caffeine content in their products to report to their consumers. Caffeine
is a stimulant and is most commonly consumed through coffees and teas. Even though
caffeine content can vary widely based on various factors (the brewing methods used, the
acidity of the coffee, etc.), consumers want to know how much caffeine they consume. In
this research, liquid-liquid extraction was used to separate the caffeine from the other
contents found in coffee. The extracted caffeine was characterized via 1H-NMR
spectroscopy to confirm that caffeine was extracted and to analyze the purity of the
caffeine. The mass of the recovered caffeine was recorded and compared to caffeine from
commercial products.
CHED 210
Motivating students to persist in general chemistry: A potential solution
Amanda F Cook1, [email protected], Lisa C Duffin2, Martha M Day1. (1)
Department of SKyTeach, Western Kentucky University, Bowling Green, Ky 42101, United
States (2) Department of Psychology, Western Kentucky University, Bowling Green, Ky
42101, United States
The purpose of this study was to examine the self-efficacy beliefs and attitudes towards
general chemistry in a sample of (n = 1,126) first-time, first-year freshmen from a large
comprehensive university in the Mid-South. The following research questions were
examined: 1) how well do self-efficacy beliefs for general chemistry and attitudes toward
chemistry predict intentions to take future chemistry courses?, 2) which is the best
predictor of intentions; self efficacy for general chemistry or attitude toward chemistry?, and
3) If other known factors that influence intentions (i.e., past experiences, past
performances, and choice of major) were controlled, is self-efficacy for general chemistry
and attitude toward chemistry still able to predict a large amount of the variance in
intentions to take future chemistry courses? Findings from the regression analyses with
statistical significance will be presented and implications for science educators and STEM
administrators will be discussed.
CHED 211
Pre-service teacher impacts from working in a peer tutoring center
Mary C Martin1, [email protected], Janice Hall Tomasik1, Debra Linton2, Anthony
Feig3. (1) Department of Chemistry, Central Michigan University, Mount Pleasant,
Michigan 48858, United States (2) Department of Biology, Central Michigan University,
Mount Pleasant, Michigan 48858, United States (3) Department of Geography, Central
Michigan University, Mount Pleasant, Michigan 48858, United States
The Peer Assistance Center (PAC) is a chemistry tutoring center open to all students in
100-level chemistry courses. The tutors hired for the PAC are pre-service teachers who
have completed a training session taught by the PAC advisors. Qualitative data collected
by an interview of four of the PAC tutors will be discussed. This interview revealed parallels
between the concepts tutors help students with and the content for Teacher Preparation
and the Michigan Teacher Training Certification. Additionally, PAC tutors report the center
helps them practice different teaching methods and build a rapport between students and
faculty.
CHED 212
Rewards and challenges of an academic career in predominately undergraduate
teaching institutions: A fifteen year, three-university retrospective
Donna K Howell, [email protected] of Natural and Physical Sciences,
Park University, Parkville, MO 64152, United States
The presenter, a tenured faculty member at Park University in the Department of Natural
and Physical Sciences currently serving as department chair, will reflect over the course of
her career spanning 3 very different primarily undergraduate institutions -- public and
private, secular and non-secular, strong research focus and predominantly teaching focus.
Comparisons and contrasts between the three institutions will be drawn in order to give
individuals considering an academic in this venue a full understanding of the demands of
the field.
CHED 213
Career advancement as adjunct faculty
Charity Lovitt, [email protected] of Chemistry, Seattle University, Seattle,
WA 98122, United States
Over 40% of college academic faculty in the US college system are non-tenure track
faculty, many of whom are adjunct faculty on short-term contracts.It is expected that this
number will increase. This paper will describe ways to obtain professional development
while adjunct faculty. It lists strategies for dealing with rejection and uncertainty while
pursuing an active career. It will discuss strategies for dealing with the two-body problem
(two specialized professions, one couple). It is important to be flexible in career options, to
keep learning new skills because it is never known when a job may open up that needs
that expertise.
CHED 214
Maneuvering the path of academic fulfillment: The search, tenure, and promotion
process
Joy J. Goto, [email protected] of Chemistry, California State University,
Fresno, Fresno, California 93740, United States
We often try to match our inner goals of academic success with the outer expectations of
the search, tenure, and promotion process. In most cases, the path you take in your
academic job search is a winding road that leads to a meeting point where one begins their
tenure-track position as an assistant professor. I will describe the job search process and
retention, tenure, and promotion (RTP) plan at a four-year public university with a M.S.
research program. I can offer the perspective of one that has sanely managed the RTP
process and come out on the other side both elated and satisfied with the journey. I will
also add insight into what search committees seek in potential colleagues at the universitylevel. I hope to ease the process and relate my story in the hopes of making the road
easier to traverse.
CHED 215
Effective practices in teaching and mentoring: How to teach better, save time, and
have more fun
Penny J Beuning1, p.beun[email protected], Scott A Snyder2, Dave Z Besson3. (1)
Department of Chemistry and Chemical Biology, Northeastern University, Boston, MA
02115, United States (2) Department of Chemistry, Columbia University, New York, New
York 10027, United States (3) Department of Physics and Astronomy, University of
Kansas, Lawrence, Kansas 66045, United States
Faculty members at research universities face many challenges in establishing themselves
as effective teachers, researchers, and mentors. Early in faculty careers, precious time can
be lost to reinventing the wheel in teaching and mentoring. Many new faculty tend to spend
too much time on teaching duties and spend too little time on scholarly work (Felder 1998
Chem Eng Ed v32 p46), which can lead to feelings of isolation and dissatisfaction. New
faculty in the physical sciences face particular challenges, as they often teach large lecture
classes, which may also be required courses for non-majors. We are surveying Cottrell
Scholars, who are a group of faculty identified for their commitment to integrating research
and education, to identify effective practices in teaching and mentoring. This work will be
made available to new faculty as a book and on-line to help new faculty teach better and
enjoy the experience more.
CHED 216
Developing a research program at a community college
James Mendez, [email protected] of Liberal Studies and
Education, Sowela Technical Community College, Lake Charles, Louisiana 70616, United
States
The prospect of establishing a research program at any level can be daunting; however,
community colleges present a unique set of opportunities and challenges. After graduate
school, the prospect of working in industry or two years in a lab as a postdoc were not
appealing, leading me to apply for instructor positions. With absolutely no research, I did
not plan to stay long at Sowela Technical Community college when I started two years ago.
After a few months though, I realized that these students were just as interested in learning
and research as any traditional 4-year student. The limiting factors for these students were
the lack of faculty interested in research along with no infrastructure. Both local and state
grants have improved our infrastructure and simultaneously encouraging further faculty
involvement. While not easy, developing a research program at a community college can
be rewarding for faculty as well as students.
CHED 217
More than teaching and research: Early career experiences at a teaching-intensive
liberal arts college
An-Phong Le, [email protected] of Chemistry and Physics, Florida
Southern College, Lakeland, Florida 33801, United States
Florida Southern College is a regional liberal arts college affiliated with the United
Methodist Church and is particularly focused on teaching and engaged learning. I will
discuss my experiences as a second year faculty member in a young department which is,
in many ways, in transition. I have been heavily involved in departmental and college-wide
efforts to grow and support the natural sciences and to increase research activity.
Particular mention of faculty duties outside those traditionally associated with teaching and
research will be made, and I will offer additional perspectives from having already been
involved with three faculty searches.
CHED 218
Life on the Hill: Early career experiences at Seton Hill University, a teaching oriented
liberal arts university
Diana Hoover, [email protected] of Natural and Health Sciences, Seton Hill
University, Greensburg, PA 15342, United States
The “day in the life” of an assistant professor of chemistry at a liberal arts university with a
strong teaching focus will be shared. Seton Hill University is a Catholic, liberal arts
coeducational university with approximately 2000 students located near Pittsburgh,
Pennsylvania. The teaching, scholarship, and service expectations at this type of university
will be defined, with particular emphasis given to personal experiences in undergraduate
research mentorship and teaching.
CHED 219
Adventures from the hunt, setting up camp, and forging a new trail: Postcards from
the strange land of Academia
William A Alexander, [email protected] of Chemistry, The
University of Memphis, Memphis, TN 38152, United States
In this presentation, I will share perspectives gained while hunting for an academic
position, and during my successful adventures interviewing at a variety of institutions
ranging from small four-year PUIs to large research universities. Similarities and
differences between the interview processes at the various institutions will be highlighted,
and insightful opinions will be offered to aid job-seekers in their pursuits.
I will also report on my first-year experiences managing classroom instruction and
establishing my research group at The University of Memphis, a learner-centered
metropolitan research university which serves a diverse population of over 18,000
undergraduate and 4,000 graduate students. The Department of Chemistry at U of M
currently consists of two dozen faculty, who serve over fifty graduate students (PhD and
MS) and hundreds of undergraduates, graduating about two dozen chemistry majors per
annum. I will delineate how my expectations coming into the position have shaped up with
reality.
CHED 220
Sunshine and maple syrup: Early years for chemistry faculty at the University of
Vermont
Rory Waterman, [email protected] of Chemistry, University of
Vermont, Burlignton, VT 05405, United States
With the smallest state allocation per capita in the country, UVM is a flagship state
research university that operates very much like a private research-intensive university.
Therefore, it is somewhat surprising that the institution has always had a small chemistry
faculty (currently 11 tenure/tenure track), especially given the undergraduate teaching load
of ~3500 students per year. Though stated effort distribution of 40:40:20 teaching to
research to service might be skewed under these numbers, the department works to
maintain relatively low teaching loads within contract-mandated stipulations. Despite (or
perhaps because of) these factors, UVM chemistry ranked higher than “peer” institutions in
many research productivity indicators (publications per year, etc.) in the most recent NRC
rankings. Within those numbers a supportive, a collegial atmosphere has led to success for
many junior faculty at UVM.
CHED 221
Strive and thrive in academic career: An example of early-career faculty in
environmental engineering
Venkataramana Gadhamshetty, [email protected] and Environmental Engineering,
Rensselaer Polytechnic Institute, Troy, New York 12180, United States
The presentation provides an overview on the experience of early-career teaching faculty
at Rensselaer Polytechnic Institute. The first half of the presentation will be geared on
basic information about RPI- students, faculty, research facilities, and campus. The second
half of the presentation will revolve around faculty's experiences (broadly defined) during
his three years of stay at RPI. The presentation will include information on the
demonstrated strategies to introduce research education to undergraduates during their
early career.
CHED 222
Addressing global challenges in sustainability through catalysis
Melanie S. Sanford, [email protected] of Chemistry, University of
Michigan, Ann Arbor, MI 48109, United States
This talk will describe basic research efforts aimed at addressing global
challenges in sustainability via catalysis. These efforts are supported by the NSF
Center for Enabling New Technologies through Catalysis (CENTC). Topics will
include developing more energy efficient catalytic routes to fuels, commodity
chemicals, and fine chemicals as well as methods for the catalytic reduction of
carbon dioxide.
CHED 223
Systematic development of an artificial solar-fuel generation device
Nathan S. Lewis, [email protected] of Chemistry and Chemical
Engineering, California Institute of Technology, Pasadena, CA 91125, United States
Addressing the world's energy challenges will require cost-competitive, globally scalable
technologies for fuel production that minimize impact on the environment. Despite decades
of research focused on understanding and improving the efficiencies of natural
photosynthesis, the energy conversion efficiencies of the most productive biofuel crops
remain too low for mass industrialization of bioenergy. The Joint Center for Artificial
Photosynthesis (JCAP) focuses on an alternative approach that aims to produce chemical
fuels from sunlight, water, and carbon-dioxide using an engineered, non-biological device
that is cost-effective, robust, and efficient. Research at JCAP involves the development of
core technologies for artificial solar–fuels generation, including directed and combinatorial
methods for the discovery of light-absorbing, semiconductor-based materials and watersplitting and carbon dioxide reducing catalysts, the design of ion-permeable, gasseparating membranes, and methods for efficiently integrating and assembling these
components into fully functional prototypes. Recent discoveries in JCAP have led to
significant advances towards commercially viable, solar-fuel producing systems.
CHED 224
Comparative study of undergraduate chemistry curricula and teaching in India and
USA
Anil C Banerjee, [email protected] of Chemistry, Columbus
State University, Columbus, GA 31907, United States
A comparison of typical undergraduate chemistry curricula followed in India and USA
shows difference in requirements and perspectives. Four-year liberal arts concept is
followed in USA with about 60% course load in chemistry in a typical BS professional
degree track. In India, the BS chemistry program is for three years and students study
mainly chemistry with two physics and three mathematics courses. There are no general
chemistry requirements. The general methodology for lecture courses is similar. But the lab
courses are more rigorous in India with 4-5 hours lab all five days in a week throughout the
whole academic year. The focus is problem solving, skill development and quantification. In
USA, undergraduate research is an important part, while this is almost missing in a BS
chemistry program in India. Undergraduate education is offered in colleges affiliated to a
university, with curriculum and exams being controlled by the affiliating university.
CHED 225
Research and teaching abroad: Contrasting chemical education in Brazil and the
United States
Brian G McBurnett, [email protected] of Chemistry, University of the
Incarnate Word, San Antonio, Texas 78209, United States
This presentation involves observations and experience gained from a semester of
teaching and research in Brazil. As a Fulbright Scholar, the presenter taught an
undergraduate inorganic class and participated in research at a private university in Rio de
Janeiro. Challenges of teaching and living abroad will be discussed. This presentation will
focus on a comparison of the pedagogical and cultural differences between institutions in
the United States and Brazil with the objective of facilitating future collaborations.
CHED 226
Molecules of life: Introducing chemistry into the culture of elementary school
education by way of experiential learning using experiments and art projects
William D. Lubell, [email protected]épartement de chimie, Université de
Montréal, Montréal, Québec H3C 3J7, Canada
Recognizing that chemistry has been traditionally poorly represented in the culture of
elementary school education, Molecules of Life (MoL: www.moleculesoflife.ca) was
launched in Canada to expose elementary school students to chemistry by way of
experiential learning using experiments and art projects. Currently in its sixth year, MoL
recruits university art and science student volunteers, who have teamed up to produce and
deliver presentations in English and French at elementary schools in Halifax and Montreal.
Over 40 different projects featuring molecules of life have been created and taught by MoL
volunteers employing discussion, experiments and art to captivate the interest of the
elementary school students. Moreover, to enhance impact, MoL has recently begun to
produce educational videos with the debut of "How to teach 3rd graders about chlorophyll".
In this entertaining and informative video, two volunteer actors, students from the arts and
sciences, Ms. Molecule and Ms. Life discuss and demonstrate the elements necessary for
the set-up, performance and interpretation of a MoL class on the green pigment from plants
responsible for photosynthesis. Describing how to extract the pigment from spinach and
showing how to use the pigment for painting, they cover a variety of subjects from
scientific, historical and artistic perspectives. Our presentation will highlight MoL efforts and
issues in bringing chemistry into the culture of the elementary school classroom by way of
experiential learning.
CHED 227
Integration of faith and chemistry: Mission field “solutions”
Christopher T Jones, [email protected] of Arts and Sciences, BrewtonParker College, Mount Vernon, Georgia 30445, United States
A model for presenting the traditional concepts of solution chemistry to
undergraduates in the context of water quality on the Christian mission field will be
examined. This model can be used to cover the required information in the same
amount of class time while making the topic relevant to students at a faith-based
institution of higher education. This model can be used to bridge the gap between
the academic discipline of chemistry and an institution's mission statement that
encourages the integration of faith and learning.
CHED 228
Pharmacy technician curriculum within a high school health science academy:
Where's the chemistry?
Sean P. Madden, [email protected] Technician Program, Greeley
District 6 Health Science Academy, Greeley, CO 80631, United States
The ACS Guidelines and Recommendations for the Teaching of High School Chemistry,
(2012) acknowledges that high school students of diverse backgrounds may be exposed to
the "big ideas" of chemistry in a variety of contexts. This presentation serves as a case
study for how such learning takes place within the Greeley District 6 Pharmacy Technician
Class, which is one component of the Greeley Central High School Health Science
Academy; sponsored by Banner Health Systems and North Colorado Medical Center.
CHED 229
What are POGIL labs and how are they different?
Frank J. Creegan, [email protected] of Chemistry, Washington
College, Chestertown, Maryland 21620, United States
What distinguishes a POGIL laboratory from a traditional laboratory? What is unique about
the POGIL laboratory text material? How does POGIL lab work relate to lecture content?
How does student laboratory work in a POGIL setting differ from that in conventional
approaches? What role does the instructor play in the POGIL laboratory experience? What
are the criteria for POGIL lab experiments? Specific POGIL experiments and experiment
outcomes will be used to answer these and other questions about using Process-Oriented
Guided Inquiry Learning in the chemistry laboratory.
CHED 230
Development and implementation of guided inquiry experiments for physical
chemistry
Alexander Grushow1, [email protected], Sally Hunnicutt2, Robert Whitnell3. (1)
Department of Chemistry, Biochemistry & Physics, Rider University, Lawrenceville, NJ
08648, United States (2) Department of Chemistry, Virginia Commonwealth University,
Richmond, VA 23238, United States (3) Department of Chemistry, Guilford College,
Greensboro, NC 27410, United States
The NSF-funded POGIL-PCL project implements the principles of Process Oriented
Guided Inquiry Learning (POGIL) in order to improve student learning in the physical
chemistry laboratory (PCL) course. POGIL principles are being used to develop inquirybased physical chemistry experiments that emphasize macroscopic and molecular models
of chemical phenomena. We will briefly describe physical chemistry experiments that are
under development in areas such as chemical kinetics, solvent effects on chemical
equilibria, phase transition behavior, thermodynamics, spectroscopy, and computational
chemistry. We will also describe the community of instructors who are collaborating on
generating and using POGIL-PCL experiments. This presentation will discuss the general
structure of a POGIL physical chemistry experiment with specific examples that are
currently being tested with students and give an overview of future workshops in which
interested physical chemistry laboratory instructors can become involved in the POGILPCL project.
CHED 231
Enriching infrared spectroscopy learning through inquiry-based activities
Sarah A Winget, [email protected], Ruth E Riter,
[email protected] of Chemistry, Agnes Scott College, Decatur, GA 30030,
United States
Problem-based (PB) laboratory experiments linked to process-oriented guided-inquiry
learning (POGIL) activities for student learning of Fourier-transform infrared (FTIR)
spectroscopy in analytical and physical chemistry are being developed, implemented and
evaluated in a project funded by an NSF TUES Type I grant (#1140391). The POGIL
activities will focus on student understanding of key IR spectroscopic concepts. The PB
laboratory experiments will provide students with hands-on opportunities to explore
fundamental techniques and measurements, including attenuated total reflectance (ATR)
spectroscopy, as well as investigate advanced topics such as the characterization of
surfaces. All activities and laboratory experiments will be peer reviewed and classroom
tested through The POGIL Project. These novel resources will be designed as selfcontained modules that may be used in any upper-level undergraduate course by any
practitioner wishing to use active learning methods to study FTIR spectroscopy and/or
fundamental principles illustrated by FTIR spectroscopy.
CHED 232
Making the Science Writing Heuristic work
Dawn Del Carlo, [email protected] of Chemistry and Biochemistry,
University of Northern Iowa, Cedar Falls, IA 50614, United States
Educators often try to implement new methods and approaches into their teaching but,
when faced with inevitable challenges, tend to either abandon the new approach or “tweak”
it to something more comfortable, but also, not much different from what they were doing
before. This presentation will discuss the basic tenets of the Science Writing Heuristic
(SWH) that make it what it is (and consequently, should not be “tweaked”), what elements
afford a bit more flexibility, and how they fit together. Specific strategies for modifying
existing lab experiments, report format, and student tasks while in laboratory will be
presented.
CHED 233
POGIL-Science Writing Heuristic (SWH) hybrid experiments for teaching concepts in
introductory organic laboratory
R Daniel Libby, [email protected], Moravian College, Bethlehem,
PA 18018, United States
For the last four years, I have been using hybrid POGIL/SWH experiments in my
introductory organic laboratory. My approach helps students learn fundamental concepts,
data processing skills and scientific writing skills while they are acquiring laboratory
techniques. Each experiment starts with a question and requires students to propose types
of laboratory data to answer it; students also submit an electronic pre-lab assignment to
assess their understanding of concepts relevant to the question. In a pre-laboratory
discussion students develop a general experimental plan. They then receive a workable
procedure for collecting the required data. In the laboratory each student individually
collects part of the data. Class data are pooled electronically and a post lab discussion
helps the students explore various ways to organize and interpret the total data set in
preparation for writing a detailed report. The presentation includes my two-semester lab
syllabus and a detailed discussion of one specific experiment.
CHED 234
Implementing student roles in the general chemistry laboratory: Student-led
instructor-facilitated guided-inquiry based laboratory (SLIFGIL)
Tanya Gupta1, [email protected], Thomas J. Greenbowe2, Kathy A. Burke2. (1)
Department of Chemistry, Grand Valley State University, Allendale, MI 49401, United
States (2) Department of Chemistry, Iowa State University, Ames, Iowa 50011, United
States
Previous researchers have demonstrated that students who experienced the Science
Writing Heuristic (SWH) approach (a type of guided-inquiry based laboratory instruction)
performed academically better than students receiving non-SWH or more traditional
laboratory instruction. In the present study implementation of the SWH approach is
extended further, with students leading the laboratory session, facilitated as needed by
their laboratory instructor. Students are assigned various roles as “experts” that are
consistent with components of the SWH approach. Roles include beginning questions
expert, safety expert, data table expert, claims expert and evidence and analysis expert.
Implementation of student roles in accordance with the SWH approach necessitates a
learner-centered classroom environment and accountability on the part of the students.
This study was based on a mixed-methods research design. Results of the study indicate
that students who were involved in group roles consistent with the SLIFGIL teaching
approach performed statistically significantly better on hour exams and laboratory practical
exams as compared to students in SWH format laboratories that were facilitated solely by
an instructor. Among students in the SLIFGIL group approach there was an increased
amount of student-student interaction, a higher level of student preparedness, a superior
understanding of the SWH format, and an improved general overall understanding of the
concept of the laboratory activity. Further, students produced higher quality writing as a
result of undertaking student roles.
CHED 235
Use of an SWH experiment as the model for a POGIL classroom activity
Brandon M Fetterly1, [email protected], Kathy A Burke2, Thomas J
Greenbowe2. (1) Chemistry, University of Wisconsin-Richland, Richland Center, WI 53581,
United States (2) Chemistry, Iowa State University, Ames, Iowa 50011, United States
The use of models to build student understanding distinguishes a classroom utilizing
POGIL from traditional classrooms. In current published activities, models are presented to
students through written material or printed figures. In order to better link lab and lecture
content, the observations gained in an exploratory laboratory experiment utilizing the
Science Writing Heuristic are used to build the model for a POGIL classroom activity in the
following session. This methodology will be shown using observations from a qualitative
analysis experiment to build a model for an activity on double replacement reactions.
CHED 236
Using the science writing heuristic in an upper-level laboratory
Caryl Fish, [email protected], Steven Gravelle.Department of Chemistry,
Saint Vincent College, Latrobe, PA 15650, United States
In an upper-level chemistry laboratory that includes project-based laboratories from both
instrumental analysis and physical chemistry, we have used the science writing heuristic
(SWH) as the guiding principle for both project design and student written reports. Students
turn in proposals for each project that address their beginning questions and develop a
method to answer those questions. In their reports students must address the beginning
questions, make a claim that answers their question, provide evidence from their data that
supports the claim, and then interpret their results based on some outside reading. Student
learning was evaluated using primary trait analysis, and coding the reading and reflection
section of the lab reports for process skills like information processing and critical thinking.
CHED 237
Incorporating the Science Writing Heuristic across the chemistry curriculum
Steven J Gravelle, [email protected], Matthew A Fisher.Department of Chemistry,
Saint Vincent College, Latrobe, PA 15650, United States
The Science Writing Heuristic (SWH) has been used in many of the chemistry major
laboratory courses at Saint Vincent College since 2005. These courses range from
freshman-level General Chemistry to our junior-level Advanced Physical Methods. We
have incorporated it across a broad range of courses because (1) it is a “writing to learn”
strategy that helps our students to focus on the science underlying the laboratories, (2) it
provides a more inquiry-based structure in our laboratories and (3) it helps the students
develop the habits of mind necessary for developing a successful senior research project.
We will provide examples of ways that we emphasize different components of the SWH in
the various laboratory courses to help the students evolve in their approach to scientific
thinking and problem solving. We will also briefly describe how the use of the SWH has
impacted our senior research program.
CHED 238
Arrowpushing in inorganic chemistry: Charting the limits of the approach
Steffen Berg, [email protected], Abhik Ghosh, [email protected]
of Chemistry, University of Tromsø, Tromsø, Norway
While a mechanistic approach ("arrowpushing") is universally adopted in introductory
organic chemistry, a similar approach is not used for introductory inorganic chemistry. A
perusal of introductory inorganic texts currently available on the market revealed a
complete lack of mechanistic rationale, as far as descriptive main-group chemistry is
concerned. In a recent article (Berg, S.; Ghosh, A. J. Chem. Educ. 2011 , 88, 1663-1666),
we argued that there was little justification for this state of affairs to continue. But just how
far can an arrowpushing approach be pushed to teach main-group reaction chemistry? The
answer, we believe, is 'very far indeed'. We will illustrate our approach by discussing some
of the more stoichiometrically complex reactions that one encounters in standard
undergraduate inorganic texts.
CHED 239
Incorporating catalysis in the undergraduate inorganic chemistry lecture and
laboratory
Bradley M Wile, [email protected] of Chemistry and Biochemistry, Ohio
Northern University, Ada, OH 45810, United States
This talk will describe efforts to incorporate catalytic cycles into the first undergraduate
inorganic chemistry course at Ohio Northern University. Activities in the lecture and
laboratory portions of this course are integrated, and students are encouraged to explore
implications of catalysis in small groups. At the conclusion of each activity, each group
communicates their findings, and some generalizations are made as a whole.
CHED 240
Utilizing metallacrowns for a multi-week upper-division inorganic laboratory
Curtis M. Zaleski, [email protected] of Chemistry, Shippensburg
University, Shippensburg, PA 17257, United States
Students engage in a multi-week, upper-division inorganic laboratory that explores four
different metallacrown compounds. This report provides experimental details regarding the
syntheses and characterization techniques, including cyclic voltammetry, solid state
magnetic susceptibility, FT-IR, UV-Vis, and paramagnetically shifted 1H-NMR. In addition,
data sets and spectra are provided for the characterization methods. A general course
outline is also provided for the different laboratory sessions. The premise of the project is to
mimic a research laboratory atmosphere in a controlled teaching environment. The
students are expected to explore the primary literature and to develop characterization
conditions for their particular metallacrown. The metallacrown laboratory also serves as a
capstone to the inorganic course as multiple lecture topics and laboratory techniques are
combined in the last weeks of the semester. Furthermore, the topic of metallacrowns
allows the instructor to combine a variety of principles from other chemistry disciplines such
as organic and analytical chemistry.
CHED 241
Increasing student comprehension in inorganic chemistry through use of online
homework
Jason S. Overby, [email protected] of Chemistry and Biochemistry, College
of Charleston, Charleston, SC 29424, United States
While online homework is a well-tested and well-understood technology for prep, intro,
general, and organic chemistry courses, its use in upper-level courses like inorganic
chemistry is minimal at best. To help with student comprehension and understanding of
advanced topics covered in a senior-level inorganic chemistry course, online homework
has been employed. An overview of the material and results from its use will be described.
CHED 242
Investigating the effects of online homework on student achievement in chemistry
Diane M Bunce, [email protected], Matthew Tomney, Ashlie Wrenne.Chemistry, The
Catholic University of America, Washington, DC 20064, United States
Online Homework is used in a variety of chemistry courses. Faculty who have overcome
the technological hurdles endorse it because it forces students to keep up with their
homework and to receive grades and feedback in a timely manner. Educational theory
supports the benefit of immediate feedback in learning. Book publishers have built in the
ability to set different parameters to better meet the needs of faculty of both large and small
classes. Research reporting on student satisfaction with Online Homework reports student
satisfaction with Online Homework, but does Online Homework affect student
achievement? This study conducted across three semesters with two different teachers
teaching the same course and using Online Homework does not show a definitive
advantage for student achievement. What is missing? Is it the experimental design, the
specific implementation of the Online Homework or the Online Homework itself? This and
other questions will be discussed.
CHED 243
Forays into blended learning with interactive digital content
Bernadette Harkness, [email protected] of Chemistry, Delta
College, University Center, MI 48640, United States
Among the many innovations in teaching chemistry in recent years, technology has played
a huge role as many educators embrace the use of tools such as clickers, online
homework, animations and videos to name a few, to increase student engagement and to
offer diverse learning modes. Some of these tools can be used in both traditional oncampus classes as well as for distance learning classes. This use of technology also
extends to online content delivery and is being used more frequently to blend online and
on-campus learning experiences. This blended learning approach can offer opportunities
for increasing classroom time for more active learning exercises or for decreasing
classroom time to shift to a more distance learning format. This discussion will focus on the
use of webpage authoring tools that can deliver online content with engaging and
interactive experiences for the student to learn and master basic chemistry fundamentals.
Student feedback and assessment data of their learning experiences will also be reported
to show the effects of online content delivery in both traditional on-campus and hybrid
(lecture online/ lab on-campus) introductory chemistry classes.
CHED 244
Targeting higher levels of learning in the general chemistry series by using
Marzano's Taxonomy
Santiago A. Toledo1, [email protected], Justin M Dubas2. (1) Department of Chemistry,
Texas Lutheran University, Seguin, TX 78155, United States (2) Department of
Economics, Texas Lutheran University, Seguin, TX 78155, United States
This presentation provides a framework to help chemistry students develop higher order
thinking skills. Marzano's Taxonomy gives a theoretical framework for learning that can be
adapted as a useful model in the chemistry classroom. This adaptation is used to develop
student learning outcomes for courses in the general chemistry series with the goal of
intentionally targeting higher levels of learning. The taxonomy based learning outcomes are
used to design classroom activities as well as formative and summative assessments
mapped to specific levels of the cognitive process. With an explicit focus on higher-levels of
learning, students are able to ascertain specific strengths and weaknesses they have
within a learning outcome in relation to the levels of the cognitive process. Faculty can use
the results of these assessments to easily identify problem areas in terms of learning
outcomes and progress in a student's cognitive development, allowing a differentiated
approach to student learning.
CHED 245
Factors to identity that enhance student learning, success, and retention in general
chemistry in an inner city university
Michael J Castaldi1, [email protected], Hamid Yazdekhasti1, Christopher
Edmin2, Felicia Mensah2, Catalina Adorno1. (1) Department of Chemistry, St. Peters
University, Jersey City, New Jersey 07306, United States (2) Science Education, Teachers
College, New York, New York, United States
The problem of retention and success for introductory physical science courses has been a
continued problem for undergraduate science departments. Nowhere has the problem
been more an issue than in General Chemistry. As this is often the "gatekeeper" for many
of the sciences it is often the make or break for someone choosing to major or to have a
career in a science. Over the years there have been many attempts to break this cycle but
with very limited success. The literature is full of studies but, the high drop rate after the
first and second semesters of general chemistry still continues. With the need to attract and
keep science and engineering students we have attempted to track our incoming general
chemistry students and try to identify factors that might be relevant to undergraduate
success in the physical sciences. We have initiated some new and creative ways which
included interviews, student focus groups, attitude surveys, online homework as well as
diagnostic pre and post tests. We will present some of our preliminary findings and results.
CHED 246
Creating connections: Introducing scientific literature research in the undergraduate
general chemistry laboratory
Margaret Bruehl1, [email protected], Denise Pan2, Ignacio FerrerVinent2. (1) Department of Chemistry, University of Colorado Denver, Denver, CO 802173364, United States (2) Auraria Library, University of Colorado Denver, Denver, CO
80217, United States
The University of Colorado Denver (UCD) Chemistry Department is collaborating with the
Auraria Library on a case study to quantify the benefits students receive in their education
by using library collections. Over the last three academic years, students enrolled in
Honors General Chemistry I and II Laboratory courses have completed units focused on
scientific literature. The goal is to introduce students to the rich resource of scientific
literature early in their undergraduate studies. A science librarian presents library
instruction targeted at topics the students have encountered in previous lab work and
lecture material. Then, the post-lab assignment challenges students' comprehension and
creativity to use library and non-library resources to explore appropriate topics in the
scientific literature, with the ultimate goal of identifying ideas for new general chemistry
laboratory experiments. While searching the literature, students record their research
process by capturing information on the scientific databases accessed as well as search
terms and refinements used, and documenting chosen citations in ACS format. At the end
of each semester, this information is gathered, along with assignment and course grade
data from each participating student, and is analyzed by the authors of this paper in order
to identify misconceptions in student learning, evaluate the effectiveness of library
instruction, find insights into teaching information literacy, and estimate the return-oninvestment (ROI) of library materials. The results of this case study can shed light on the
role of library instruction and teaching information literacy to students early on in their
undergraduate science education. Long term, this case study can assist libraries in making
informed decisions on where to invest their resource dollars and the effective integration of
library and freely available resources.
CHED 247
Infrastructure requirements of the ACS Guidelines
Laura Kosbar1, [email protected], Cynthia K. Larive2, [email protected]. (1) IBM T.J.
Watson Research Center, Yorktown Heights, NY 10547, United States (2) Department of
Chemistry, University of California - Riverside, Riverside, CA 92521, United States
The infrastructure requirements of the 2008 Guidelines provide a foundation for program
excellence. Faculty and instructional staff are the main drivers of undergraduate programs
therefore contact hours are limited to 15 hrs per week, with some flexibility for averaging. A
minimum of 4 faculty members are required with at least 3/4ths PhDs. The 2008 Guidelines
require that programs maintain a suite of modern instruments (including a functioning
NMR) and specialized laboratory apparatus for student use, as well as providing students
and faculty access to Chemical Abstracts and at least 14 current journals.
The past five years have witnessed rapid changes in the staffing of many chemistry
programs, with increases in the numbers of temporary and non-tenure track instructors.
Electronic access to chemical information is changing rapidly and modes of interaction with
instrumentation, including remote access, could allow other paradigms for chemistry
instruction. Updated guidelines may need to address these changes.
CHED 248
Discussion of infrastructure needed for an approved program
Laura L. Kosbar1, Cynthia K. Larive2, [email protected]. (1) IBM T. J. Watson Research
Center, Yorktown Heights, NY 10547, United States (2) Department of Chemistry,
University of California, Riverside, Riverside, CA 92512, United States
This session will provide an opportunity for the attendees at this symposium to engage in a
conversation about infrastructure requirements for approved programs. The discussion will
focus on faculty and technology. Topics of the discussion will include appropriate maxima
for teaching loads for both tenure-track faculty and other individuals who are involved in
course delivery. We are also interested in the balance between faculty and instructional
staff in course delivery. We will explore how the revisions to the Guidelines should reflect
changes in information resources and their modes of delivery as well as how changes in
technology affect the ways in which students work with instrumentation.
CHED 249
Development of student skills and the role of research in the undergraduate
curriculum: Implications for the ACS guidelines
Joel I. Shulman1, [email protected], Edgar A. Arriaga2, [email protected]. (1)
Department of Chemistry, University of Cincinnati, Cincinnati, Ohio 45221, United
States (2) Department of Chemistry, University of Minnesota, Minneapolis, Minnesota
55455, United States
While formal coursework provides students with education in chemical concepts and
training in laboratory practices, students need to learn more than course content alone to
be effective and productive scientists. They need to master a variety of skills that will allow
them to become successful professionals, including problem solving, laboratory safety, use
of the chemical literature, oral and written communication, team building, and ethical
behavior. These skills can be imparted and assessed throughout the chemistry curriculum.
Undergraduate research is an important experience that reinforces development of these
skills while at the same time providing students the opportunity to integrate concepts
learned in class into the broader context of a research question. The treatment of student-
skill development and undergraduate research in the revised ACS Guidelines will be
discussed.
CHED 250
Discussion of skills required for a certified major
Edgar A. Arriaga1, [email protected], Joel I. Shulman2, [email protected]. (1)
Department of Chemistry, University of Minnesota - Twin Cities, Minneapolis, MN 55455,
United States (2) Department of Chemistry, University of Cincinnati, Cincinnati, OH 45221,
United States
The importance of skill development in undergraduate programs is becoming increasingly
evident. During this session we will focus on the range of skills certified majors should gain
by the time they graduate, how students can obtain these skills, and how the Committee on
Professional Training can assess the effectiveness of programs to develop these skills in
their students. We will also consider the role of undergraduate research and how it can be
used to help develop student skills. This session will consist of both small group
discussions as well as discussion in the larger group.
CHED 251
Undergraduate curriculum and the ACS Guidelines
Clark R. Landis1, [email protected], Anne B. McCoy2, [email protected]. (1) Department of Chemistry, University of Wisconsin - Madison, Madison, WI
53706, United States (2) Department of Chemistry and Biochemistry, The Ohio State
University, Columbus, OH 43210, United States
A central feature of the undergraduate experience is the courses that students are required
to take. With the 2008 Guidelines, the course requirements for certified majors were made
more flexible. Specifically, students have foundation level experiences in each of the five
sub-disciplines of chemistry (analytical, biochemistry, inorganic, organic and physical) as
well as four in-depth courses. In addition to the lecture courses, students should have at
least 400 hours of laboratory, which covers at least four of the five sub-disciplines of
chemistry. Further, approved programs need to teach the foundation courses in the five
sub-disciplines, and offer four in-depth courses annually. In this talk, we will review the
current requirements, as well as discuss areas where changes may be introduced during
the revision of the guidelines that is presently underway. We will also describe various
approaches for introducing areas of chemistry that span multiple sub-disciplines or which
represent evolving areas in chemistry.
CHED 252
Discussion of the curriculum for the certified major
Clark R. Landis1, [email protected], Anne B. McCoy2, [email protected]. (1) Department of Chemistry, University of Wisconsin - Madison, Madison, WI
53706, United States (2) Department of Chemistry and Biochemistry, The Ohio State
University, Columbus, OH 43210, United States
During this session we will conduct a discussion of topics related to the curriculum a
certified major must complete. In the 2008 Guidelines, considerable flexibility was
introduced into the curriculum. Part of the motivation for the flexibility is to allow programs
to include subjects that are appropriate for the students they are teaching. There must
always be a balance between flexibility and ensuring students have an appropriate
exposure to a broad range of topics that don't naturally fall into the five sub-disciplines of
analytical, biochemistry, inorganic, organic, and physical chemistry. Such topics include,
but are not limited to, green chemistry, polymer chemistry or material science. Much of the
discussion will focus on these issues. In addition, the Guidelines currently stipulate that
programs must teach foundation courses annually and must teach a minimum number of
in-depth courses each year. We will discuss how this requirement affects programs,
particularly when small-enrollment courses are involved.
CHED 253
Effect of phytohormones in nutrient uptake by coriander plants in soil-compost
system
Taina Rodríguez-Curet1, martha.l[email protected], Martha López-Moreno2. (1) Department
of Biology, Chemistry and Environmental Sciences, Inter American University of Puerto
Rico - San Germán, San Germán, Puerto Rico (2) Department of Chemistry, University of
Puerto Rico, Mayaguez, Puerto Rico
Food shortage is a worldwide problem; to produce foods containing greater amount of
nutrients may be a solution. Different soils contain diverse nutrient content. Compost in soil
behaves as fertilizer, provides micro and macro-nutrients and increases its retention. Also,
it has other properties that contribute significantly to the growth of plants. Phytohormones
are chemical substances occurring naturally in plants; they are responsible for regulating
the physiological processes of plants. The aim of this research was to enhance the nutrient
uptake of Coriandrum sativum (Coriander) in soil-compost systems using phytohormones.
Leaves and stems of coriander were analyzed for micro and macro nutrient uptake by
Inductively Coupled Plasma Mass Spectroscopy (ICP-MS). Results showed that coriander
plants grown in soil or soil- compost system treated with phytohormones contained higher
amount of nutrients. These results may suggest that phytohormones can increase the
nutrient uptake by coriander plants, but additional studies are needed.
CHED 254
Characterization of alternate grains used in the brewing process and analysis of
product parameters
Grant D Newton, [email protected], Francis M Mann.Department of Chemistry,
Winona State University, Winona, Minnesota 55987, United States
In recent months, an interest has arose in the gluten content of beer, both traditional and
gluten free. During the first part of my research, a few gluten free beers were tested using
an ELIZA (EZ Gluten) test to determine if there was any gluten in the beer. The results
showed that the gluten free beers did not contain gluten. Following this analysis, I have
analyzed alternate grains, (sorghum, rice, corn, quinoa), as well as barley, to determine if
any gluten is extracted during the fermentation process. During the process, standard tests
used during the brewing process are used on the alternative grain fermentation to
determine if the grains are a plausible alternative to standard grain used. The tests include
relative ethanol fermentation, a Brix test to determine sugar content and consumption, and
a total protein assay to determine the proteins extracted by the fermentation process.
CHED 255
Determination of metals in pet food
Karolyn Barker, [email protected], Donald L Wharry.Department of Chemistry, St.
Edwards University, Austin, Texas, United States
A rise in the amount of pet food recalls within the past few years has caused
concern over the health and safety of pets, as well as regulations. Metals that are not listed
on labels can have harmful impacts on the animals, especially long-term. Iron, nickel,
cadmium, copper, and chromium concentrations were tested through AA spectroscopy.
RfD values for humans were used for nickel, cadmium, and chromium because there are
not values set for animals. One was over the value for copper of a 33lb dog. Iron averaged
2x too high, nickel averaged about 1x too high, chromium ranged from 2-6x too high, and
cadmium averaged about 4x too high. For 9lb cats, copper was about 2x higher than the
RfD, 1.5x too high for Iron, 3x for nickel, 3-20x too high for chromium, and 5-8x too high for
cadmium. Further research will aim to evaluate more samples and metals.
CHED 256
Correlation of logD(Oct) and chromatographic logk' values for the catechol flavones
Josh D. Hernandez, [email protected], Chin Yeow, Katie Loving, Hannah Sigal,
Margaret J. Risher, William L. Whaley.Chemistry, Geosciences and Environmental
Science, Tarleton State University, Stephenville, Texas 76402, United States
The flavones represent a class of natural products that are contained in fruits and
vegetables. These compounds function as anti-oxidants to protect cells from reactive
oxygen species (ROS). The ortho-dihydroxy group, also called a catechol group, is one of
the structural features of flavones that confer high radical scavenging activity. The
presence of a catechol group increases the polarity of flavones and this may affect
membrane permeability. The logarithm of the octanol/water partition coefficient, or logP (Oct),
is a descriptor that is an index of the hydrophobicity of a molecule. For flavones, it is more
appropriate to measure distribution coefficients, or logD(Oct) values, because the hydroxyl
groups of several catechol flavones have pKa values less than 9.0. The distribution
coefficient was determined using 1-octanol equilibrated with MOPS buffer (pH=7.4) in the
aqueous phase. For a group of related compounds, the values of logD(Oct) have often been
correlated to the logarithm of the chromatographic retention factors (logk' values) to verify
their accuracy. Each catechol flavone including 7,8-dihydroxyflavone (7,8DHF), 6,7dihydroxyflavone (6,7 DHF), 5,6-dihydroxyflavone (5,6DHF), 2',3'-dihydroxyflavone
(2',3'DHF) and 3',4'-dihydroxyflavone (3',4'DHF) were assayed by the “shake-flask” method
to determine the value of logD(Oct). The values of LogD(Oct) were correlated with values of
Logk' that were determined using an octadecylsilane (C-18) stationary phase and a polar
mobile phase. A good correlation with an R2 value of 0.93 was observed. The compound
3,2'-dihydroxyflavone (3,2'DHF) was also included in the study because it has exhibited
some of the physical and chemical properties that are typical of true catechol-flavones.
Nuclear magnetic resonance spectroscopy was used to demonstrate that this compound
can exist in two different conformations that allow it interact with either polar or non-polar
solvent molecules. (This research was supported financially by the Welch Foundation
Departmental Research Grant Program, the Tarleton Organized Research Program, and
the Tarleton REAL Program.)
CHED 257
Quantification of urea in a controlled-release fertilizer
Joshua L Neeper, [email protected], Ron E Hemingway, Frederick F Shriner, IV,
Blakely M Adair.Department of Chemistry, The Citadel, Charleston, South Carolia 29409,
United States
Nitrogen is one of three macronutrients commonly used in plant fertilizer; the other two
being phosphorous and potassium. The focus of this experiment was to determine the rate
of release of a newly formulated controlled-release solid formulation of nitrogen containing
urea fertilizer, after having been exposed to soil over a specified period of time. The
fertilizer pellets varied in size and urea content. The desired outcome was a slow and
uniform reduction of urea in the fertilizer pellets over time. Multiple concentrations and
sizes of fertilizer pellets were analyzed. UV-visible spectrometry was employed to
determine the concentrations of nitrogen from urea by comparing its absorbance at 470nm
against a set of urea nitrogen standards. The results show that the expected
concentrations before the fertilizer was applied to the soil are accurate. The nitrogen
concentrations in some post application samples are inconsistent with the preliminary mass
difference data.
CHED 258
Antioxidants and polyphenol activity: It's getting hot
Kimberlee Daus, Dviti P Mody, [email protected] of Chemistry,
Belmont University, Nashville, Tennessee 37212, United States
In the past three decades research regarding antioxidant activity has gained attention.
Antioxidant, found abundantly in fruits, can reduce oxidative damage that is caused by free
radicals. Antioxidants safely interact with free radicals to terminate the chain reaction
before vital molecules like DNA are damaged. Polyphenols are a type of antioxidant that
have great abundance in our diet and help with prevention of cancer and cardiovascular
diseases. The aim of this research is to investigate the effect of heat on the activity of
polyphenols in fruits such as blueberries, apples and grapes. The polyphenolic activity of
the fruits was tested using the TEAC test and DPPH assay. The anticipated results should
indicate an increase in polyphenolic activity of these fruits, and thus, an increase in
nutritional value.
CHED 259
Dissolution of cellulose with Fe-containing magnetic ionic liquids
Stephanie A Hall, [email protected], Clint W Williford.Department of Chemical
Engineering, University of Mississippi, Oxford, Mississippi 38655, United States
The focus of this project is to determine the effectiveness, in the preprocessing of biomass,
of a magnetic ionic liquid 1-butyronitrile-3-methylimidazolium tetrachloroferrate
(nbmim[FeCl4]) as a catalyst. Lignocellulose is a promising starting material for
bioproducts, ranging from biofuels to specialty chemicals; however, lignocellulose is
resistant to enzymatic degradation. Various biomass-preprocessing techniques such as
mechanical, microbial, and chemical pretreatment are used for increasing the digestibility
of biomass to sugars for ethanol production. A variety of ionic liquids have demonstrated
the capability to degrade lignocellulose. However, after degradation separation of biomass
and ionic liquids has proven to reduce the economic potential of this pretreatment process.
The addition of magnetic properties to the ionic liquid can be used to stabilize the ionic
liquids and prevent its loss or other unfavorable fluid/fluid interactions in the bioreactor.
Therefore, overcoming separation is an important priority for the progress of the
lignocellulosic biorefinery concept.
CHED 260
WITHDRAWN
CHED 261
Expressed sequence tag for DNA polymerase alpha
Rebecca Krewer, [email protected], Ira Simet.Department of Chemistry and Biochemistry,
University of Northern Iowa, Cedar Falls, Iowa 50613, United States
Replicative DNA polymerases have a role in the control of DNA synthesis and are potential
targets for stopping unregulated cell growth, such as cancer. DNA polymerase alpha,
which assembles RNA primers and initiates replicative synthesis, represents a model
enzyme in the study of this control. This enzyme is composed of a priming subunit, a
catalytic subunit, and two structural subunits. Several primers developed from known
enzyme gene sequences have been used to identify an expressed sequence tag (EST) in
the catalytic subunit of the enzyme in embryonic chicken brain. The sequence of the EST
matches a published chicken genomic DNA sequence. This EST will be used in real time
PCR to help quantitate DNA polymerase alpha catalytic subunit mRNA under various
growth conditions.
CHED 262
2-Octadecynoic acid displays antineoplastic activity against neuroblastoma via
lactate dehydrogenase release
Gabriel A Cintrón, [email protected], Elsie A Orellano, Néstor M
Carballeira.Department of Chemistry, University of Puerto Rico Río Piedras Campus, San
Juan, Puerto Rico 00931-3346, Puerto Rico
Recently, our research work demonstrated that the 2-octadecynoic acid (2-ODA) displays
antineoplastic activity, against the neuroblastoma SH-SY5Y cell line (EC 50 = 26.0 ± 2.0).
Moreover, we found that the 2-ODA is an inhibitor of the human topoisomerase IB enzyme,
a possible intracellular target for this fatty acid. To further characterize the cell death
response by 2-ODA we assessed caspase-3 activation and lactate dehydrogenase (LDH)
release. We found that 2-ODA promoted LDH release, which is a cell death mechanism
principally associated to necrosis. Thus, 2-ODA promotes cancerous cell death by a death
mechanism independent of caspase-3 activation, but dependent of LDH release. For this
reason, our results suggest a specific mechanism of action for 2-ODA through cell
membrane breakdown. 2-ODA could be the first of many such class of novel acetylenic
fatty acids with antineoplastic activity. Our research work highlights a fundamental step
forward towards the eradication of cancer.
CHED 263
Comparison of insulin and insulin-like receptors from bean beetles and mammals
Shawn Mercer, [email protected], Richard Singiser.Department of Natural Sciences,
Clayton State University, Morrow, GA 30260, United States
Previous studies have been completed on bean beetles and morphological changes.
These studies identified changes in morphology related to growth on different mediums.
Current work is aimed at determining the biochemical effects the insulin-like receptors may
cause, leading to morphological changes. Using this knowledge, experiments to isolate the
bean beetle insulin-like receptor will be completed. After isolation, comparisons between
the insulin-like receptor of bean beetles and the mammalian insulin receptor can be made
using ligands specific to both the mammalian insulin receptor and bean beetle insulin-like
receptor. Both conserved and divergent residues will be identified in this comparison
leading to focal points for further studies. These conservative and divergent areas should
help identify regions related to control of the morphological changes observed in bean
beetles. In addition, study of these areas in the insulin-like receptor could present knew
knowledge about the workings of the mammalian insulin receptor.
CHED 264
Study of secondary structure of cpTat system component, Tha4, by EPR
spectroscopy
Karolin Emia Ginting1, [email protected], Amanda Storm1, Carole DabneySmith1,2. (1) Department of Chemistry and Biochemistry, Miami University, Oxford, Ohio
45056, United States (2) Cell, Molecular and Structural Biology Program, Miami University,
Oxford, Ohio 45056, United States
Chloroplast Tat (twin arginine translocation) pathway is responsible for transporting fully
folded precursor proteins into the thylakoid lumen using only the proton motive force for
energy via the assembly and activity of three membrane-bound components: Tha4,
Hcf106, and cpTatC. The arrangement of Tha4 in the membrane has significant
implications on how it could function during translocation, yet little is still known about its
oligomer organization. As a prelude to structural studies of the Tha4 oligomer, we present
the secondary structure of Tha4 in the membrane as determined using site-directed spin
labeling electron paramagnetic resonance (SDSL EPR) spectroscopy. Single cysteine
substitution is introduced in various positions of Tha4 through primer-based mutagenesis
and subsequently labeled with a nitroxide spin label. Integration of this protein to synthetic
lipid membranes was subjected to power saturation and continuous wave EPR (CW-EPR)
experiments. These methods allows us to more accurately map the transmembrane
domain of Tha4.
CHED 265
Single base changes in DNA discriminator show large effects on transcription
initiation thermodynamics
Stephanie Chong-Macias1, [email protected], Emily Ruff2, Noah Bown2, Tom
Record2. (1) Department of Chemistry, University of the Incarnate Word, San Antonio, TX
78209, United States (2) Department of Biochemistry, University of Wisconsin-Madison,
Madison, WI 53706, United States
Transcription initiation occurs in a several-step mechanism, whereby RNA polymerase
(RNAP) recognizes and binds to DNA and forms an opened RNAP-promoter complex
(RPo). We aimed at determining which of the interactions occurring between RNAP and
DNA promoter affected RPo complex formation the most. DS4 and DS5 variants were
studied. They differed in length by two base pairs of a phage promoter λP R (DS4 and DS5:
8 base pairs; λPR: 6 base pairs), and varied in sequence from each other at one base pair
position. To determine if such discriminator variations cause any effect on RP o stability,
various filter binding dissociations were performed at different temperatures and a
permanganate footprinting reaction was performed for both variants. Through these
experiments it was seen that the change between λP R and DS4 only affected the lifetime of
open complex, while the variations in DS5 also caused large and surprising effect on the
system's thermodynamics.
CHED 266
Identification of proteins that interact with the arabidopsis SYN3 cohesin protein
Dirk Auman, [email protected], Yuan Li, Kayla Zehr, Christopher
Makaroff.Department of Chemistry and Biochemistry, Miami University, Oxford, OH 45056,
United States
The cohesin protein complex is vital for holding sister chromatids together during cell
division. In Arabidopsis thaliana, α-kleisin proteins are the connectors of two structural
maintenance proteins in the cohesin complex. The four α-kleisin proteins found to be vital
to sister chromatid cohesion in Arabidopsis thaliana are SYN1, SYN2, SYN3, and SYN4.
The behavior of SYN3 was examined in previous research, and it was found not to
aggregate around chromosomes in the way SYN1, SYN2, and SYN4 do; instead, its
predominant localization in the nucleolus lead to the hypothesis that SYN3 is involved in
transcriptional regulation. By employing a yeast two-hybrid assay to screen for SYN3interacting proteins and using subsequent co-immunoprecipitation and western blotting to
confirm the potential interactions, SYN3's putative role in transcriptional regulation was
investigated. SYN3 was ultimately shown to interact with a number of known transcription
factors, suggesting a regulatory function in gene expression for the protein.
CHED 267
Studies towards the development of a colorimetric method for determination of
bacterial concentration
Alaina N. Nunn, [email protected], Stephanie A Brouet, Tami L. Sivy.Department of
Chemistry, Saginaw Valley State University, University Center, MI 48710, United States
The synthesis of a cephalosporin that could lead to the development of a new colorimetric
test for bacterial concentration is described. This highly conjugated compound contains a
strained four-membered ring, which is readily opened upon attack of β-lactamase, causing
the release of the compound's 3-substituent (2-mercaptopyridine-N-oxide). The release of
the 3-substituent is important because it forms a violet-colored complex with Fe, allowing
for a colorimetric method for determining bacteria concentrations to be developed. Without
the β-lactamase produced by bacteria there would be no release of the 3-substituent, and
hence, no color change. Therefore, a correlation may be made between the intensity of the
violet color and the concentration of bacteria present. The color changes will be followed
quantitatively by measuring changes in absorption using UV-VIS, and this data will then be
used to form a calibration curve which will show the relationship between bacteria
concentration and the color change's absorptions.
CHED 268
Structural studies of CTCF
Lyanne M Gomez-Rodriguez1, [email protected], Ronen Marmorstein2, Jasna
Maksimoska2. (1) Department of Chemistry, University of Puerto Rico, San Juan, Puerto
Rico 00931, Puerto Rico (2) Department of Biochemistry and Biophysics, University of
Pennsylvania, Philadelphia, Pennsylvania 19104-6059, United States
CCCTC-binding factor (CTCF) is an ubiquitous, 11 zinc finger (ZF) protein that binds to
many sites in the genome and is an important regulator of different cellular processes
essential for normal cellular development. It is known that CTCF binds to DNA through its
11 ZF binding region, however molecular details and role of individual fingers in that
interaction are not known. To reveal the mechanism for DNA binding specificity by CTCF,
we aim to determine the crystal structure of relevant CTCF - ZF domain in complex with
target DNA sequence. For this, the protein will be expressed in bacterial cells and purified
to homogeneity. Purified protein alone and in complex with DNA will be exposed to various
crystal screening conditions to obtain crystals. Once we have crystals, x-ray diffraction data
will be collected in order to solve the structure of CTCF and CTCF/DNA complex.
CHED 269
Stability of native state beta2-microglobulin
Laylee E. Ghafar, [email protected], Stephanie Gould, John M.
Richardson.Department of Chemistry, Austin College, Sherman, TX 75090, United States
Β2-microglobulin (β2m) is a small, 99 residue protein, is a major component of the
formation of amyloid fibrils in dialysis-related amyloidosis-a disease associated with renal
failure and the deposition of insoluble amyloid fibrils in the musculo-skeletal system. This
research is focused to understand the mechanism behind the formation of amyloid fibrils,
which includes the analysis of the unfolding transition of β2m. To determine the free
energy, ΔG, of the native state, the conformational transition was monitored by the use of a
chemical denaturant, guanidinium hydrochloride (Gdm-HCl). Unfolding was followed by
fluorescence emission of the amino acid tryptophan. Literature reports differences in ΔG
values depending upon identity of chemical denaturant used. Differences in the unfolding in
different denaturants may indicate a possible mechanism for the identification of the
amyloidgenic species. Our preliminary results showed cooperative unfolding using GdmHCl, and gave higher ΔG values then those previously published in literature.
CHED 270
How does rev regulate retroviral integration in HIV
Tam Vo, [email protected], Nicholas Fitzkee.Department of Chemistry, Mississippi State
University, Starkville, MS 39759, United States
The catalytic core domain (CCD) of HIV-1 Integrase can shuttle cDNA from the virus to the
host genome. This interaction is strictly controlled by the HIV Rev protein. Rev is required
for successful integration, and the CCD-Rev interaction is a potential target for new AIDS
treatments. Structural details of this interaction remain unclear; without it, progress in drug
development is limited. Recently, a new method has been developed to make both the Rev
protein and the CCD more soluble, facilitating characterization by biomolecular NMR
spectroscopy. We present a simple method for the expression and purification of the Rev
protein. Rev is fused to a Lipoyl domain during expression. This additional domain resolves
the solubility issues that plagued prior work. Rev can then be purified by Ni-affinity column
chromatography, ion exchange, and gel filtration and characterized spectroscopically.
Characterization of the Rev-CCD interaction via NMR titrations will be also be described.
CHED 271
Synthesis of transition state analogs of the AI-1 synthase RhlI
James Annand, [email protected], Scott Ulrich.Department of Chemistry, Ithaca
College, Ithaca, NY 14850, United States
Quorum sensing is a bacterial communication system that involves the production and
detection of small signaling molecules called autoinducers. Bacteria sense autoinducer
concentrations to gauge their cell density, and use this information to initiate cell-density
dependent transcriptional changes. The main class of autoinducers are the acyl
homoserine lactones or AI-1 molecules. They are made by LuxI family of AI-1 synthases
and detected by the LuxR family of AI-1 receptors. We aim to design and chemically
synthesize transition state analogs of the P. aeruginosa AI-1 synthase, RhlI. These
molecules will be useful both as potential inhibitors of RhlI as well as ligand for X-ray
crystallography experiments to elucidate the mechanism of RhlI.
CHED 272
tRNA synthetases show “extreme” features in oral pathogens
Eric Trejo1, [email protected], Ashley Van-Orden1, Rachel Yomtob2, Vern Winston2, Caryn
Evilia1,2. (1) Department of Chemistry, Idaho State University, Pocatello, ID 83209, United
States (2) Department of Biological Sciences, Idaho State University, Pocatello, ID 83209,
United States
tRNA synthetases are essential enzymes that are required for protein synthesis and
evolutionary changes should be evident in their protein sequences.Our lab has found that
extremophile organisms, like Halobacterium, have peptide insertions that confer increased
stability to the tRNA synthetases under extreme conditions. To see if other potentially
“extreme” organisms might have the same features, we used protein alignments and
computer modeling to find tRNA synthetases that fit a similar pattern. We found a group of
pathogenic organisms (Prevotella intermedia, Fusobacterium necrophorum, and
Porphyromonas gingivalis) whose cysteinyl and arginyl-tRNA synthetases had peptide
insertions around the active site of the enzymes. This leads us to conclude that peptide
insertions may be an adaptation to their “extreme” environment. We are currently
characterizing these enzymes in an attempt to discover a novel mechanism of inhibition,
which may lead us to a novel therapy for this disease.
CHED 273
Elucidating the enzymatic mechanism of epi-isozizaene synthase
Carina Chittim, [email protected], Kevin Litwin, [email protected], Scott
Ulrich.Department of Chemistry, Ithaca College, Ithaca, NY 14850, United States
Terpene cyclases are enzymes that catalyze the formation of terpene natural products from
linear isoprenoid pyrophosphates. The cyclases catalyze carbocation formation of these
precursors followed by complex carbocation chemistry to generate the terpene
hydrocarbon framework. Epi-isozizane synthase, which generates the terpene epiisozizaene, has a complex carbocation cascade mechanism and has a known threedimensional structure by X-ray crystallography. However, how it manages the carbocation
chemistry en route to the product remains poorly understood. It is the goal of our lab to
address the question of how epi-isozizaene synthase funnels the reaction cascade towards
its unique product. We seek to synthesize ammonium and sulfonium analogs of the
carbocation intermediates and co-crystallize them with the enzyme. These co-crystal
structures will collectively shed light on the enzymatic reaction mechanism.
CHED 274
Molecular and cellular characterization of arabidopsis SCC4
Nicole M Fisher, [email protected], Jessie L Ellis, [email protected], Eric Wynn,
Li Yuan, Christopher Makaroff.Department of Chemistry and Biochemistry, Miami
University, Oxford, OH 45056, United States
Cohesion complexes hold sister chromatids together during mitosis and meiosis and play a
role in DNA repair and transcription. Cohesin binding is dependent upon the SCC2/ SCC4
adherin complex. Previous studies have shown that inactivation of SCC2 or SCC4 in yeast
results in lethality. In humans, SCC2/SCC4 mutations that alter the expression and/or
activity of the proteins result in complex developmental abnormalities. In this study, the role
of SCC4 in the model plant Arabidopsis is being determined. We have shown that
inactivation of SCC4 results in embryo lethality. To better understand the role of SCC4,
particularly during meiosis and mitosis, transgenic plants in which SCC4 levels are reduced
by RNA interference are being generated. Specifically, three lines of plants will express
SCC4 RNAi constructs from the constitutive 35S, inducible PX7, and meiosis-specific
DMC1 promoters. The effect of SCC4 knockdown on meiosis, mitosis, gamete
development, and embryogenesis will be analyzed.
CHED 275
Identifying the interacting partner protiens of cohesin SYN3
Spenser M Pruett, [email protected], Kayla R Zehr, Li Yuan, Christopher A
Makaroff.Department of Chemistry and Biochemistry, Miami University, Oxford, Ohio
45056, United States
Cohesins are critical for holding a pair of sister chromatids together before segregation
during cell division, as well as a variety of other processes. The core cohesin complex
consists of 4 proteins: SMC1, SMC3, SCC3, and an ɑ-kleisin. In Arabidopsis thaliana, the 4
ɑ-kleisin proteins are SYN1, SYN2, SYN3, and SYN4. SYN3 was found to be enriched in
the nucleolus and is crucial for gametophyte growth. Recent studies have also shown that
SYN3 cohesins in animal cells may have regulatory roles in transcription. Utilizing the
Matchmaker Gold Yeast Two-Hybrid Assay, SYN3 was tested against a protein library to
screen for potential interacting partners. Over 60 proteins were determined to be
candidates for SYN3's interactome. Among these partners were a number of chloroplastlocalized proteins including FTSZ-1: the Arabidopsis homolog of the bacterial Z-ring
protein. These interactions are interesting because SYN3 has never been shown to have a
role in the chloroplast.
CHED 276
Structural characterization of antierior gradient 2 protein and its role in pancreatic
cancer
Amielia G Adams, [email protected], Shuisong Ni, Michael A. Kennedy.Department
of Chemistry and Biochemistry, Miami University, Oxford, Ohio 45056, United States
The protein Anterior gradient 2 (Agr2) is highly expressed in pancreatic ductal
adenocarcinoma (PDAC), and plays a role in the spread of pancreatic cancer cells. While
Agr2's structure and molecular level role in PDAC remains unknown, the structure of its
homologue Agr3 was recently deposited into the PDB bank. The primary goal of this study
is to better understand the structure of Agr2 through x-ray crystallography and NMR
spectroscopy. To prepare the protein for structural studies, Agr2 was cloned without its 20
N-terminal amino acid signal peptide (Agr2 d20) and without an additional N-terminal 30
amino acids because of low sequence complexity and predicted structural disorder (Agr2
d50). Using bioinformatics, site-directed mutagenesis was also performed to reduce
predicted surface entropy. Crystal trials and preliminary HSQC 15N labeled NMR spectra of
Agr2 d20 were unsuccessful and indicated the protein formed a dimer in solution.
Research with Agr2 d50 will be presented.
CHED 277
Effects of DNA sequence and topology on the binding of heterocyclic diamidine antiparasitic agents to DNA examined by restriction enzyme activity assays
Cassandra J. Winkle1, [email protected], Stefanie Suarez1, David W. Boykin2, W. David
Wilson2, Stephen A. Winkle1. (1) Department of Chemistry and Biochemistry, Florida
International University, Miami, Florida 33199, United States (2) Department of Chemistry,
Georgia State University, Atlanta, Georgia 30302, United States
Heterocyclic diamidines have been shown to have anti-parasitic properties. Previous
studies have suggested that these compounds may exhibit sequence selectivity. To further
elucidate the effect of DNA sequence and topology on the binding properties of
heterocyclic diamidines, restriction enzyme activity assays were performed with a mix of
supercoiled and relaxed circular phiX174RF DNAs and the compounds DB75, DB293, and
DB818. Drug to base pair ratios ranged from 0.2 to 7.8 drug/base pair. The results indicate
that altering drug structure leads to sequence and topological specificity in the binding.
Drug effects were shown to vary depending on whether the substrate DNA was relaxed or
supercoiled. With DB818, cleavage by Pst I (CTGCAG) showed partial enhancement with
relaxed DNA and partial inhibition with supercoiled DNA. Together, these results further
delineate the role of drug structure in the sequence and topological selectivity in the
binding of heterocyclic diamidines to DNA.
CHED 278
Retromutagenesis: A novel approach to drug resistance in microorganisms
Michael J. Cargill, [email protected], Alicia M. James, [email protected], Tina T.
Saxowsky.Department of Chemistry, Pacific Lutheran University, Tacoma, WA 98447,
United States
In non-dividing cells, such as those subject to drug pressure, the influence of persistent
DNA damage on transcription could affect cellular outcomes. Base damage can be
bypassed by RNA polymerase, resulting in a pool of mutant mRNAs through transcriptional
mutagenesis (TM), and potentially a population of mutant proteins that could alter the
phenotype of the cell. We hypothesize that TM could be an important first step in acquiring
drug resistance, as the mutant protein could allow cells to resume DNA replication and
convert this damage to a permanent advantageous mutation, a process we call
retromutagenesis. Using Saccharomyces cerevisiae as a model organism, we have
established an experimental system to elucidate this process. Furthermore, we have begun
to explore the effects of increasing steady state levels of DNA damage by either
compromising repair pathways or inducing additional damage with UV-A irradiation.
CHED 279
Three hair mutations, frizzy (fr), frizzy-like (frzl), and retarded hair growth (rhg),
disrupt distinct genes on mouse chromosome 7
Samantha R Hughes, [email protected], Thomas R. King.Department of
Biomolecular Sciences, Central Connecticut State University, New Britain, CT 06050,
United States
The frizzy (fr) mutation has previously been assigned to the Prss8 gene on mouse
Chromosome 7. The retarded hair growth (rhg) and frizzy-like (frzl) mutations also generate
hair defects and map to the same region as fr, but whether they are alleles of Prss8 or
mutations in distinct genes is not known.To discover the genetic relationship among these
mutations, I have crossed all pair-wise combinations of these variant mice and have shown
that all three mutations complement, and therefore must lie in distinct genes. To identify
alternative gene candidates by a positional approach, I have mapped rhg between markers
that flank fewer than 25 genes. One of the genes in this interval, Fgfr2, is known to be
required for normal hair development. But, since mice carrying both Fgfr2Δ and rhg or
Fgfr2Δ and frzl are normal, I conclude that neither of these mutations is a defect in Fgfr2.
CHED 280
Taking back control: Active engagement and enhanced student learning in a guided
inquiry biochemistry laboratory course
Jamila Lee, [email protected], Nakeya Hudgens, [email protected], Candace Timpte,
Gillian Rudd.School of Science & Technology, Georgia Gwinnett College, Lawrenceville,
GA 30043, United States
This project-based laboratory will become a part of the GGC curriculum as it improves
student interest and skills by updating and upgrading the biochemistry laboratory. Students
will experience the isolation and purification of cytochrome c in an environment where
learning is experiential and steeped in investigation. New learning materials and
applications have been developed for the biochemistry laboratory course that include: (i)
the preliminary preparation of cytochrome c from a source; (ii) its consequential separation
from other proteins using liquid chromatography; (iii) investigating protein assays and
applying a standard curve, with construction of a protein purification table; and (iv)
estimating the molecular weight of cytochrome c by SDS-PAGE. Pre, post and attitudinal
studies will contribute to SoTL. This project will enhance the reality of - and student
perception of - how biochemistry is done in the real world.
CHED 281
Antimicrobial cyclic peptoids inducing transmembrane pore formation in
Staphylococcus aureus
Peter T Smith, [email protected], Mia Huang, Kent Kirshenbaum.Department of
Chemistry, New York University, New York, NY 10003, United States
Antimicrobial peptides (AMPs) are a large class of defense molecules in multicellular
organisms that exhibit broad and potent activity. We investigated the use of N-substituted
glycine oligomers, peptoids, as AMP mimics with similar low concentration antimicrobial
activities. The mechanism of action of AMPs varies, but many penetrate bacterial cell
membranes leading to leakage and death. Our antimicrobial cyclic peptoids demonstrate a
similar pore-formation mechanism against methicillin-resistant Staphylococcus aureus. We
observed that the minimum inhibitory concentrations of the peptoids increased with the
addition of polyethylene glycol to the cell suspensions, which protected from a loss of
osmotic balance. This decrease in antimicrobial activity was more significant with larger
osmoprotectants indicating that peptoids formed pores with initial diameters greater than
3.8 nm. Scanning electron microscopy was used to analyze cell membrane damage after
24 hours of peptoid treatment. These images revealed extensive membrane deformities
and pores reaching over 200 nm in diameter.
CHED 282
Chemical methods for the detection of cysteine sulfenic acid in biological systems
Travis J Brachtenbach, [email protected], Justin M Chalker.Department of
Chemistry and Biochemistry, The University of Tulsa, Tulsa, Oklahoma 74104, United
States
Regulation of reactive oxygen species is an essential function in cellular health. Disruption
in cellular redox regulation is a hallmark of atherosclerosis, cancer, neurodegenerative
disease, and aging. Therefore, it is critical to monitor the proteins that maintain redox
homeostasis. One such protein residue implicated in cellular redox maintenance is cysteine
sulfenic acid. Yet, despite its putative role as a messenger in redox regulation, very few
methods exist for its real-time analysis. Of the chemical probes used to detect cysteine
sulfenic acid, dimedone is the most widely used reagent. In this report, we disclose an
examination of dimedone selectivity and introduce alternative probes for the bioorthogonal
detection of cysteine sulfenic acid. Applications in the analysis of oxidative stress are
discussed.
CHED 283
Immunotoxic effects of undecafluoro-2-methyl-3-oxahexanoic acid in mouse models
Blake R Rushing1,2, [email protected], Jamie DeWitt1. (1) Department of
Pharmacology & Toxicology, Brody School of Medicine at East Carolina University,
Greenville, NC 27834, United States (2) Department of Chemistry, Catawba College,
Salisbury, NC 28144, United States
Perfluorinated compounds (PFC) are organic compounds where C-H bonds have been
replaced with C-F bonds. A new PFC named undecafluoro-2-methyl-3-oxahexanoic acid
(U2M3-OHxA) is a potentially less toxic replacement for current PFCs. Immunotoxicity was
tested using C57BL/6 mice that were exposed to 0, 1, 10, and 100 mg/kg of U2M3-OHxA
by gavage for 28 days. Body and organ weights were recorded and spleens were used for
immunophenotyping. Mice were immunized with sheep red blood cells on day 24 and
ELISAs were used to measure the IgM antibody responses. Results showed a loss in body
weight for females in the 100 mg/kg group, increased liver weight for 10 and 100 mg/kg
doses, increased thymus weight for the 100 mg/kg males, decreased splenic weight for
100 mg/kg females, a decrease in the CD45 (B cell) splenic lymphocytes for males in the 1
and 100 mg/kg dose groups, and no changes in IgM responses.
CHED 284
Antibiotic delivery from electrospun non-woven mats
Caitlin E. Pegg, [email protected], Amberleana D. Sweeney, Ruya R. Ozer, Justin
M. Chalker.Department of Chemistry and Biochemistry, The University of Tulsa, Tulsa,
Oklahoma 74104, United States
Antiobiotics and other pharmaceuticals containing a basic site can be easily conjugated to
alginic acid through an acid-base reaction. The resulting polymer can then be used to
prepare non-woven mats by electrospinning with a copolymer such as PVA. Presented
here is an examination of antibiotic release from these materials by a simple ion exchange
pathway and its effectiveness in inhibiting bacterial growth. Applications to wound
treatment and pain management are also discussed.
CHED 285
Drug release from electrospun nanofibers by ion exchange: A kinetic analysis
Amberleana D. Sweeney, [email protected], Caitlin E. Pegg, Ruya R.
Ozer, Justin M. Chalker.Department of Chemistry and Biochemistry, The University of
Tulsa, Tulsa, Oklahoma 74104, United States
Basic drugs and drug-like compounds were loaded onto alginic acid through an acid-base
reaction. The resulting polymer solution was electrospun with a PVA carrier polymer to
provide non-woven mats useful for biomedical applications. Presented here is a kinetic
analysis of drug release through an ion exchange mechanism. Application to wound
healing is also discussed.
CHED 286
Modified porphyrins for photodynamic therapy of triple-negative breast cancer
Taylor Neeley, [email protected], Jospeh E. Bradshaw, Timothy E.
Hayes.Department of Chemistry, Ouachita Baptist University, Arkadelphia, AR 71998,
United States
Photodynamic therapy (PDT) is a cancer treatment that kills cells using light, but there is a
need for improved PDT drugs. An ideal PDT drug exhibits high toxicity at low
concentrations in the light while showing low toxicity in the dark. It must be soluble in water
but must also demonstrate lipid solubility to cross the cell membrane. Seven new porphyrin
derivatives were compared to Foscan as photosensitizers on triple-negative breast cancer
cells. All were highly effective below 10 μM but none as low as Foscan, a drug in Stage II
clinical trials. All exhibited less dark toxicity than Foscan. The distribution coefficient (logD)
and cell uptake were measured for each derivative. No correlation was observed between
logD, uptake and the light and dark toxicities. Several of these compounds may be
candidates for PDT drugs since they are effective at low concentration but show reduced
dark toxicity compared to Foscan.
CHED 287
Synthesis of new RNA bases
Pandora E White1, [email protected], Stephen Woski2. (1) Department of
Chemistry and Physics, Alcorn State University, Alcorn State, Mississippi 39096, United
States (2) Department of Chemistry, University of Alabama, Tuscaloosa, AL 35487, United
States
Although there has been tons of work done on DNA nucleosides, very little work has been
done on RNA nucleosides. The purpose of this experiment was to synthesize a RNA
nucleoside with a carbazole base. The results of the experiments are indicative that β-1-(9carbazolyl)-ribofuranose has been synthesized.
CHED 288
Effects of sodium fluoride binding on the electrochemical properties of heme
proteins
Margaret H Roeder, [email protected], Danielle N Houchins, Emily J Amendola,
Jacquelyn D Castorino, Andrea L Fritz, Carmen X Guzman, Jose F Cerda.Department of
Chemistry, Saint Joseph's University, Philadelphia, PA 19131, United States
Heme proteins have a wide range of functions. The reactivity of the heme iron is important
in the function of the protein as well as the interaction between the heme cofactor and the
surrounding protein. In our research we use fluoride binding to the heme iron to understand
the behavior of a heme protein in the oxidized state. We have studied heme proteins such
as myoglobin (Mb), hemoglobin (Hb), and horse radish peroxidase (HRP), all of which
contain an important distal histidine which plays a specific role in each of these proteins.
UV/Vis spectroelectrochemical experiments performed on Mb at various pH show evidence
of the protonation of the distal histidine in the heme pocket of the protein with a pKa of 5.7.
Moreover, pH dependence of fluoride binding to Mb, Hb, and HRP demonstrate ionization
of the distal histidine in Mb and Hb, but not in HRP.
CHED 289
jhp1130 from H. pylori J99 is a HAD phosphatase
Aubree Albert, [email protected], Anne Roberts.Chemistry, Western
Connecticut State University, Danbury, CT 06810, United States
Helicobacter pylori is a gram-negative bacterium that colonizes the human stomach and
causes gastric ulcers. Although the H. pylori genome has been sequenced, the functions of
many of H. pylori's genes are not yet known. The gene jhp1130 has been identified as a
member of the HaloAcid Dehalogenase (HAD) superfamily. The presence of three
conserved sequence motifs indicates that the jhp1130 protein likely functions as a small
molecule phosphatase. We have cloned, expressed, and purified the protein and have
tested its activity against a variety of small molecule phosphorylated substrates. The goal
of this research is to determine the metal ion dependence, pH dependence, and the true in
vivo substrate and metabolic function of the jhp1130 enzyme.
CHED 290
What makes Lyme disease tick? Characterization of an essential global regulator in
Borrelia burgdorferi
Elisabeth A Geyer, [email protected], Sarah E Evans.Department of Chemistry
and Biochemistry, Canisius College, Buffalo, NY 14208, United States
Caused by the bacteria Borrelia burgdorferi, Lyme disease is the fastest growing and most
common tick-borne illness in the United States. Vital to the survival of B. burgdorferi in ticks
and vertebrates, Borrelia oxidative stress regulator, BosR, is a regulatory transcription
factor that functions to activate and repress nearly 80 genes, including genes for DNA
protection from damage during starvation or oxidative stress and control over the
expression of outer membrane proteins. To-date, little has been discovered about the
important role and types of metal ions that are thought to function in the regulatory pathway
of BosR. In this work, focus is placed on the preparation, purification and characterization
of the protein, as well as initial analysis of BosR by metal binding titrations with UV-Visible
spectroscopy. Electromobility shift assays and fluorescence anisotropy assays are also
analyzed to investigate DNA binding properties and possible classification of a Bos box.
CHED 291
Metabolic regulation of terpenoid biosynthesis in rhodospirillum rubrum
Brittany Hemelgarn, [email protected], Francis Mann.Department of
Chemistry, Winona State University, Winona, MN 55987, United States
Rhodospirillum rubrum is a bacterium that has the metabolic versatility to produce energy
through four different pathways: fermentation, photosynthesis, nitrogen-fixation and cellular
respiration.R. rubrum can synthesize terpenoids that are utilized in energy production and
other cellular functions. Different terpenoids are produced depending on what energy the
environment provides which indicates that the biosynthetic gene expression differs in
different metabolic conditions. Only four non-carotenoid synthase terpenoid biosynthetic
genes exist in the R. rubrum genome. Our goal is to study the function and expression of
these genes that are involved with the biosynthesis of terpenoids. Understanding the
metabolic process of R. rubrum will assist in improving the efficiency of modern-day
cyanobacteria and lower the cost of engineered molecules.
CHED 292
Determination of lachesin as a cell surface receptor protein for flock house virus
using gateway cloning in Saccharomyce cerevisiae
Jason Blanks, [email protected], Amy Odegard.Department of Chemistry, University of
Puget Sound, Tacoma, WA 98406, United States
The simplicity of the Flock House virus (FHV) capsid and genome, along with the wealth of
available structural information, make FHV an excellent model system for studying viral
infection. Lachesin, a receptor protein in Drosophila, has been proposed as the receptor
protein required for FHV to infect Drosophila. Still, no conclusive evidence demonstrating
FHV binging to lachesin has been presented. In my research, I will use Gateway cloning to
demonstrate that a) lachesin does bind FHV and b) lachesin is necessary for FHV
infection. Once the receptor protein for FHV is determined, the interactions between FHV
and the receptor can be characterized. This will lead to a better understanding of how FHV
and other non-enveloped viruses, that cause serious human disease, infect host cells.
CHED 293
Evidence for the role of a novel histone mark in hippocampal neurogenesis
Anna Weinstein1,2, [email protected], Miriam E.R. Baker2, Christina M. Hughes3,
David Allis3, Bruce S. McEwen2, Richard G. Hunter2. (1) Stern College for Women,
Yeshiva University, New York, NY 10016, United States (2) Laboratory of
Neuroendocrinology, The Rockefeller University, New York, NY 10065, United States (3)
Laboratory of Chromatin Biology, The Rockefeller University, New York, NY 10065, United
States
Epigenetics is the study of processes that regulate gene expression without altering the
actual DNA sequence. Entailed in such processes are various modifications, which impact
the genome while preserving nucleotide sequence. Since epigenetic information is often
contingent on something as transient as stress, it is said to be susceptible to environmental
conditions, making it an important link in broadening our understanding of how the
environment impacts physiological function. Studies have shown that stress decreases
neurogenesis in the hippocampal region. In order to examine the effects of chronic stress
on the putative mitotic histone mark H3 Serine 57 phos (H3S57p), we performed a series
of Light Immunocytochemistry (ICC) protocols on hippocampal sections from wild type and
stressed mice. The results so far indicated a lower level of the H3S57p mark in the
stressed hippocampal sections, indicating the possibility that it is indeed a mitotic marker
affected by chronic restraint stress.
CHED 294
Comparison of breast cancer and osteosarcoma secretomes and lysates using LCMS/MS
Crystal L Daniels1,2, [email protected], Lewis K Pannell2. (1) Spring Hill College,
Mobile, AL 36608, United States (2) Mitchell Cancer Institute, University of South
Alabama, Mobile, Al 36604, United States
A study of the secreted proteins, the secretome, can provide insight into what proteins are
functioning in the microenvironment of a cell. Secretome studies have the potential to
identify more specific biomarkers than that of serum protein studies, due to the proximity of
the sample. Secreted proteins are present in relatively low abundances and are easily
masked by cytosolic and serum proteins. Secretome isolation is vital for using the
secretome as a source for biomarker discovery. Comparison of secretomes to lysates
helps to assess the effectiveness of the collection method at limiting protein contamination.
MBA-MD-231Her2 secretome analyses revealed that approximately 56% of the proteins
identified were secreted via the non-classical or classical method. Comparatively, 52% of
proteins were identified as being secreted by the U2OS cell line. The method used was
effective in isolating the secreted proteins and limiting the amount of intracellular and
serum protein contamination.
CHED 295
Species and growth optimization of algal biofuel feedstocks
Brynn Umbach, [email protected], Erin Gehlhausen, Charles R. Sweet.Department of
Chemistry, United States Naval Academy, Annapolis, MD 21402, United States
To develop algal feedstocks with enhanced biofuels potential, we examined the lipid
content of extremophilic algae, including novel strains isolated by winter bioprospecting of
the Chesapeake Bay. To assess the potential of these algae, we examined them in
comparison to the model organism Chlorella. The algal fatty acid profiles, characterized
from hydrophobic Bligh-Dyer extracts by FAME (fatty acid methyl ester) GC-MS, show
similarities to other algae but also significant differences which may result in favorable fuel
characteristics. These differences include an unusual acyl population in the
acidothermophile Galdieria sulphuraria, which contains unsaturated and polyunsaturated
20-carbon fatty acids. In addition we have compared the lipid content of these organisms
under a variety of growth conditions and lipid isolation techniques, and have also used
MALDI-TOF mass spectrometry to examine the total lipid composition of these algae and
gain a more comprehensive understanding of their lipid content.
CHED 296
Analysis of volatile organic compounds in the desert shrub Larrea tridentata
(creosote bush)
Luis Alcala, [email protected], Mary A. Kopecki-Fjetland.Department of Chemistry,
St. Edward's University, Austin, TX 78610, United States
Larrea tridentata, creosote bush, is a desert shrub found in dry, arid regions of North
America, and the most common desert shrub in the Southwest. This drought resistant
woody perennial becomes part of the main source of food for mammalian herbivores during
the dry season. The leaves and berries of L. tridentata produce and emit phytogenic
volatile organic compounds (PVOC) which may have an effect on the grazing patterns of
desert herbivore populations. This research aims to analyze the exact PVOC profile of L.
tridentata. To date identified PVOCs include limonene, camphor, alpha-cedrene, ARcurcumene and (E)-nerolidol. Current research is focusing on identifying additional PVOCs
contained in L. tridentata using sold-phase microextraction (SPME), gas chromatographymass spectrometry, and retention indices.
CHED 297
Black band disease (BBD): Pigment characterization and reactive oxygen species
(ROS) production and evolution assay development
Kymberlee A Osborne1, [email protected], Kathleen Rein1, Miroslav
Gantar2, Martin Quirke1, Ian Campa3, Laurie Richardson2. (1) Department of Chemistry
and Biochemistry, Florida International University, Miami, Florida 33199, United States (2)
Department of Biology, Florida International University, Miami, Florida 33199, United
States (3) Department of Chemistry, Columbia University, New York, New York 10027,
United States
Reefs are integral to world economies contributing to food sources and tourism of coastal
communities, serving as nurseries and habitats for marine life, and as a source of oceanic
photosynthetic activity. Black band disease (BBD) is a cyanobacterial dominated
polymicrobal disease, killing framework building coral. This investigation focused on
characterizing major pigments of some BBD cyanobacteria, including identifying and
quantifying pigments contributing to the dark, or black, appearance of BBD. BBD
cyanobacterial pigments identified were compared with that found in non-BBD
cyanobacterial strains. Additionally, we investigate the production of reactive oxygen
species (ROS) by BBD cyanobacteria. Pigment analysis points to chlorophyll a, pheopytin
a, phycocyanin, and phycoerythrin. Since some photosensitize, cells exposed to solar
irradiation should produce and excrete ROS. Initial ROS analysis indicates that cellular
ROS production and evolution occurs at a higher rate in cyanobacterial cells that have
been subjected to solar irradiation relative to dark controls.
CHED 298
Detection of caspase 3 activity in Chinese hamster ovarian cells after treatmeant
with Morinda citrifolia (Noni) extract
Nicole M. Yordán-López, [email protected], Lizette Santos-Santori.Department of
Chemistry, Pontifical Catholic University of Puerto Rico, Ponce, Puerto Rico 00717, Puerto
Rico
Apoptosis is a genetically controlled process by which a cell dies naturally. It is initiated
through activation of effector Caspases 3/7. Morinda citrifolia is used as a dietetic
supplement because of its antioxidant, anti-inflammatory and hepatoprotective properties.
Noni shell extracts, aqueous and organic, and pulp extract were prepared. CHO cells were
cultured. After treatment with the plant's extracts for a 96-hour period, a colorimetric
substrate was applied and incubated for four hours at 37ºC. Absorbance measurements
were determined. Preliminary results were 0.00050 pmol/µL for pulp, 0.00480 pmol/µL
aqueous extract, and 0.0100 pmol/µL for organic extract. Results suggest organic extract
from Noni shell had and inductive effect on Caspase 3 activity. Other assays will be
conducted to verify these results and establish specific conclusions.
CHED 299
DNA phosphate crowding correlates with protein cationic side chain density and
helical curvature in protein/DNA crystal structures
Bryce Grant, Jayme Arameda, [email protected], Madison Throneberry,
[email protected], Elizabeth Dourlain, Lori Isom.Department of
Chemistry, University of Central Arkansas, Conway, AR 72035, United States
DNA flexibility is crucial in many biological functions including protein/DNA recognition,
gene transcription, and DNA packaging inside the cell. This project investigated the indirect
readout relationship between cation-induced phosphate collapse and DNA bending.
Phosphate crowding around high density cationic protein residues in protein/DNA
complexes was considered. In this project, crystal structures of protein/DNA complexes
with resolution of 2.5Å or higher were selected from the PDB. Structures containing DNA
breaks and modified bases were excluded. Each structure matching the criteria was then
analyzed and assigned two crowding functions for each phosphate oxygen: one quantifying
each phosphate's crowding with respect to other phosphates and one quantifying the
cation density. The correlation between phosphate crowding and cation density was
calculated for each structure and compared to the type of DNA distortion present in the
complex.
CHED 300
Deletion of the yhfR gene in Bacillus subtilis and its effects on isoprene and
methylbutanol production
Tyler S Beyett, [email protected], Tami L Sivy.Department of Chemistry, Saginaw Valley
State University, University Center, MI 48710, United States
Isoprenoids are produced via the mevalonic acid (MVA) and methylerythritol phosphate
(MEP) pathways and are among the most valuable secondary metabolites. Isoprenoids
with medicinal value have proven extremely difficult to synthesize and microbial production
has been complicated due to cell death as a result of the buildup of toxic precursors in
engineered cells. Bacillus subtilis exhibits a greater tolerance towards these toxic
precursors than E. coli, possibly due to the presence of the yhfR gene, whose enzymatic
product is thought to be responsible the detoxification of pathway intermediates. We
replaced the yhfR gene with a spectinomycin resistance cassette, confirmed by qPCR and
sequencing, and have analyzed methylbutanol and isoprene production in engineered and
wild-type cells. Our research aims to determine whether the enzyme coded for by yhfR
plays a role in the conversion of toxic precursors to volatile compounds that can be
released into the environment.
CHED 301
Comparison of coralsnake venom components between individuals
Sloane Zimmerman, [email protected], Randall A. Kopper.Department of Chemistry,
Hendrix College, Conway, AR 72032, United States
Snakes utilize their venom, a mixture of multiple proteins and enzymes, for protection and
prey acquisition. One of the most toxic enzymes found in coralsnakevenom is
phospholipase A2. In order to investigate the variation in venom composition between
individual coralsnakes, venom samples from 13 coralsnakes were analyzed for total protein
concentration, their electrophoretic protein profile, and their specific phospholipase A2
enzyme activity. Most previous studies of venom components have been performed using
pooled samples comprised of venom from multiple individuals. While using pooled venom
provides a larger volume of sample to work with, it masks individual variances. This
analysis of venom from 13 coralsnakes demonstrates the differences between individuals
of this species. Preliminary results indicate a significant inverse relationship between
venom volume and total protein concentration. Although the electrophoretic profiles appear
similar, the specific enzyme activities vary dramatically.
CHED 302
Metal ion cofactor requirements for phospholipase A2
Jessica Hook, [email protected], Randall A. Kopper.Department of Chemistry, Hendrix
College, Conway, AR 72032, United States
Phospholipase A2 is an enzyme that hydrolyzes glycerophospholipids, cleaving free fatty
acids from the second carbon on the glycerol molecule. Phospholipase is the main
contributor to the neurotoxicity of snake venoms, such as coralsnake venom. In its native
form, the phospholipase A2 holoenzyme contains calcium as the divalent metal ion
cofactor. In this study, the endogenous calcium ion was removed and other divalent metals
were tested as possible replacements for calcium. Various metals were tested for their
ability to function as a replacement cofactor to activate the enzyme and for their binding
affinity in comparison to calcium. The chelating agent EDTA was used to sequester the
calcium from phospholipase A2, allowing their replacement with other divalent metals. The
results of the study will reveal whether metals other than calcium can active the enzyme,
and through binding competition studies indicate the relative binding affinity of the enzyme
for various metal ions.
CHED 303
Adsorption of snake venom proteins by activated charcoal
Olivia R. Urbanowicz, [email protected], Randall A. Kopper.Department of Chemistry,
Hendrix College, Conway, AR 72032, United States
Over 7,000 people receive venomous snakebites in the United States each year; one in
five of those are from rattlesnakes. The Diamond-Backed Rattlesnake (C. atrox) venom
contains hydrolytic enzymes including proteases and phospholipase A2 that produce
severe symptoms such as necrosis and paralysis and may be fatal if not treated quickly.
Activated charcoal is currently the most common emergency treatment for ingested
poisons. This study investigates the use of activated charcoal for the adsorption of
rattlesnake venom proteins to reduce hydrolytic enzyme activity. Venom samples were
incubated with increasing amounts of activated charcoal and then centrifuged to remove
the charcoal. The resulting solutions were analyzed by gel electrophoresis, total protein
determination and enzyme activity assay. The results will determine the efficacy of using
activated charcoal as a potential treatment option for snakebites before emergency medical
care is available.
CHED 304
Visualizing the effects of mutations in Scytovirin
Charity Haggenmaker, [email protected], Robert L. McFeeters.Department of
Chemistry, University of Alabama in Huntsville, Huntsville, Alabama 35899, United States
The carbohydrate binding protein Scytovirin acts as an antiviral entry inhibitor. Structural
engineering has been used to improve Scytovirin's ability to protect against the HIV-1
infection. 15N-HSQC spectra for Scytovirin and eleven mutant forms were analyzed. The
changes in chemical shift caused by mutating one amino acid were mapped onto the
structure. Resonances were assigned by inspection and categorized by the magnitude of
the chemical shift change. It was determined that mutations in various regions were more
likely to affect the protein core than others. Overall, Scytovirin is structurally resistant to
amino acid changes, opening the possibility of structural engineering to reduce cost and
increase efficacy.
CHED 305
Putative Rhodospirillum rubrum squalene hopene cyclase (A0062) characterization
Kevin L Vickerman, [email protected], Francis M Mann.Department of
Chemistry, Winona State University, Winona, Minnesota 55987, United States
Rhodospirillum rubrum terpene synthase (Rru_A0062) has an unclear function and activity.
Commonly present in bacteria, squalene cyclase converts squalene a triterpene into a
hopanoid. Isoagathenediol a cyclized diterpene component in R. rubrum membrane is
potentially converted from the same synthase. The lack of analysis of the putative
Rhodospirlillum rubrum squalene hopene cyclase (RrSHC) in Rhodospirillum rubrum ATCC
11170 is the reason for our examination of the bioactivity. RrSHC putative dual function as
a diterpene and triterpene synthase has not been previously demonstrated. For our
examination we utilized cloning and expression RrSHC in Escherichia coli. The activity of
RrSHC was approached with crude lysed cells analyzed with GC-MS to track product
formation in the presence of either geranylgeranyl pyrophosphate or squalene. A more
detailed analysis was attempted on the purified protein. In this analysis, we cloned,
expressed, purified, and determined enzymatic parameters of the putative squalene
hopene cyclase from Rhodospirillum rubrum.
CHED 306
Studies of mTOR and its substrates in Kirsten virus-transformed murine fibroblasts
Carolina Mendoza, [email protected], Kerry Bruns.Department of Chemistry
and Biochemistry, Southwestern University, Georgetown, Texas 78627, United States
The mTOR signal transduction pathway in Kristen virus-transformed murine embryonic
fibroblast (KBalb) was studied. Regulatory proteins and phosphoproteins associated with
this pathway were identified in different cell fractions and compared to the levels detected
in the parental cell line (Balb 3T3). In KBalb cells, mTOR and its regulatory proteins (Rictor,
Raptor, and GβL) appeared to be present at higher levels than Balb 3T3 cells. These
regulatory proteins are important in mTOR's interaction with downstream targets. Sites on
mTOR phosphorylated by Akt also appeared to be different between the two cell lines.
Rictor-mTOR complex phosphorylates Akt at Serine 473, which is necessary for the
phosphorylation of Akt at Threonine 308 by PDK1 and its full activation. The increased
levels of Rictor and mTOR proteins and the increased phosphorylation of Akt at Serine 473
and Threonine 308 support this idea that mTOR is more active in K-ras transformed cells.
CHED 307
Molecular mechanisms underlying the function of the cancer-associated protein,
NURP1: A computational biochemistry study
Raul Urrutia1, Gabriel Velez1,2, [email protected], Marisa Lin1, Gwen Lomberk1, Jose
Luis Neira3, Juan Iovanna4. (1) Translational Epigenomics Program, Center for
Individualized Medicine, Mayo Clinic, Rochester, Minnesota 55902, United States (2)
Department of Chemistry, Winona State University, Winona, Minnesota 55987, United
States (3) Cell and Molecular Biology Institute Miguel Hernández, Elche University,
Alicante, Spain (4) Cancer Research Center of Marseille, Institute Paoli-Calmettes, AixMarseille University, Marseille, France
NURP1 is protein that plays critical roles in cancer development, progression, and
resistance to therapy. Its mechanism of action is postulated to rely on its ability to undergo
cytoplasmic-to-nuclear translocation, bind DNA and regulate gene expression. NURP1
binds to DNA in vitro and regulates gene expression networks in vivo. This data has guided
efforts to solve the structure of DNA-bound NURP1 in order to develop models to guide the
design of drug inhibitors. Previous studies have suggested that NURP1 may be a member
of the High Mobility Group of chromatin proteins, but have not provided a model of the
NURP1-DNA complex. Here we report the first structural models for both the large and
small form of NURP1. Our results show that NURP1s share characteristics yet are distinct
from their closely related homolog. These models should be taken into consideration when
designing small drugs aimed at controlling the function of NURP1s.
CHED 308
Effect of Morinda citrifolia on the erythromicyn-N-demethylase and cytochrome P450
activity
Maria del Mar Morales1, [email protected], Lizette Santos-Santori2. (1)
Deparment of General Science, Pontifical Catholic University of Puerto Rico, Ponce,
Puerto Rico 00717, Puerto Rico (2) Deparment of Chemistry, Pontifical Catholic University
of Puerto Rico, Ponce, Puerto Rico 00717, Puerto Rico
Morinda Citrifolia also known as Noni has a long history of use as a medicinal plant
because of its antioxidant, anti-inflamatory and hepatoprotective properties. To determine
Noni effect in Cytochrome P450 isoenzymes, aqueous and organic extractions from the
seeds and the skin were prepared. Extracts were analyzed by HPLC. CHO cells were
treated for 48 hours. Microsomes were prepared. Protein and erythromicyn-N-demethylase
assays were perfomed. Enzyme activity was determined to establish the effect of Noni in
the system. Results showed a low concentration of protein in the experimental groups:
0.0306µg/ml (pulp), 0.0306µg/ml (aquous skin extract) and 0.0305 µg/ml (organic skin
extract). Results from the erythromicyn-N- demethylase assay showed no activity. Results
suggest a decrease in activity.
CHED 309
Structural and functional determination of the polysaccharide deacetylase BC0361
Elitsa I Stoyanova, [email protected], Kathryn E Cole.Department of Chemistry and
Biochemistry, Ithaca College, Ithaca, New York 14850, United States
The gene bc0361 encodes for a polysaccharide deacetylase, which is part of the
carbohydrate esterase family 4 (CE 4). All members of this family share a conserved (α/β)8
barrel fold and a divalent metal ion (most commonly zinc) associated with the active site.
This particular enzyme helps bacterial cells become “invisible” by removing the acetyl
groups from membrane sugars, which are recognized by the host immune macrophages.
Inhibition of this enzyme would disable the defensive mechanisms of the bacteria, which is
a possible route for antibiotic drug development. Crystals of the native protein have been
obtained, and crystallization of enzyme-inhibitor complexes is currently in progress.
CHED 310
Structural elucidation of histone deactylase 8 with "linkerless" hydroxamic acid
inhibitors
Rochelle J. Frankson, [email protected], Kathryn Cole.Department of Chemistry and
Biochemistry, Ithaca College, Ithaca, NY 14850, United States
Histone deacetylases (HDACs) catalyze the deacetylation of both histone and non-histone
proteins. The catalysis of this reaction is critical to many cellular processes such as cell
differentiation, senescence, and apoptosis. As such, aberrant HDAC activity is linked to the
proliferation of certain diseases such as cancer, validating the use of histone deacetylase
enzymes as targets for drug design. Two HDAC inhibitors, suberoylanilide hydroxamic acid
(SAHA), and Romidepsin have already been approved for use as cancer chemotherapy
agents while several others are under clinical trial. Numerous small molecules have been
developed to inhibit HDAC8. Included in this array are 'linkerless' hydroxamic acids that
present potencies on the micromolar scale (IC50: 0.3 mM – 66.0 mM). Here, we report the
findings of the enzyme-inhibitor structural investigation of six of these hydroxamic acid
inhibitors.
CHED 311
Small molecules as potential regulators of quorum sensing
Nicholas Dragotakes, [email protected], Emily Garcia Sega.Department of
Chemistry, Ithaca College, Ithaca, New York 14850, United States
Quorum sensing (QS) is a population-density dependent form of inter-cellular bacterial
communication. Pseudomonas aeruginosa uses QS to coordinate pathogenic aggression
against hosts whose immune systems have already been compromised. The natural acyl
homoserine lactone (AHL) autoinducer of P. aeruginosa binds to the LasR receptor,
activating transcription of virulence genes. Variations within the acyl chain of AHL
autoinducers has been extensively researched. Recently, a triphenyl scaffold, which is
structurally unrelated to the natural AHL autoinducer, has shown binding capability to
LasR. We sought to design new QS regulators which incorporate modifications of both the
triphenyl and acyl substituted scaffolds. The synthesis of these compounds takes
advantage of a modular synthetic route and aims to further explore the interactions within
the LasR ligand binding domain. Synthesized compounds are then analyzed for QS
regulation in a LasR GFP reporter assay.
CHED 312
Identifying proteins that bind to UBE2Q2 and exosome component 7
Crista E. Riggs1, [email protected], Kimberly Hammock2, David F. Crawford2. (1)
Department of Chemistry, Ouachita Baptist University, Arkadelphia, AR 71998, United
States (2) Department of Pediatric Hematology and Oncology, University of Oklahoma
School of Medicine, Oklahoma City, OK 73104, United States
Proteins that regulate mitotic checkpoint function are highly important in cancer research.
Mitotic checkpoints are essential to normal cell cycle regulation, and they allow cells to
correct threats to genomic integrity in order to decrease the risk of developing
malignancies. UBE2Q2 is an ubiquitin-conjugating enzyme that is thought to antagonize an
early mitotic checkpoint in HeLa cells. It is predicted that UBE2Q2 over-expression
promotes the development of malignancies. When the expression of UBE2Q2 is inhibited,
cells become more sensitive to treatment with chemotherapy agents and become
suspended in prometaphase, causing apoptosis to occur. Previous studies concluded that
another protein, Exosome Component 7 (ExoC7), interacts with UBE2Q2. Both epitopetagged UBE2Q2 and ExoC7 were expressed and affinity purified, and putative UBE2Q2and ExoC7-binding proteins were found. These proteins could be essential to developing
new cancer therapy drugs and useful for better understanding the role of mitotic checkpoint
function in cancer.
CHED 313
Effect of chironja on cytochrome P450 system of CHO cells
Natalia S Fernández Dávila1, [email protected], Lizette Santos2. (1) Department of
Biology, Pontifical Catholic University of Puerto Rico, Ponce, Puerto Rico 00717, Puerto
Rico (2) Department of Chemistry, Pontifical Catholic University of Puerto Rico, Ponce,
Puerto Rico 00717, Puerto Rico
Previous investigations agree that different isoenzymes from the Cytochrome P450 System
can be affected by a variety of compounds present in grapefruit. 'Chironja', being a hybrid
between orange and grapefruit, can probably interact with the Cytochrome P450 System.
Extractions from the fruit and the skin were performed. The extracts were analyzed by
HPLC and CHO cells were treated for 48 hours with the chironjas' extracts. Microsomes for
each group were prepared. Protein and erythromycin N-demethylase assays were
performed. Protein concentration and ERDN activity were higher in the sample treated with
the aqueous extract with values of 0.0401µg/ml and 3.399nmol/min/mg respectively.
Further studies are being conducted in order to establish the effect of the different
Chironja's extracts on the isoenzymes.
CHED 314
Exploring cutting edge biotechnology: A cloning blueprint of serine
carboxypeptidase II
Perouza Parsamian, [email protected], Mary A. Kopecki-Fjetland.Department of
Chemistry, St. Edward's University, Austin, TX 78704, United States
Serine Carboxypeptidase II (SCP) is a proteolytic enzyme that cleaves the C-terminal
residue of polypeptides and is primarily found in species of yeast, more specifically
Sacchromyces cerevisiae. SCP contains a catalytic triad consisting of histidine, aspartate,
and serine. A similar enzyme, Serine Endopeptidase, cleaves within the polypeptide
through a catalytic triad analogous to that of SCP. An association to both structures of
enzymes and an alteration to their functions suggest an example of convergent evolution.
To determine this evolutionary phenomenon between two catalytic enzymes, kinetic
studies need to be conducted. SCP from S. cerevisiae was amplified and ligated into the
pGEM-T nonexpression vector. SCP was then reisolated and ligated into the pET-32C
vector. Currently potential clones are being analyzed for the presence of the SCP gene
using restriction endonucleases and sequencing. Future work includes purification of the
fusion protein followed by kinetic studies.
CHED 315
Evaluation of the role of disulfide crosslinkages in lysyl oxidase via site-directed
mutagenesis
Megan A. Smith, [email protected], Karlo M. Lopez.Department of Chemistry,
California State University, Bakersfield, Bakersfield, CA 93311, United States
Lysyl oxidase is a copper-dependent amine oxidase that plays an important role in
catalyzing the oxidation of amino groups in the proteins, collagen and elastin. The
catalyzed process results in aldehyde molecules, which is essential in the production of the
crosslinkages in these proteins. There are few studies involving the use of native lysyl
oxidase from bovina aorta, which provides structural properties, specifically the connectivity
of the five-disulfide linkages. The main focus of this study is to investigate the role each
disulfide bond has on lysyl oxidase. A LOX mutant, C238S, was generated via PCR
mutagenesis program. Overexpression of this mutant yielded 16.01mg of enzyme per liter
of media. Total copper incorporation is currently being calculated. There was no catalytic
activity for this mutant when compared to the wildtype. A redox cycling assay was
performed, which confirms that a quinone is present even when one disulfide linkage was
removed.
CHED 316
Overexpression and characterization of NusA tagged lysyl oxidase
Madison A Smith, [email protected], Karlo M. Lopez.Department of Chemistry,
California State University, Bakersfield, Bakersfield, CA 93311, United States
Lysyl oxidase is a copper-dependent enzyme that plays an important role in the cross
linkages on elastin and collagen in connective tissues and other biological systems. The
crystal structure of LOX has never been observed mainly due to the low solubility of the
enzyme and the high levels of urea required to solubilize the enzyme. Crystallography
cannot be accomplished if urea is present because the concentration of urea is much
greater than that of the enzyme. To increase the solubility of LOX without the use of urea,
the enzyme was co-expressed with a NusA solubility tag and purified using an aqueous
buffer with the absence of urea. Overexpression of this enzyme with the solubility tag
yielded 2.7mg of protein per liter of media. Total copper incorporation was calculated to be
68%. Average specific catalytic activity was calculated to be 0.1065 units/mg of enzyme.
CHED 317
Model for small heat shock protein inhibition of polyglutamine aggregation
Carley Little, [email protected], Eamonn Healy.Department of Chemistry and
Biochemistry, St. Edward's University, Austin, TX 78704, United States
The polyglutamine (polyQ) repeat disease family is a CAG trinucleotide repeat expansion
in the protein-coding region that results in expression of an expanded polyQ domain.
Huntington's disease and the spinocerebellar ataxias (SCAs) are within this family, where
polyQ expansion leads to the formation of fibrillar protein aggregates, causing neuronal cell
death. With a threshold exceeding 52 glutamines, ataxin-3, the causative agent of SCA3,
triggers formation of intranuclear aggregates. αB-crystallin is a small heat shock protein
that suppresses SCA3 toxicity, likely by forming a transient aB-crystallin/ataxin-3 complex.
After performing extensive simulations of the interaction of human αB-crystallin and ataxin3, we predicted an energy-preferred complex; the bioactive peptides FSVN and HEER
were identified through analyzing solvent-accessible backbone hydrogen bonds. Using
AutoDock to run docking simulations, it was found that FSVN and HEER complexed with
the ataxin-3 much like the human αB-crystallin/ataxin-3 complex, implicating the formation
of a weak yet effective transient complex.
CHED 318
Heme loss in myoglobin and hemoglobin in the presence of fluoride
Danielle N Houchins, [email protected], Brady O Werkheiser,
[email protected], Margaret H Roeder, Katherine C McGovern, Victoria C
Angelucci, Jose F Cerda.Department of Chemistry, Saint Joseph's University, Philadelphia,
PA 19131, United States
Myoglobin (Mb) and hemoglobin (Hb) have very similar roles in that both proteins bind
oxygen. The heme-bound oxygen is stabilized through hydrogen bonding from the distal
protonated histidine. We have recently used fluoride ion in our research to understand the
role of the distal histidine in the ferric state of heme proteins. Our study at various pH
shows that the heme-bound protein to heme loss transitions in ferric Mb and Hb occur at a
pKa of 4.5. However, in the presence of fluoride ion, the heme loss transitions in both of
these proteins are shifted to a pKa of 4.2. This shows that the heme-bound fluoride
stabilizes the ferric state by being a better hydrogen acceptor than the water ligand.
CHED 319
WITHDRAWN
CHED 320
Staphylococcus aureus putative GcpMB protease can cleave specific host tissues
and proteins
Gabriel Spencer1, [email protected], Marsalis Brown1, Brianna Moncur1, Conwin
Vanterpool1, Kenneth LaiHing2, Elaine Vanterpool1. (1) Department of Biological Sciences,
Oakwood University, Huntsville, Alabama 35896, United States (2) Department of
Chemistry, Oakwood University, Huntsville, Alabama 35896, United States
Staphylococcus aureus infections have been a growing concern in the medical community.
Some strains of S. aureus are becoming resistant to treatment resulting in fatalities. Thus,
it is imperative that we identify the mechanisms utilized by S. aureus to induce host
damage. In this study, we have identified, cloned, and expressed a putative Gcp protease
of S. aureus. We hypothesize that GcpMB may be associated with virulence of S. aureus.
Purified rGcpMB was incubated with homogenized Fisher 344 rat cardiac, gingival and
brain tissues. In addition, rGcpMB was incubated with collagen, elastin and asioalofetuin.
rGcpMB is shown to selectively degrade host gingival epithelium and cardiac tissues.
rGcpMB also degrades/cleaves collagen. Asialofetuin and brain tissue samples were not
degraded or cleaved by rGcpMB. In conclusion, data from our lab suggests that this
putative protease may be associated with virulence of the organism by selectively
degrading host proteins.
CHED 321
Putative GcpMB can interact with virulence factors of Staphylococcus aureus
Ashlea Hendrickson1, [email protected], Gabriel Spencer1, Marsalis
Brown1, Brianna Moncur1, Kenneth LaiHing2, Elaine Vanterpool1. (1) Department of
Biological Sciences, Oakwood University, Huntsville, Alabama 35896, United States (2)
Department of Chemistry, Oakwood University, Huntsville, Alabama 35896, United States
Methicillin-Resistant Staphylococcus aureus (MRSA) infections have been incurable by
many antibiotics. It is imperative that we elucidate the virulence mechanisms of S. aureus.
The virulence factors are capable of causing damage to the host. Other factors such as
chaperones may be needed to assist in host invasion. Previously, we hypothesize that the
putative protease GcpMB may be involved in virulence. The purpose of this study is to
identify the mechanisms of GcpMB and their possible associations with the virulence
factors of S. aureus. Protein interaction studies and immunoblot analysis show that
rGcpMB physically interacts with the serine protease/chaperone HtrA and cysteine
protease ScpA of S. aureus. This suggests that GcpMB may share a common pathway
with the virulence factors of S. aureus. In conclusion, GcpMB may be involved in the
production, processing or maturation of important S. aureus virulence factors.
CHED 322
Effect of TCDD on gene expression of estrogen synthesis enzyme aromatase using
real time qPCR
Elizabeth F Ebensperger, [email protected], Gregory T Marks.Department of
Chemistry and Biochemistry, Carroll University, Waukesha, WI 53186-5518, United States
2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is a manmade environmental contaminant that
is produced during the synthesis of chlorophenols, which are used in herbicides and
fungicides. TCDD is an endocrine disruptor that can affect the reproductive system and has
been reported to have both estrogenic and anti-estrogenic effects. Estrogens are important
hormones that are responsible for sexual development in females and are members of the
steroid hormones family. Recent studies show that TCDD's effects start in the ovary,
reducing fertility, impairing ovulation, and causing anatomical defects that are not yet fully
understood. Female human granulosa cells dosed with TCDD were studied using real time
quantitative polymerase chain reaction (RT-qPCR) to determine if levels of aromatase
expression, an enzyme key to the estrogen synthesis pathway, relative to the
housekeeping gene ribosomal protein L13 (RPL13) were affected and are contributing to
the disruption of the female human reproductive system.
CHED 323
Effects of ajulemic acid on VEGF production: Relevance to angiogenic potential in
Ewing's sarcoma
Ryan K. James1, [email protected], Elizabeth Blankenship1, Amy Eubanks1, Rob J.
Griffin2, Lori L. Hensley1. (1) Department of BIology, Ouachita Baptist University,
Arkadelphia, AR 71998, United States (2) Department of Radiation Oncology, University of
Arkansas for Medical Sciences, Little Rock, AR 72205, United States
Ewing's Sarcoma is an aggressive pediatric bone cancer common in teenagers and young
adults. It is potentially the most lethal of all bone tumors with a 30% survival rate. Ajulemic
Acid (AJA) offers a potential solution to this problem. Our data show this compound
successfully kills Ewing's sarcoma cells as well as several other pediatric tumor cell lines in
vitro, and we have seen complete tumor regression in approximately 33% of our treated
mice. Our data demonstrate that ajulemic acid inhibits the migration of tumor cells and
endothelial cells, the cells that line blood vessels and direct their growth. Our aim for this
study is to determine the mechanism through which AJA inhibits angiogenesis by looking
specifically at its effects on Vascular Endothelial Growth Factor (VEGF) levels. VEGF is a
protein secreted by cells to promote angiogenesis, our hypothesis was VEGF is to be
inhibited by AJA.
CHED 324
Increasing the permeability of Burkholderia cenocepacia by inserting targeted
genomic mutations
Tyler Y Miyawaki, [email protected], Kimberly M Specht.Department of Chemistry
and Biochemistry, Denison University, Granville, OH 43023, United States
Burkholderia cenocepacia is a multi-drug resistant, opportunistic pathogen infecting those
with Cystic Fibrosis and immunocompromised individuals. The membrane is fairly
impermeable partially due to a barrier formed by a lipopolysaccharide (LPS) layer on the
outer-membrane, localized by the protein BCAL0894. In order to increase the permeability
of the outer-membrane, our lab is investigating several different BCAL0894 gene mutations
while decreasing the expression of wild-type protein, with the goal of decreasing the overall
activity of BCAL0894. Decreased activity of BCAL0894 should localize less LPS in the
outer-membrane, creating a more permeable membrane for antibiotic susceptibility. We are
now engineering B. cenocepacia strains that each carry a different BCAL0894 gene
mutation inserted into the genome utilizing homologous recombination to test for increased
permeability.
CHED 325
Gene knockout of an outer membrane protein in Burkholderia cenocepacia
Linda M Weber, [email protected], Kimberly M Specht.Department of
Chemistry and Biochemistry, Denison University, Granville, OH 43023, United States
Burkholderia cenocepacia is a bacterial strain responsible for causing infections in the
lungs of cystic fibrosis patients. This Gram-negative strain is multi-drug resistant with a
highly impermeable outer membrane. The impermeability of Gram-negative bacteria is due
in part to a high concentration of lipopolysaccharide (LPS) molecules in the outer
membrane. Based on sequence homology with similar genes in E. coli, the BCAL0894
gene is expected to play a part in the mechanism responsible for inserting LPS into the
outer membrane of B. cenocepacia. Current studies are working towards a gene knockout
of BCAL0894, which will determine if the protein is essential for B. cenocepacia viability.
CHED 326
Assessing the effects of spermine on the binding strength of the nucleic acid
complexes between polydA+2polyU
Mark Harris, Anne E Serrao, [email protected] of Biochemistry,
Washington & Jefferson College, Washington, PA 15301, United States
In addition to the standard double helix formed by Watson-Crick base-pairs, Hoogsteen
base-pairing allows a third strand of DNA or RNA to bind to produce triple helices from
different DNA/RNA combinations. Stabilization of nucleic acid triple helices has the
potential to be used in the control of gene expression by affecting protein synthesis. This
study analyzes the effects of spermine, a polyvalent cation, on the binding strength of the
helical complexes formed in a system of two equivalents of polyuridylic acid and one
equivalent of polydeoxyadenylic acid. Melting curves show a general trend of increasing
stability with increasing spermine concentration. Mixing curves are generated to determine
if triple helices had formed or if only double helices were present.
CHED 327
Reversal of RNA toxicity in myotonic dystrophy type 1 using antisense
oligonucleotides
Jamie L Platz1, [email protected], Rebecca Moore3,2, David Brook2, Christopher
Hayes3. (1) Department of Chemistry & Biochemistry, Carroll University, Waukesha,
Wisconsin 53186, United States (2) Department of Genetics, University of Nottingham,
Nottingham, United Kingdom (3) Department of Chemistry, University of Nottingham,
Nottingham, United Kingdom
Myotonic dystrophy type 1 (DM1) is a genetic disease caused by a triplet CTG expanded
repeat in the DMPK gene, which codes for DM protein kinase. The CTG repeat causes an
RNA gain-of-function, sequestering muscleblind-like (MBNL) proteins which results in
missplicing and pathogenesis. In this study, antisense oligonucleotide (ASO) therapy is
employed to block the repeat expansion and reverse RNA toxicity. We used ASO gapmers
containing DNA and 2'OMe modified bases for optimal binding affinity and potential RNase
H induction. Using DM1 cells to screen ASOs, we have identified a 5-12-4 gapmer that
reduces RNA foci in situ. However, immunofluorescence analysis shows no reduction in
MBNL protein foci, revealing that RNase H is not effectively cleaving the DNA:RNA
hybrids, and that sequestered MBNL protein remains nonfunctional. Therefore, additional
nucleotide functionality will need to be further investigated; however our research serves as
an important gateway for further ASO therapy in DM1.
CHED 328
Purification of avian riboflavin binding protein for a senior level biochemistry lab
Samantha Saville, [email protected], Christina Miller.Department of
Chemistry, Computer Science, and Mathmatics, Adams State University, Alamosa,
Colorado 81101, United States
Experiments done to improve the isolation of avian riboflavin binding protein from chicken
egg yolk will be discussed. The protein was purified by salting out, dialysis, and ion
exchange chromatography. Characterization of the protein was performed using SDSPAGE to determine molecular weight, the Lowery assay to determine protein concentration
and a riboflavin-binding assay. The aim of this set of experiments is to develop a new
senior level biochemistry lab.
CHED 329
Control of protein translational rates by mTOR in v-ras transformed mouse
fibroblasts
Hayley B. Hamilton, [email protected], Kerry Bruns.Department of Chemistry
and Biochemistry, Southwestern University, Georgetown, Texas 78627-0770, United
States
Malignantly transformed cells exhibit an abnormal rate of growth relative to normal cells,
requiring a higher rate of protein biosynthesis. To study differences in regulation of protein
biosynthesis between normal and transformed cells, KBalb cells (Kirsten sarcoma virus
transformed embryonic mouse fibroblasts) and their parental cell line, Balb 3T3 cells, were
used as models. Translational regulation requires eukaryotic initiation factors, inhibitory
binding proteins of initiation factors, and p70 S6 kinase, all of which are substrates of
mTOR. Experimental results suggest that changes in the phosphorylation state of
substrates of mTOR1 may have effects on the rate of protein biosynthesis in transformed
cells.
CHED 330
Identification of a quinone intermediate in the biogenesis pathway of lysyl tyrosyl
quinone
Parveen Hussain, [email protected], Karlo M. Lopez.Department of Chemistry,
California State University, Bakersfield, Bakersfield, CA 93311, United States
The mechanism for the biogenesis of the lysyl tyrosyl quinone cofactor in lysyl oxidase has
not been fully characterized. Two mechanistic pathways have been proposed leading to
the formation of this cofactor.
Spectrophotometric and redox cycling studies of the K320R mutant of lysyl oxidase (which
prevents LTQ formation) have revealed that a quinone is present in the mutant form of the
enzyme. Based on these data, mechanistic pathway 1 is proposed as the biogenesis
pathway leading to LTQ.
CHED 331
DNA-binding studies of Pax3-FOXO1 through site-directed mutagenesis
Endia Blunt1, [email protected], Madhusoodanan Mottamal1,2, Chantelle Collins1, Kelly
Johanson1. (1) Department of Chemistry, Xavier University of Louisiana, New Orleans,
Louisiana 70126, United States (2) RCMI-Molecular Structure and Modeling Core, Xavier
University of Louisiana, New Orleans, Louisiana 70126, United States
Alveolar Rhabdomyosarcoma (ARMS) is a malignant, skeletal muscle tumor that occurs
primarily in older children and young adults. ARMS is frequently caused by the transcription
factor, Pax3-FOXO1, which retains the full Pax3 DNA-binding domain and a truncated
FOXO1 DNA-binding domain. While the Pax3 domain has been thought to direct DNA
binding, the ability of the truncated FOXO1 domain has never been directly tested. The
overall goal of this project is to characterize the activity of the truncated FOXO1 DNAbinding domain. In the full FOXO1 DNA-binding domain, Arg225 and Ser235 are known to
be important for maintaining DNA contacts, and these residues are predicted to be
necessary in the truncated system. Here, we present our studies on the affinity of Pax3FOXO1 for Pax3 and FOXO1 recognition sequences in vitro as well as the effect of Arg225
and Ser235 site-directed mutagenesis on the affinity for these sequences.
CHED 332
Measuring the rates of nitric oxide release from heme proteins
Shelby D Arleth, [email protected], Miranda L Gathright, [email protected], Truc T T
Nguyen, [email protected], Stephen E Valacer, [email protected], Colin R
Andrew.Department of Chemistry & Biochemistry, Eastern Oregon University, La Grande,
OR 97850, United States
Reactivity of nitric oxide (NO) with iron-containing centers of heme proteins occurs in a
variety of physiological processes, including heme-based NO signaling (e.g. soluble
guanylate cyclase) and NO detoxification (e.g. NO reductases). The kinetic stability of
heme-nitrosyl complexes is reflected in the rate constant for heme-NO release, koff(NO).
Here we report different experimental strategies for measuring koff(NO) for a selection of
heme proteins, including cytochrome c′ which exhibits a novel heme-NO binding location
on the proximal heme face. The influence of heme Fe coordination number and heme
protein environment on the kinetics of heme-NO release is discussed.
CHED 333
Using HS SPME and GC-MS to identify microbial volatile organic compounds in
fungal strains isolated from Atriplex canescens
Elizabeth Hernandez-Jaimes, [email protected], Mary Kopecki-Fjetland.Department
of Chemistry, St. Edward's University, Austin, TX 78704, United States
Fourwing saltbush, Atriplex canescens, is an important food source for herbivores in the
desert southwest. It produces plant volatile organic compounds (PVOCs) that could
possibly serve as the source of attraction for herbivores. Initial studies revealed a symbiotic
relationship between A. canescens and various fungal strains including Alternaria,
Cladosporium, Phoma, and Nigrosporium. This research aims to isolate and identify
microbial volatile organic compounds (MVOCs) released during the growth of each fungal
strain using head space solid phase microextraction (HS SPME) and GC-MS. Alternaria
versicolor is being used as a model system. HS SPME exposure times and temperatures
are being varied to optimize MVOC isolation. Future studies include comparison of the A.
canescens PVOC profile with that of the fungal MVOC profiles in order to determine if
herbivores are attracted to the plant or to the fungus.
CHED 334
Cryopreservation of unicellular algae
Allyson McDonald, [email protected], Bahinah Callahan, Damaris Delgadillo, Betsy
Leverett.Department of Chemistry, University of the Incarnate Word, San Antonio, TX
78248, United States
As a means of establishing optimal cryopreservation conditions for commonly used
laboratory species of unicellular algae, the freezing tolerance of some representative
species has been investigated. Algae were cultivated under constant growing conditions,
and subjected to freezing in the presence of a cryoprotective agent, either
dimethylsulfoxide (DMSO) or glycerol. The freezing procedures included either a two-step
procedure or a controlled cooling method, and viability analysis of previously frozen algae
included growth rate, oxygen production, and chlorophyll analysis.
CHED 335
Loss of sigmoidality in fibrin clot formation in the presence of inhibitors acet-LSPRamide or acet-ISPR-amide
Jessica S Viscomi, [email protected], Brandon T Brown Sr., Toni A
Trumbo.Department of Chemistry and Biochemistry, Bloomsburg University of
Pennsylvania, Bloomsburg, PA 17815, United States
A fibrinopeptide assay was used to compare the rates of uninhibited clot formation and clot
formation containing acet-ISPR-amide or acet-LSPR-amide. For LSPR, clot formation was
followed by spectroscopic methods. Not only was clot formation inhibited, sigmoidality was
lost in the presence of the inhibitor. For ISPR, the velocity of FpA and FpB release was
measured using quench methods and HPLC analysis. Michaelis-Menten plots of for FpA
release velocity with respect to fibrinogen concentration showed significant inhibition of clot
formation with physiological concentrations of fibrinogen. By contrast, plots for FpB release
velocity with respect to fibrinogen concentration showed no inhibition of FpB release. The
inhibition of FpA and not FpB release suggests that cooperativity is lost during clot
formation with the addition of ISPR.
CHED 336
Determination of Vmax and Km for a membrane protease from the periodontal
pathogen, Tannerella forsythia, in solutions between pH 6.0 and 8.0
Amy Rost, [email protected], Cole Hartfield, [email protected], Joseph Paganoni,
[email protected], Beth A Harville.Department of Chemistry, Drury University,
Springfield, Missouri 65802, United States
Tannerella forsythia is an anaerobic bacterium that is associated with severe periodontal
disease. T. forsythia produces a membrane bound protease that cleaves both gelatin and
collagen. To better understand the ideal conditions for enzyme activity the protease was
purified then incubated with highly fluorescein-labeled gelatin in buffers ranging from pH
6.0 to pH 8.0. Enzymatic cleavage of the highly fluorescein-labeled gelatin resulted in relief
of fluorescent quenching which was monitored using a Luminescence Spectrophotometer.
Increase in fluorescence due to enzymatic cleavage was used to determine Vmax and Km
for the enzyme in the different pH buffering systems.
CHED 337
Effects of resveratrol on ultraviolet light-induced skin cell death
George D. Grady, [email protected], Kimberly George.Department of Chemistry,
Marietta College, Marietta, Ohio 45750, United States
Antioxidants, such as Resveratrol, are suspected to have anti-cancer and anti-tumor
effects. Most cases of skin cancer are caused by overexposure to ultraviolet light
irradiation. Results from trypan blue cell viability assays, clonogenic cell proliferation
assays, western blots of apoptotic PARP protein cleavage, and FLICA assays for apoptotic
caspase cascade activation indicate that resveratrol treatment of both normal human
HaCaT skin cells and human cancerous melanoma M624 skin cells causes a dosedependent increase in cell viability. Results also indicate that resveratrol treatment
combined with 50 mJ/cm2 ultraviolet B irradiation causes a resveratrol dose dependent
decrease in cell viability of both normal HaCaT skin cells and melanoma M624 skin cells.
Results from these studies are indicative of the type of cell death occurring: apoptosis,
healthy cell death, or necrosis, unhealthy cell death.
CHED 338
Engineering c-type heme in a cyanobacterial hemoglobin
Lukas Gilevicius2, [email protected], Matthew R Preimesberger1, Belinda Wenke1,
Juliette T. J. Lecomte1. (1) Department of Biophysics, Johns Hopkins University,
Baltimore, Maryland 21218, United States (2) Loyola University New Orleans, New
Orleans, Louisiana 70118, United States
Among other cyanobacteria, Synechocystis sp. PCC 6803 produces a globin called
cyanoglobin or GlbN. What is unique about GlbN is that it is capable of undergoing a posttranslational modification (PTM), which covalently links a vinyl group of the heme to a
noncoordinating histidine. A similar PTM can be found in c-type cytochromes where both
the 2- and 4-vinyl groups undergo addition by cysteines, anchoring ferrous heme to protein
through thioether linkages. In this study, the ability for GlbN to form dual histidine linkages
analogous to cytochrome c was investigated as well as the resulting effects on protein
properties and heme chemistry. The composite optical and NMR data acquired from this
project indicated that we succeeded in engineering double His-heme linkages. Preliminary
work indicates that the modified protein is more thermally stable, but there are still other
properties left to investigate for future work.
CHED 339
Arabidopsis MMD-like genes and their roles in chromosome biology during male
reproduction
Megan M Shroder, [email protected], Kuntal De, Christopher A
Makaroff.Department of Chemistry and Biochemistry, Miami University, Oxford, Ohio
45056, United States
We previously reported the analysis of the Arabidopsis Male Meiocyte Death1 (MMD1)
mutant, which exhibits cytoplasmic shrinkage and chromatin fragmentation, leading to male
meiocyte apoptosis. MMD1 is expressed during meiosis and encodes a Plant Homeo
Domain (PHD) protein. Arabidopsis contains three other MMD1-like proteins, MS1, which is
essential for tapetal cell development and MMDL1 and MMDL2, which are expressed at
elevated levels in the endosperm and sperm cells, respectively. Genetic analyses were
conducted to determine the roles of MMDL1 and MMDL2. Plants homozygous for single
mutations in MMDL1 and MMDL2 appear normal, while homozygous mutations in both
genes are lethal. Interestingly, while mmdl1-/-mmdl2+/- plants are viable, but display a seed
abortion phenotype, mmdl1+/-mmdl2-/- plants are not able to be isolated. The results of
more detailed cellular and molecular analyses including the analysis of pollen, female
gametophyte, and embryo development will be presented.
CHED 340
Progress towards synthesis of novel RNA phosphoramidite monomer protecting
groups
Seth Jones, [email protected], Kenda Syler, [email protected], Rachael Kew, Vincent
Dunlap.Department of Chemistry, Henderson State University, Arkadelphia, Arkansas
71999, United States
With the explosion of new research in the field of RNA, a significant demand for synthesis
of oligoribonucleotides has materialized thus allowing the phosphoramidite method to
become a very valuable tool in biochemical research. As a result, the demand for synthesis
of phosphoramidite monomers has increased. However, there is a lack of selectivity
between the 2'- and 3'-hydroxyl groups in RNA for phosphite addition, resulting in a
reduction in efficiency of synthesis. Silyl protecting groups have been developed to improve
selectivity for the 2'-hydroxyl; but, in order to obtain the greatest utility, yields of the
monomer still need to be improved. In order to improve these yields, we have developed
structural analogs of the 5'-hydroxyl protecting group dimethoxytrityl (DMT) which contain
linker arms aimed at improving selectivity for 3'-hydroxyl phosphitylation. Synthetic
methods for assembly of the protecting groups as well as additional developments are
presented.
CHED 341
Molecular substrate interactions of lysine deacetylases
Lavoryette S Cannon2, [email protected], Jayla D Jones2, Ashley N Matthew1, Asia N
Matthew1, Richard G Painter1, Terry J Watt1. (1) Department of Chemistry, Xavier
University of Louisiana, New Orleans, LA 70125, United States (2) Department of Biology,
Xavier University of Louisiana, New Orleans, LA 70125, United States
Lysine deacetylases (KDACs) play critical roles in cell cycle progression, transcriptional
regulation, and developmental events, including cardiovascular development and disease
and muscular development. In effort to discover what KDAC residues are critical for the
activity and stability of the protein, three KDACs were expressed, purified, and found to be
active in assays measuring the deacetylation activity. Site-directed mutagenesis was used
to introduce an active site histidine to tyrosine mutation in KDAC4 and KDAC7, and as well
as combinations with cysteine to alanine mutations in KDAC4. The histidine to tyrosine
mutation in both enzymes was determined to be more active by approximately 1000-fold
compared to the wild-type enzymes in a commercial assay, whereas the cysteine to
alanine mutations reduced activity and stability. Implications for the role of specific residues
are discussed.
CHED 342
Analyzing the antimcrobial properties of bacteriostatic copolymer, vinylbenzylthymine and vinylbenzyl triethylammonium chloride via 96-well assay
Maureen Corrielus, [email protected], Brittany Caruso, Richard Gurney,
Jennifer Roecklein-Canfield.Department of Chemistry & Physics, Simmons College,
Boston, MA 02115, United States
We present here our work on developing a long-lasting bacteriostatic copolymer,
vinylbenzyl-Thymine and vinylbenzyl triethylammonium Chloride (VBT-VBA), which can be
applied to surfaces in hospitals. Bacterial infections acquired during patient stay in the
hospital have been a long-standing problem. Recent studies have shown the antibacterial
action of substituted VBT-VBA polymers against E.coli. We are examining the effect on
growth these polymers have against 6 other pathogenic bacteria commonly acquired in
hospitals. We will also be developing new methodology to perform these antibactierial
assays at high-throughput using a 96 well plate assay, utilizing the recently purchased
ViaFlow robotic liquid handler. The outcome of this work may lead to the development of a
commercial product that will dramatically decrease the number of bacterial infections that
patients receive from hospitals.
CHED 343
Determination of the binding constant when glycitein is complexed with rat estrogen
receptor beta
Chealse M Stokes, [email protected], Greg Marks.Department of Chemistry,
Carroll University, Waukesha, Wisconsin 53186, United States
Estrogen functions by binding to receptors that control gene transcription, leading to the
creation of proteins that regulate several functions within an organism. The
hormone/receptor binding event can be blocked by the binding of molecules that are
structurally similar to estrogen, causing various developmental issues, specifically causing
damage to the ovarian follicles. There is a gap current literature that would offer a solution
as to how conformational changes in proteins can be caused by the binding of incorrect
ligands, triggering the proteins to function differently. Glycitein, a phytoestrogen found in
soy, is used to characterize the effects of phytoestrogens on cell signaling with estrogen
receptor beta (ERβ), using rats as a model system. The ligand binding domain (LBD) of rat
ERβ was subcloned using PCR. Escherichia coli is ideal for bacterially expressing rERβ
LBD. Isothermal calorimtry can be used to determine the binding affinity for estrogen and
glycitein.
CHED 344
Photophysical evaluation of 5-aryl pyrimidines
Jake Firmender, [email protected], Brandon Litwin, Nicholas J.
Greco.Department of Chemistry, Western Connecticut State University, Danbury, CT
06810, United States
Deoxyribonucleic acid (DNA) is an essential biomolecule whose properties have been of
scientific significance since its discovery. Experimentation with DNA has focused on
modifications made to the sugar, backbone or nucleobases of native nucleosides. Through
studying the modified nucleotides a greater understanding of their properties and overall
stability can be reached. Our research is focused on a series of 5-aryl nucleosides, whose
photophysical properties will be investigated. The absorption and emission properties of
these modified nucleosides will be used to determine the location of the modified
nucleotides within the DNA duplex.
CHED 345
Effect of 7-hydroxyflavone and fluconazole on the CYP450-2C9 mediated metabolism
of ibuprofen
Emily M Lauterbach, [email protected], Daryle Fish.Department of
Chemistry, Saint Vincent College, Latrobe, PA 15650, United States
The overall goal of this research is to determine the effects of fluconazole and 7hydroxyflavone on the cytochrome P450-2C9 mediated metabolism of ibuprofen. The
fluconazole and 7-hydroxyflavone will both be administered individually to the ibuprofen
and cytochrome complex. Ibuprofen is a non-steroidal anti-inflammatory drug that is
commonly used for pain reduction and inflammatory diseases. 7-hydroxyflavone is a
flavonoid, which is a class of dietary phytochemicals, which is a chemical compound that
occurs naturally in plants. 7-hydroxyflavone has a known interaction with the CYP450-2C9
enzyme. Fluconazole is often used to treat fungal infections and meningitis caused by
fungus. This drug is also known to have an interaction with the CYP450-2C9. Throughout
this research, the final products will be analyzed by the High Performance Liquid
Chromatograph. The drugs ibuprofen, fluconazole, and 7-hydroxyflavone will all be
metabolized in order to produce the metabolites associated with each of them.
CHED 346
Extraction and identification of Bifidobacterium animalis from commercially
available yogurt using polymerase chain reaction
BreAnne DeMarco, [email protected], Diana Hoover.Division of Natural and Health
Sciences, Seton Hill University, Greensburg, PA 15601, United States
Increasing concerns about food safety has lead to an increase in the importance of
methods to identify food components. In yogurt with live cultures, it is possible to find
several types of bacteria. One popular commercial brand claims to use a specific strand of
Bifidobacterium animalis, which is a strain of Gram positive bacteria. The purpose of this
experiment was to extract DNA from the bacteria in this brand of yogurt and attempt to
identify it as DN-173010 strain I-2494, a particular strain of Bifidobacterium animalis,
subspecies lactis. As a control, DNA extracted from yogurt was compared with human and
Micrococcus luteus DNA. The DNA from each sample was extracted using a QuiAmp kit
and amplified with PCR using known primers for the specific B. animalis strain. The
amplified DNA was separated and visualized using gel electrophoresis. Future work could
include comparisons of the bacteria in different brands of yogurt.
CHED 347
Structural and thermodynamic studies of a DNA i-motif
Alexander Buxton, [email protected], Mikael McKim, Richard D Sheardy.Department of
Chemistry and Biochemistry, Texas Woman's University, Denton, TX 76204, United States
Telomeres are protein DNA complexes found at the ends of eukaryotic chromosomes. The
human telomere sequence has a G-rich strand, (TTAGGG), complemented to a C-rich
strand, (CCCTAA). Previous studies of the G-rich strand indicate that this sequence folds
into a distinct conformation, designated as a G quadruplex, where the GGG bases form Gtetrads while the TTA segments are found in loops joining the tetrads. C-rich DNA has also
been shown to form an unusual structure, under slightly acidic conditions, designated as
the i-motif. For this aspect of the project, we are investigating the structure and stability of
the conformation formed from (CCCTAA)4 in the presence of either Na+ or K+ at pH values
ranging from 5.0 to 7.5. We will present circular dichroism (CD) spectroscopic
determinations to demonstrate the pH induced formation of the i-motif for this sequence. In
addition, we will report results of the effect of a crowding agent (PEG) on the single strand
to i-motif equilibrium.
CHED 348
Search for the catalytic subunit of DNA polymerase α in Thermomyces lanuginosus
Sonia T. Han, [email protected], Chelsea E. Meier, [email protected], Ira
M. Simet.Department of Chemistry and Biochemistry, University of Northern Iowa, Cedar
Falls, Iowa 50614, United States
DNA polymerases are the enzymes responsible for replicating DNA, with DNA polymerase
α's (DNAPα) initiating the replication process in eukaryotes. Unfortunately, many DNA
polymerases are not very stable, making study of these enzymes difficult. Thermomyces
lanuginosus (TL) is a thermophilic fungus, so its DNA polymerases are expected to be
heartier and to have a higher temperature tolerance; for this reason, TL has become a
target for study. Experiments designed to determine the gene sequence of the catalytic
subunit of DNAPα have been undertaken using large scale culture of TL. This sequence
appears to be partly conserved among eukaryotes, though little research has been done on
fungi apart from Saccharomyces cerevisiae. Using primers based on known sequences
from a handful of other fungi, a possible expressed sequence tag (EST) has been
identified. This EST will be sequenced and then used to quantitate DNAPα catalytic subunit
mRNA in TL.
CHED 349
Analysis of the mutagenic and biophysical characteristics of nanoparticles in
common consumer products
Nicholas Eberhart, [email protected], Sean Divoky, [email protected], Virginia
Smith.Department of Chemistry, United States Naval Academy, Annapolis, Maryland
21401, United States
Nanoparticles are used in a wide range of applications throughout the world, including
many common consumer products. Metal-oxide nanoparticles such as ZnO and various
forms of TiO2 are especially useful. Despite the popularity of nanoparticles, however,
relatively little research has been done on the unintended effects nanoparticles might have
on the human body. We have used classical microbiological techniques and modern
spectroscopic methods to determine the possible mutagenic and biophysical effects of
metal oxide nanoparticles on living organisms and membrane bilayers. The Ames Test and
bacterial growth assays were used to determine the mutagenicity of several metal-oxide
nanoparticles. By incorporating spin-labeled and fluorescently-tagged phospholipids into
unilamellar liposomes, we investigated the effects of these same nanoparticles using
fluorescence emission and electron paramagnetic resonance spectroscopy. The combined
results of these experiments provide information on both the physiological effects and
possible mechanisms of action of nanoparticles on living systems.
CHED 350
WITHDRAWN
CHED 351
Expression and identification of GPR133, a human orphan G-protein coupled
receptor
Cassandra L. Sidone, [email protected], Caleb S. Lougheed, Dale S. DiSalvo, Thomas
Frielle.Department of Chemistry, Shippensburg University, Shippensburg, PA 17257,
United States
Sixty percent of all human G protein-coupled receptors (GPCRs), including GPR133, do
not have an identified agonist, so are termed “orphan receptors.” The primary structure of
GPR133 is similar to four previously identified D. discoideum GPCRs whose agonist,
extracellular cAMP, initiates chemotaxis and cellular development suggesting that the
agonist of GPR133 may also be cAMP. To ensure high expression levels, a mammalian
expression vector was constructed that included the sequence encoding the N-terminal 20
amino acids of bovine rhodopsin inserted after the signal peptide sequence of GPR133.
After transfection of COS-7 cells, the ability of extracellular cAMP to increase intracellular
cAMP in a GPR133-dependent fashion was assessed using a fluorescence resonance
energy transfer assay.
CHED 352
Characterizing the antibacterial activity of a VBT/VBA copolymer against common
nosocomial gram-negative bacteria: Applications for new surface coating
Cynthia Reynolds, [email protected], Brittany Caruso, Richard Gurney,
Jennifer Roecklein-Canfield.Department of Chemistry, Simmons College, Boston, MA
02115, United States
Hospital acquired infections have become a growing problem due to the proliferation of
bacteria on surfaces and the overuse use antimicrobial products, leading to bacterial
resistance. We discuss here a polymer of Vinylbenzyl Thymine (VBT) and Vinylbenzyl
Triethyl Ammonium (VBA), which was synthesized and analyzed for antibacterial properties
using qualitative and quantitative bacterial assays. Preliminary findings suggest
concentrations as low as 1% polymer solution are antibacterial. The VBT/VBA polymer
shows promising antibacterial results based on the decrease in the number of colonyforming units of E.coli in the presence of the polymer. We report here the time course of
antibacterial activity of the VBT/VBA polymer against 6 nosocomial bacteria strains and
new methodology for cross-linking and adherence of the polymer to laminate surfaces.
CHED 353
Cloning, expression, and purification of the pyruvate dehydrogenase complex
subunits E1α, E1β, E2, and E3 from the pdhABCD operon of Bacillus subtilis
Laura A Bowman2, [email protected], Geoff Briggs1, Kent Molter2, Panos
Soultanas1. (1) Centre for Biomolecular Sciences, University of Nottingham, Nottingham,
Nottinghamshire NG7 2RD, United Kingdom (2) Department of Chemistry, Carroll
University, Waukesha, WI 53186, United States
Pyruvate dehydrogenase (PDH) is a four-enzyme complex which is employed in the lower
half of glycolysis and is also suspected of regulating lagging strand synthesis of DNA. It is
unknown which of the PDH subunits interact with subunits of DNA helicase to regulate
synthesis. Environmental factors were previously assumed to regulate DNA replication, but
there may instead be a complex regulatory system that directly links enzymes in glycolysis
and DNA replication. In this research the four subunits of the PDH enzyme (E1a, E1b, E2,
and E3) were obtained by cloning the PDH gene from Bacillus subtilis, expressing the
protein, and purifying via fast protein liquid chromatography. Interactions between PDH
subunits and enzymes in DNA helicase responsible for lagging strand synthesis were
tested using analytical gel filtration. Improved methods of purifying the PDH subunits using
readily available materials were also explored.
CHED 354
Deciphering the breast cancer histone code
Lisa M. Orr1, [email protected], Linley Moreland2, Nathan Avaritt2, Alan J. Tackett2. (1)
Department of Chemistry, University of Arkansas at Little Rock, Little Rock, Arkansas
72204, United States (2) Department of Biochemistry and Molecular Biology, University of
Arkansas for Medical Sciences, Little Rock, Arkansas 72205, United States
Chromatin, a complex of DNA wrapped around a core of histone proteins, greatly reduces
the size of DNA. Processes like replication and transcription are dependent upon chromatin
density because tightly packaged DNA cannot be accessed by proteins involved in these
activities. Histone post-translational modifications (PTMs) can alter chromatin density
enabling or inhibiting replication and transcription. Alterations in levels of transcriptional
activating and inactivating PTMs have been associated with progression of numerous
cancers. A recent study has shown that expression of estrogen receptor in breast cancer is
regulated by epigenetic aberrations. Described here is a mass spectrometric approach for
correlating PTM status with hormone responsiveness in two breast cancer cell lines. It is
hypothesized that differences in histone modifications exist between cancer cell lines
derived from ER+ and ER- breast tumors. Identification of differences in PTMs between the
tumor types may provide insights into new treatments that target histone-modifying
enzymes.
CHED 355
Solvent-dependent structure of the endogenous opioid peptide β-neoendorphin
Jasmine Hill, [email protected], Khushikumari Patel, Brittany Morgan, Nsoki
Phambu.Department of chemistry, Tennessee State University, Nashville, Tennessee
37209, United States
Structural changes for the endogenous opioid peptide β-neoendorphin (β-NE) in various
solvents were investigated using infrared, NMR, ThT-fluorescence and Dynamic light
scattering (DLS) techniques. The peptide structure was studied in aqueous solution,
sodium dodecylsulfate (SDS), trifluoroethanol (TFE), and in the presence of the anionic
model membrane dipalmitoylglycerophosphoglycerol (DPPG). FTIR with second derivative
resolution and curve-fitting methods indicates that β-NE adopts a major β-sheet structure in
water and SDS micelles. A substantial reduction of the β-sheet structure is observed in
TFE, with an increase in a-helix structure. DLS experiments reveal that β-NE increases the
size of DPPG aggregates. ThT-fluorescence results indicate that β-NE adopts a beta-sheet
structure while interacting with DPPG in water, in agreement with the FTIR results. The
interaction of β-NE with DPPG in TFE are also discussed. Proton NMR spectra shows that
the N atom of the amide group of β-NE is involved in the interaction with DPPG.
CHED 356
Quantification of CDP-choline in tissues and body fluids using LC/SRM/MS and
stable isotope dilution
Ashley Freeze1, [email protected], Joshua Cummings1, [email protected],
Shucha Zhang2, Walter B Friday2. (1) Department of Chemistry, Catawba College,
Salisbury, NC 28144, United States (2) Department of Metabolomics, University of North
Carolina at Chapel Hill, Nutrition Research Institute, Kannapolis, NC 28081, United States
CDP-choline, also known as cytidine 5'-diphosphocholine or citicoline, is the active form of
choline that is important for normal membrane function, acetylcholine synthesis, lipid
transport, and methyl metabolism. CDP-choline supplements are available in the market to
promote brain function. Once absorbed, CDP-choline is widely distributed throughout the
body, crosses the blood-brain barrier and reaches the central nervous system, where it is
incorporated into the membrane and microsomal phospholipid fraction. Despite its
importance, only a limited number of assays are available in literature and have not been
extensively applied to biological samples due to undesirable sensitivity and selectivity. In
this study, a new liquid chromatography-selective reaction monitoring-mass spectrometry
(LC/SRM/MS)-based assay is described for quantification of CDP-choline. The assay is
evaluated by parameters such as precision, accuracy, linear dynamic range, limit of
detection and limit of quantification. The concentrations of CDP-choline in various samples
such as tissues, plasma and urine are determined.
CHED 357
Influence of a coiled-coil isoleucine zipper on the trimerization and endosomolytic
activity of the E5-TAT-mCherry protein
Valerie Nickel1, [email protected], Ting-Yi Wang2, Jean-Philippe Pellois2. (1)
Department of Chemistry, Ouachita Baptist University, Arkadelphia, AR 71998, United
States (2) Department of Biochemistry and Biophysics, Texas A&M University, College
Station, TX 77843, United States
The E5-TAT-mCherry protein is designed to initiate cellular uptake through endocytosis
and react to the acidification of the endosomes by causing membrane lysis and cytosolic
delivery. The cell penetrating peptide TAT from the HIV transcription activator binds to the
cellular membrane and triggers endocytosis. E5 is a derivative of the fusogenic peptide
HA2 from the influenza hemagglutinin protein and reacts to the acidification of the
endosomal lumen by inserting into the membrane and increasing permeability. Cytosolic
delivery has been achieved using E5-TAT-mCherry, although efficiency still remains low. A
pH-sensitive isoleucine zipper (IZdep) has been incorporated into the protein in order to
increase its endosomolytic activity. Under acidic conditions IZdep forms a triple stranded
coiled coil but remains as a monomer under neutral conditions. Preliminary results suggest
that IZdep is creating a mixture of oligomerization states and that TAT is interacting with
charged residues on IZdep, decreasing membrane binding efficiency.
CHED 358
Purification of α-Amylase from human saliva from diverse populations
Paul Cornelius, [email protected], Diana Hoover.Division of Natural and Health
Sciences, Seton Hill University, Greensburg, PA 15601, United States
The scientific community has examined the effects smoking has on males and females at
length. But what effects does smoking and gender have on the digestion of starch in the
mouth? The purpose of this study was to determine if a relationship existed between
smoking habits and gender, in terms of the activity of α-amylase. α-Amylase, an enzyme
located in human saliva that functions in the digestion of starch, was isolated from several
human saliva samples and analyzed using starch and iodine reagent. Twenty samples
were collected from participants aged 18-24 years, who had not consumed food in the past
hour. The results will be useful in determining if enzymatic activity of α-amylase is hindered
based on smoking habits or gender, providing a foundation for future experimentation into
how these variables affect DNA coding for this enzyme.
CHED 359
Characterization of cationic DNA transfection agents binding to supramolecular GDNA
Zachariah Henseler, [email protected], Thomas Marsh, Lisa
Prevette.Department of Chemistry, University of St. Thomas, St. Paul, Minnesota 55105,
United States
Guanine-rich nucleic acids self-assemble into a polymorphic family of quadruple helical
structures known as G-DNA. Its common structural motif is a coplanar tetrad of guanine
bases that, when stacked, have the capacity to coordinate some cations. Sequences
capable of adopting a G-DNA structure are found throughout the genomes and their
biological functions are linked to genome stability, regulation of gene expression and
cellular senescence. This work describes interactions of cationic polymers used as DNA
transfection agents with a supramolecular G-DNA known as a G-wire. Polyethyleneimine
(PEI), TAT peptide and PAMAM dendrimer show high affinity for G-wires self-assembled in
the presence of Na+, K+ and NH4+ when measured by Isothermal Titration Calorimetry
(ITC). Dynamic light scattering (DLS) revealed the emergence of polydisperse aggregates
form at charge ratios greater than 1(+:-) ranging in diameter (100-1000 nm). The analyses
of binding interactions indicate that G-DNA remains intact, supporting results from ITC and
DLS.
CHED 360
Cyclocreatine:membrane interactions studied by differential scanning calorimetry
and fluorescence emission spectroscopy
Joshua Sohn, [email protected], Allison Maher, [email protected], Virginia F
Smith.Chemistry, United States Naval Academy, Annapolis, MD 21412, United States
Cyclocreatine (CCr) and its phosphorylated derivative, PCCr, have been shown to have
medically important properties in the heart and nervous system, but their interactions with
cell membranes are not well understood. We used liposomes formed from cardiac and
brain tissue lipid extracts to model the cell membranes in order to study the membrane
interactions with CCr and PCCr. We used differential scanning calorimetry to obtain Tm
values and changes in enthalpy associated with the addition of the creatine analogs. Using
phospholipids with either DANSYL-labeled headgroups or NBD-labeled acyl chains we
were able to monitor CCr and PCCr interactions with the membrane bilayer. By varying the
temperature we were able to evaluate the effect on membrane thermal stability. By using
polar and total lipid extracts we were able to evaluate how creatine analogs interact with
membrane components of different polarity. The combined results provide a fuller picture of
creatine-membrane interactions.
CHED 361
Isolation and determination of the DNA gene sequence of actin for the slime mold
Stemonitis flavogenita
Brett A. Williams, [email protected], Jeannie T. B. Collins.Department of
Chemistry, University of Southern Indiana, Evansville, IN 47712, United States
The slime mold Stemonitis flavogenita was studied to determine the gene sequence for
actin. Actin, a cytoskeletal protein, is highly conserved among eukaryotes; however, the
actin sequence for this species is unknown. DNA and RNA were isolated from the
aphanoplasmodial and coralloid stages of this organism. Known actin gene sequences
were aligned and compared in order to determine the best primer sequences for PCR.
After preparing cDNA samples from the RNA isolations through reverse transcription, the
DNA and cDNA samples were amplified using PCR under various conditions. The
amplified samples were analyzed using agarose gel electrophoresis. It was determined that
samples that were amplified at temperatures near 37°C produced the largest bands,
although they were not the strongest bands. The target DNA size is 1130 bases, and a
couple of samples are larger than this. Additional isolations will be performed and analyzed
and the results will be presented.
CHED 362
Synthesis of naphthyridine/azaquinoline analogs for the disruption of TNR
expansions in the base excision repair mechanism
Jay D. Pike, Nicole Sassu, [email protected], Luke Sejkora,
[email protected], Eileen Colliton,
[email protected] of Chemistry & Biochemistry, Providence
College, Providence, RI 02918, United States
Several neurological disorders result from the expansion of (CAG)n/(CTG)n trinucleotide
repeat (TNR) microsatellite sequences in the human genome. As part of the expansion
process, the formation of non-B DNA hairpin conformations has been proposed in the base
excision repair mechanism, within which an oxidized guanine residue is excised by 7,8dihydro-8-oxoguanine glycosylase and repaired by β-polymerase. At this stage, DNA
slippage can occur, forming hairpin conformations and leading to the addition of extra
bases in the sequence. We propose that developing small molecules that have high
binding affinity to the CAG/CTG sequence can be used to “clamp” the DNA duplex,
preventing such slippage. We have constructed a model DNA system with a
(CAG)20/(CTG)20 unit in a 100-mer duplex, with an abasic site at the first 5'-CAG repeat
site. This work focuses on the design and synthesis of naphthyridine/azaquinoline analogs
and their potential to inhibit TNR expansion during the repair process.
CHED 363
Resveratrol and resveratrol derivatives as class IA PI3K inhibitors
Cassandra N Petty, [email protected], Eamonn F Healy, Peter King.Department of
Biochemistry, St. Edwards University, Austin, TX 78704, United States
Atherosclerosis is an accumulation of fatty deposits that can form plaque and block the flow
of blood. The hallmark of early atheroma is the appearance of foamy macrophages which
secrete cytokines, chemokine's, and reactive oxygen species. Resveratrol is found in the
skin of grapes and is an effective inhibitor of the COX reaction scheme, known activator of
the inflammatory response. We measured the effects of resveratrol on phagocytosis,
reactive oxygen species production, foamy cell formation, and cytokine production, and
found that resveratrol effectively inhibited production on all accounts. This work also
verifies α-PI3Kinase as a key target for inhibition by resveratrol. Using Accelrys Discovery
Studio and a crystal structure of α-PI3K obtained from PDB we are able to demonstrate
that reveratrol and certain resveratrol derivatives exhibit high binding affinities to PI3Kinase. We found cyclopropyl-diacetyl resveratrol to have the highest binding efficiency
due to its orientation in the binding pocket.
CHED 364
Effect of spent media isolated from Lactobacillus plantarum WCFS1 on biofilm
formation by Staphylococcus aureus
Taylor B. Stanford1, [email protected], Huanli Liu2, Mark E. Hart2. (1) Department of
Chemistry, Ouachita Baptist University, Arkadelphia, AR 71998, United States (2) U.S.
Food and Drug Administration, National Center for Toxicological Research, Jefferson, AR
72079, United States
Staphylococcus aureus is a gram-positive, facultative anaerobic bacterium that causes the
life threatening disease called Toxic Shock Syndrome (TSS), which became prevalent in
the late 70s in menstruating women using highly absorbent tampons (2). The incident of
TSS was reduced significantly when the product was removed from the market; however,
recent surveys indicate that TSS is on the rise again (1). Lactobacillus species are a
predominant member of the vaginal microflora and are known to afford a level of protection
to invading bacterial pathogens. An in vitro biofilm microtiter plate assay was used to
examine the effect of L. plantarum WCFS1 spent media on biofilm formation by a toxic
shock syndrome toxin-1 producing strain of S. aureus in various types of media under
different pH conditions. We concluded biofilm formation increased in a modified genital
tract secretion media, which mimics the vaginal environment, under neutral pH conditions.
CHED 365
WITHDRAWN
CHED 366
Determination of sodium fluoride and sodium monofluorophosphate in samples
using quantitative 19F-NMR
Alysha Alaimo, [email protected], Diana Hoover.Division of Natural and Health
Sciences, Seton Hill University, Greensburg, PA 15601, United States
Teeth are protected by a hard enamel layer. By using fluorine-containing toothpaste the
possibility of tooth decay will decrease, however, overdose of fluorine may induce dental
fluorosis, which is a defect in tooth enamel caused by excessive fluoride intake. Studies
show that many children ingest more fluoride from toothpaste than is recommended as a
total daily intake, which poses several health concerns. Therefore, quantitative
determination of fluorine in toothpaste is necessary for health purposes. For this study, 19FNMR was used to determine the concentration of fluorodizers (sodium fluoride and sodium
monofluorophosphate) in toothpaste, but this technique can also be useful for determining
the amount of fluoride in other compounds such as drinking water. With the 19F-NMR
spectra the fluoride content and the speciation information of the fluoride in each
compound can be determined.
CHED 367
Retinoids modulate cellular adhesion and proliferation in the human K562 cell line
Amanda M Hanson, [email protected], Jenni Goodwin, Melissa D
Kelley.Department of Chemistry, University of Central Arkansas, Conway, AR 72035,
United States
Retinoids are essential for such critical life processes as cellular adhesion and proliferation.
All-trans-retinoic acid (t-RA) and 9-cis-retinoic acid (9-cis-RA) serve as ligands for retinoic
acid and retinoid X receptors and can form heterodimeric partners with peroxisome
proliferators-activated receptor gamma (PPARgamma). Proliferation and cellular adhesion
assays were performed with K562 cells treated with troglitazone, t-RA, 9-cis-RA or
troglitazone and t-RA or 9-cis-RA. Cellular adhesion assays were conducted on three
substrates: fibronectin, FN-120, or FN-40. Our data suggest that, in the presence of
troglitazone, cells treated with t-RA or 9-cis-RA increase cellular adhesion to both
fibronectin and FN-120. Additionally, K562 cells treated with t-RA or 9-cis-RA and
troglitazone decrease cellular proliferation compared to cells treated with t-RA or 9-cis-RA
alone. We examined t-RA and 9-cis-RA metabolism in the presence or absence of
troglitazone using liquid-liquid extraction and reverse-phase HPLC. Troglitazone appears to
increase retinoid availability and modulates cellular proliferation and adhesion.
CHED 368
Investigating the role of non-coding RNAs in pericentric heterochromatin formation
Justin M Smith1,2, [email protected], Whitney L Johnson1, William T Yewdell1, Aaron F
Straight1. (1) Department of Biochemistry, Stanford University School of Medicine,
Stanford, CA 94305, United States (2) Department of Chemistry, Catawba College,
Salisbury, NC 28144, United States
Proper chromosome segregation is necessary during mitosis and meiosis in order to
accurately segregate a cell's genome. One domain important to this process is the
pericentric heterochromatin which surrounds the core centromere on chromosomes and
ensures equal segregation of the genome. Previous research has shown that centromeric
RNA plays a role in the formation of the pericentric heterochromatin in
Schizosaccharomyces pombe. However, it is not clear if recruitment of pericentric proteins
is dependent on centromeric RNA in human cells. To test the effect of disrupting
centromeric RNA in vivo, we generated fusion protein constructs consisting of a pericentric
localizing protein, green fluorescence protein (GFP) and RNase. We analyzed the
expression of fusion proteins by Western blot, and confirmed their RNase activity. Finally,
we tested the effect of expressing these fusion proteins in cells by analyzing fixed cells via
immunofluorescence microscopy.
CHED 369
WITHDRAWN
CHED 370
Generating new protein models for thiolate-ligated heme ligand switch proteins
using cytochrome c
Lindsey M. Ludwig, [email protected], Melisa M. Cherney.Department of Chemistry and
Biochemistry, University of Northern Iowa, Cedar Falls, IA 50614, United States
Thiolate-ligated heme proteins contain a heme cofactor that is bound to a cysteine residue.
Included in this group are six-coordinate heme proteins which are regulated by a ligand
switch from the cysteine thiolate ligand to a neutral ligand upon reduction of the heme iron.
The exact mechanism of this switch is unknown. The purpose of this research is to create a
model protein using cytochrome c, a robust and incredibly well-characterized protein which
contains a built-in ligand switch (the alkaline conformational transition). In this study we
have generated a series of yeast iso-1-cytochrome c variants which contain a Met80 to Cys
mutation that creates a thiolate-ligated ferric heme. These variants contain mutations which
introduce potential histidine ligands for the switch, eliminate native histidine residues,
and/or stabilize the overall protein structure. The results of these studies and their
relevance to other heme-thiolate proteins will be discussed.
CHED 371
Quantification of blood plasma ghrelin levels in aggressive and depressive CF-1
male mice Mus musculus
Clint Badger1, [email protected], Boyce Jubilan2, Julie Aaron1. (1)
Department of Natural Science, DeSales University, Center Valley, PA 18034, United
States (2) Department of Social Sciences, DeSales University, Center Valley, PA 18034,
United States
Ghrelin is a peptide hormone secreted by the stomach in mammals. Ghrelin has been
linked to increase the food intake of high fat foods while also being a potential stimulator of
growth hormone from the anterior pituitary gland. Elevated levels of ghrelin have been
identified in depressed humans, however quantitative studies of ghrelin levels in the blood
stream in highly depressed and aggressive mammals have not been completed. In this
study ghrelin levels are monitored in CF-1 laboratory mice, Mus musculus, prior to and
after socialization by a chronic social defeat stress protocol, resulting in aggressive and
depressive groups. It is hypothesized that aggressive mice will have lower ghrelin
concentrations and depressive mice will have higher ghrelin concentrations. Blood plasma
ghrelin levels are analyzed using a mouse ghrelin specific ELISA assay from EMD
Millipore.
CHED 372
Properties of a new series of acetyl-ethyl-pyrazine thiosemicarbazones (ACEPTSC's) and their copper(II) complexes
Alexandra Arriaga, [email protected], Carrie Thompson, Kathleen
Mansur, Edward C Lisic.Department of Chemistry, Tennessee Technological University,
Cookeville, TN 38505, United States
Thiosemicarbazone compounds are a class of multidentate ligands that contain potential
binding sites for a wide variety of metal ions such as iron and copper. This work will
present the synthesis of a series of new, never before synthesized, 2-acetyl-3ethylpyrazine thiosemicarbazone compounds (AEPZ-TSC's). These new compounds are
potential anti-cancer agents, as they most likely interfere with ribonucleotide reductase, an
iron-containing enzyme used by cells to produce DNA. They are structurally similar to
Triapine, which has undergone Phase 2 clinical trials. The work includes the structural
characterization of the new compounds by 1H NMR spectroscopy. The purpose of this
project was to synthesize, characterize, and determine the minimum inhibitory
concentration (MIC) of this series of compounds for four bacteria (Bacillus subtilis,
Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa), two yeast
(Candida albicans and Saccharomyces cerevisiae), and a mold (Aspergillus niger) to
determine the indication of biological activity and anti-proliferation capacity.
CHED 373
Pyruvaldehyde bis-thiosemicarbazone ligands and metal complexes
Amanda Koch, [email protected], Christine N Beck, Kathleen Mansur,
Edward C Lisic.Department of Chemistry, Tennessee Technological University, Cookeville,
TN 38505, United States
Pyruvaldehyde was reacted with seven different thiosemicarbazide compounds to give a
series of seven pyruvaldehyde bis-thiosemicarbazone compounds. These complicated
compounds were characterized by 1H NMR. The compounds produced are: pyruvaldehyde
bis-thiosemicarbazone, pyruvaldehyde bis-methylthiosemicarbazone, pyruvaldehyde bisethylthiosemicarbazone, pyruvaldehyde bis-tertbutylthiosemicarbazone, pyruvaldehyde bisbenzilthiosemicarbazone, pyruvaldehyde bis-phenylthiosemicarbazone, and pyruvaldehyde
bis-dimethylthiosemicarbazone. These compounds were reacted with various metals to
form metal complexes and then tested to prove or disprove biological benefits. The
antimicrobial activity of these synthesized pyruvaldehyde thiosemicarbazones and the
metal complexes of these compounds will be tested by determining the minimum inhibitory
concentrations against four bacteria (Bacillus subtilis, Saphylococcus aureus, Escherichia
coli, and Pseudomonas aeruginosa), two yeast (Canida albicans and Sacchromyces
cervisiae), and two molds (Aspergillus niger).
CHED 374
Synthesis and characterization of new copper (II)quinoline-2-carboxaldehyde
thiosemicarbazone compounds
Lizzie L Monroe, [email protected], Carrie Thompson, Kathleen Mansur,
Edward C Lisic.Department of Chemistry, Tennessee Technological University, Cookeville,
TN 38505, United States
This research involved the synthesis of new quinoline-2-carboxaldehyde
thiosemicarbazone compounds (QCA-TSC), characterized through 1H NMR, for the
purpose of forming complexes with transition metals. Those compounds were reacted with
Cu(II). We present here the synthesis of new Cu(II) quinoline-2-carboxaldehyde
thiosemicarbazone (Cu-QCA-TSC)compounds. Various entries on thiosemicarbazones in
the literature indicate a potential use in biological and biomedical applications.
CHED 375
Investigations of PurP proteins from Methanocaldococcus jannaschii and
Thermococcus kodakarensis
Noah R. Aguayo, [email protected], Catherine A. Sarisky.Department of
Chemistry, Roanoke College, Salem, Virginia 24153, United States
Our lab studies purine biosynthetic pathways in Archaea. PurP enzymes catalyze the ATPand formate-dependent conversion of 5-aminoimadazole-4-carboxamide-1-β-Dribofuranosyl 5'-monophosphate (ZMP) to 5-formaminoimidazole-4-carboxamide-1-β-Dribofuranosyl 5'-monophosphate (FAICAR). The genes from the organisms
Methanocaldococcus jannaschii (MJ0136) and Thermococcus kodakarensis (TK0196 and
TK0203) were cloned into pMAL-c5E vector. Previously we have investigated in vitro
activity of these predicted PurP enzymes. Neither Thermococcus kodakarensis protein
showed activity in vitro. As an alternate approach, we are testing a complementation
system using purine auxotrophic E. coli cells. It was found that the cells with the MJ0136containing vector exhibit prototrophy. Complementation results for TK0196 and TK0203 will
be discussed.
CHED 376
Identification of alternative pathways to prenyl diphosphates involved in cell wall
assembly in Mycobacterium tuberculosis
Courtney Nygaard, [email protected], Francis M Mann.Department of Chemistry,
Winona State University, Winona, Minnesota 55987, United States
Mycobacterium tuberculosis (Mtb) has six genes, Rv0562, Rv0989c, Rv1086, Rv2361c,
Rv3383c, Rv3398, that encode for related enzymes. These enzymes produce various
prenyl diphosphates (PDP), which are different sizes and stereochemistry. The products of
these enzymes facilitate the production of cell wall components and PDPs assist in the
transfer of polysaccharides into the cell wall. The proteins encoded by Rv0989c, Rv1086,
and Rv2361c, make products that elongate to form decaprenyl phosphate, which is the
natural pathway and product in Mtb; however, there are alternative pathways indicating that
Mtb can survive by assembling its cell wall with different products. This experiment
identifies alternative natural pathways, which could identify enzymatic antibiotic targets.
Escherichia coli is utilized to express the Mtb genes in non-native sequences and assess
the production of novel PDPs. The products were harvested from lysed cells and analyzed
via GC-MS and TLC against a background E. coli metabolism.
CHED 377
Effect of tris buffer on calf intestinal alkaline phosphatase
Ajibola B Bakare, [email protected], Eva Csuhai, Kayarash Karimian,
[email protected] University, Lexington, Kentucky 40508, United
States
Enzymes are highly selective biological molecules that speed up the rate of metabolic
reaction. Living organisms usually maintain a relatively constant internal environment that
keeps enzymes active, and deviation from norm would denature enzymes. This is true for
most enzymes; however, calf intestinal alkaline phosphatase deviates from this norm. Our
previous experiment showed that calf intestinal alkaline phosphatase was activated by
trifloroethanol in carbonate buffer at pH 10 and temperatures 45°C, 65 °C. In our study, we
tested the effect of Tris buffer at pH of 8 and 9, and at temperatures 25 °C, 45 °C and 65
°C on calf intestinal alkaline phosphatase. Para-Nitophenylphosphate was used as a
substrate for the alkaline phosphatase in this experiment, after which the absorption and
concentration of the reaction were recorded using spectrophotometer.
CHED 378
Gallic acid, an inducer of apoptosis to human oral carcinoma HSC-2 cells, as
mediated through oxidative stress
Esther F. Robin, [email protected], Jordana R. Wietschner,
[email protected], Jeffrey H. Weisburg, Harriet L. Zuckerbraun, Alyssa G. Schuck,
Harvey Babich.Department of Biology, Stern College for Women, New York, NY 10016,
United States
Gallic acid is preferentially cytotoxic to cancer cells, and acts as a prooxidant to induce cell
death via apoptosis. This research demonstrates a cause-and-effect relationship between
production of hydrogen peroxide by gallic acid and its subsequent induction of apoptosis to
human oral carcinoma HSC-2 cells. FOX assay shows that gallic acid is a strong generator
of H2O2. Depletion of intracellular reduced glutathione (GSH,) was observed in HSC-2 cells
exposed to increasing levels of gallic acid. Also, the decrease in intracellular GSH in HSC2 cells treated with gallic acid was reduced by coexposure with CoCl2. Flow cytometric
analyses of HSC-2 cells showed that with increased gallic acid concentration, viable cells
decreased while apoptotic and dead cells increased. In the presence of Co 2+, the cells were
essentially rescued from apoptotic death. The mechanism of apoptotic cell death in HSC-2
cells exposed to gallic acid is via the induction of oxidative stress.
CHED 379
Functional dissection of BRCA1 A complex proteins, Abraxas, and BRCC36
Génesis Millán-Serrano1, [email protected], Andrew Castillo2, Paul Atanu2, Bin
Wang2. (1) Department of Natural Science, University of Puerto Rico - Aguadilla,
Aguadilla, PR 00604-6150, Puerto Rico (2) Department of Genetics, University of Texas
MD Anderson Cancer Center, Houston, TX 77030, United States
Genome integrity is essential for the survival of the cells; therefore the ability to respond to
DNA damage is critical. Breast cancer-1 (BRCA1) participates in the DNA damage
response and co-localizes with Abraxas and BRCC36, as it forms a multi-protein BRCA1
A-complex. The mechanism by which BRCA1 A-complex proteins functions remains
elusive. Abraxas serves as an adapter protein in the complex. BRCC36 contains
deubiquitination activity and has recently been observed to multimerize with itself. To
further understand the role of BRCA1 A-complex proteins, we aim to dissect these genes
functions through the generation of multiple mutants and their expression in cells for
functional analysis. Abraxas cDNA mutants were able to detect transient expression in
mouse embryonic fibroblasts cells. Dissected BRCC36 clones show that the
multimerization domain is located between the MPN domain and Coiled-Coil domain.
Further analysis will be performed to comprehend the organization and function of the
complex.
CHED 380
NMR study of the thermal denaturation of TIAM PDZ domains
Reena Dev, [email protected], David C. Speckhard.Department of Molecular and Life
Sciences, Loras College, Dubuque, IA - Iowa 52001, United States
T- cell lymphoma invasion and metastasis 1 and 2 (TIAM1 and TIAM2) proteins are
guanine nucleotide exchange factors that specifically activate GTPase Rac and are
implicated in the regulation of biological functions. TIAM1 and TIAM2 are composed of
different interacting PDZ domains and thus in QM (quadruple mutant) TIAM1, the four
residues crucial for the differences in binding specificity for partner peptides were replaced
with the corresponding TIAM2 residues and the specificity became more like TIAM2 PDZ
domain. Additionally, TIAM1 and TIAM2 domains also display differences in stabilities.
TIAM1 can be stored for long period of time while QM and TIAM2 cannot. We have been
able to demonstrate differential stabilities of N15 HSQC amide signals in spectra of QM PDZ
taken at 25 °C and 45 °C We will report the thermal titration of these groups in the
presence/absence of binding partner, and will report how altering the key residues impacts
stability.
CHED 381
CYP2E1 overexpression induces mitochondrial biogenesis in HepG2 cells
Logan Rice, [email protected], Andres Caro.Department of Chemistry, Hendrix College,
Conway, Arkansas 72032, United States
HepG2 cells overexpressing cytochrome P450 2E1 (CYP2E1) were generated by
transfection with a pCI expression vector containing the human CYP2E1 cDNA, and
selected with the use of geneticin. Overexpression of CYP2E1 was confirmed at the RNA
level by reverse-transcriptase PCR, at the protein level by western blot, and at the
enzymatic activity level by 7-methoxy-4-trifluorocoumarin O-demethylation. Control HepG2
cells were transfected with the empty pCI plasmid. The content of mitochondrial DNA in
CYP2E1-overexpressing HepG2 cells (determined by real-time PCR and expressed
relative to nuclear DNA content), was two-fold higher than that of control HepG2 cells. In
parallel, the level of reactive oxygen species expressed as dichlorodihydrofluorescein
oxidation rate and determined by flow cytometry increased two-fold with respect to control
HepG2 cells. These results support a working hypothesis where CYP2E1 overexpression
induces mitochondrial DNA synthesis, probably by increasing oxidative stress levels.
CHED 382
Effect of ethanol on mitochondrial DNA in HepG2 cells
Spencer Sanson, [email protected], Andres Caro.Department of Chemistry, Hendrix
College, Conway, Arkansas 72032, United States
Ethanol metabolism in hepatocytes induces oxidative stress; in turn, oxidants can damage
and deplete mitochondrial DNA. The effect of ethanol on mitochondrial DNA (mtDNA)
content and oxidative stress of hepatocytes was explored using a human hepatoma cell
line (HepG2 cells). Ethanol did not induce significant cell death in HepG2 cells at
concentrations of up to 100 mM. Ethanol produced a dose-dependent increase in the level
of cellular oxidants, evaluated by dichlorodihydrofluorescein oxidation and determined by
flow cytometry. The content of mDNA was determined by real-time PCR and expressed
relative to the nuclear DNA content. At 100 mM, ethanol produced a 30% decrease in
mtDNA content with respect to untreated cells. These results support a working hypothesis
where ethanol produces partial depletion of mtDNA, probably by increasing oxidative stress
levels.
CHED 383
Docosahexaenoic acid induces mitochondrial biogenesis in HepG2 cells
Johnny Tran, [email protected], Andres Caro.Department of Chemistry, Hendrix College,
Conway, Arkansas 72032, United States
Docosahexaenoic acid (DHA) is a polyunsaturated fatty acid abundant in fish oil, which is
very sensitive to oxidation; in turn, lipid-derived oxidants can damage and deplete
mitochondrial DNA. Mitochondrial biogenesis is a compensatory mechanism which is
activated by many cells under oxidative stress to maintain mitochondrial DNA (mtDNA)
levels. The effects of DHA on mitochondrial biogenesis in hepatocytes were explored using
a human hepatoma cell line (HepG2 cells). At 20 uM, DHA produced a two-fold increase in
mtDNA content with respect to untreated cells. Mitochondrial transcription factor A (TFAM)
is a key component of the mtDNA biosynthesis pathway. DHA at 20 uM produced a 60%
increase in TFAM mRNA, and a 40% increase in TFAM protein levels. Pre-incubation with
trolox, an amphipathic antioxidant, prevented the increase in mtDNA caused by DHA.
These results support a working hypothesis where DHA increases mtDNA biosynthesis by
inducing TFAM expression, probably via oxidative stress.
CHED 384
Use of bioinformatics tools to investigate molybdate ABC transporters in
Thiomicrospira crunogena
Emily Santellan, [email protected], Teresita Munguia.Department of Mathematics
and Science, Our Lady of the Lake University, San Antonio, Texas 78207, United States
Thiomicrospira crunogena is a chemolithoautotroph that lives in deep sea vents in the
Atlantic and Pacific oceans. T. crunogena uses reduced sulfur compounds as a fuel source
for carbon fixation and has developed multiple adaptations to obtain inorganic molecules to
sustain life in deep sea vents. Transporters play important roles in the uptake and export of
substrates across the cellular membrane to maintain homeostasis within the organism. The
use of bioinformatics tools was used to annotate the molybdate ABC transporter system.
Bioinformatic tools help to determine putative structure and location of mod A, mod B, mod
C genes on the cellular membrane. Molybdate ABC transporters in T. crunogena do not
contain a fourth protein that helps in the transportation of substrates through the cell
membrane. Understanding the structure of ATP-Binding Cassette Transporters is important
to understanding the movement of substrates and how the substrate is distributed within
the cell.
CHED 385
Docosahexaenoic acid induces glutathione synthesis in HepG2 cells
Etienne Nzabarushimana, [email protected], Andres Caro.Department of Chemistry,
Hendrix College, Conway, Arkansas 72032, United States
Docosahexaenoic acid (DHA) is a polyunsaturated fatty acid abundant in fish oil, which is
very sensitive to oxidation; in turn, lipid-derived oxidants can activate redox-sensitive
transcription factors to produce a compensatory induction of antioxidant enzymes. The
effects of DHA on antioxidant defenses of hepatocytes were explored using a human
hepatoma cell line (HepG2 cells). At 20 uM, DHA produced a 3-fold increase in the content
of glutathione, the most abundant water-soluble antioxidant, with respect to untreated cells.
DHA produced a 60% increase in the mRNA levels of gamma-glutamylcysteine synthetase
(GCS), whose protein product catalyzes the rate-limiting step of glutathione biosynthesis.
Knockdown of Nrf-2 (a key redox-sensitive transcription factor, which binds to the gammaGCS promoter) with siRNAs, blocked the effect of DHA on glutathione content. These
results support a working hypothesis where DHA increases glutathione synthesis by
inducing gamma-GCS expression, probably via Nrf-2.
CHED 386
FT flowering gene examination in Cannabis sativa
Sarah A Anderson1,2, [email protected], George Weiblen2, David
Speckhard1. (1) Department of Biochemistry, Loras College, Dubuque, Iowa 52001, United
States (2) Department of Plant Biology, University of Minnesota, Saint Paul, Minnesota
55108, United States
Often plants are used either for their flowers or the fruit that is produced from the flowers;
however, the plant must receive triggers for flowering to occur. Many of the exact triggers
that cause specific plants to switch from their vegetative states into flowering states have
not yet been discovered. The flowering of Cannabis sativa was examined through the
isolation of its FT gene. FT has previously shown to be significant in the conversion from
vegetative to flowering in model plants. The FT gene in Cannabis was identified,
sequenced, and compared to published FT sequences of various other plants to form a
phylogenic tree. In Cannabis specifically, active ingredients are found in the flowers; to be
able to control when the plant flowers gives control over the production of the active
ingredients. Since flowering in Cannabis has not previously been explored, this study was
a starting point for future research.
CHED 387
WITHDRAWN
CHED 388
Evaluation of the azinomycin gene cluster
Chardai Grays2, [email protected], Dinesh Simkhada1, Coran M. H.
Watanabe1. (1) Department of Chemistry, Texas A&M University, College Station, Texas
77840, United States (2) Department of Chemistry, Dillard University, New Orleans, LA
70122, United States
Azinomycins have putative resistance proteins, HRP1 and HRP2, found in the azinomycin
biosynthetic gene cluster. These proteins appear to be selective toward azinomycin B
(AzB) and demonstrate a protective effect against azinomycin's cytotoxic effect.
Understanding the resistance mechanism will aid in the development of AzB as a potent
chemotherapeutic agent. AziA2 is also found within azinomycin biosynthetic gene cluster. It
has been shown to contribute to the assembly of the skeletal backbone of AzB. A typical
non-ribosomal peptide synthase module consists of an A-PcP-C module. However, AziA2
consists of a C-PcP-C module with two active condensation domains. Knockout of the
module yielded no AzB production and domain analysis of the PcP-C module led to the
discovery of a new metabolite. Collection/isolation of the metabolite, using an HPLC
instrument, can lead to future studies dealing with characterization of this metabolite giving
insight into the activation and role of the condensation domains.
CHED 389
Design of robust LuxS activity assay protocol and synthesis of known inhibitor for
inhibition assays
David J Silpa, [email protected], Keeshia Wang, Megan E. Bolitho.Department of
Chemistry, University of San Francisco, San Francisco, California 94117, United States
Quorum sensing (QS) is a biochemical process used by many bacterial species to
communicate via small-molecule "auto-inducers." QS Systems 1 and 2 are used to
communicate within and across species, respectively. QS-2 has been shown to regulate
virulence expression in many pathogens and is thus a drug-development target; LuxS, an
enzyme integral to QS-2 has been identified as a target for inhibition. An Ellman's assay is
employed to spectrophotometrically observe LuxS activity and has herein been rigorously
optimized. This assay will be used to quantify LuxS inhibition by small molecules, including
a benchmark inhibitor reported in literature for which syntheses are attempted.
CHED 390
Identification of licorice root components for prostate cancer therapeutics using
triple quadrupole GC-MS
Evan S DuBose1, [email protected], Marisela D Mancia1, Michelle E Reid1,
James A Campbell2, Kimberly M Jackson1. (1) Department of Chemistry, Spelman
College, Atlanta, GA 30314, United States (2) Chemical and Biological Signature
Sciences, Pacific Northwest National Laboratory, Richland, WA 99352, United States
Licorice root (Glycyrrhiza glabra), an herbal Chinese medicine, has shown medicinal uses
in therapeutics and cancer prevention. Dibenzoylmethane (DBM), a small β-diketone, has
been reported to be a minor constituent of licorice and a known deregulator of human
prostate cancer cell cycle. Characterization of the phytochemical profiles of licorice root
forms including commercially available DBM will advance our search in identifying novel
reagents for prostate cancer therapeutics. Gas chromatography- triple quadrupole-mass
spectrometry analysis was used for detecting DBM in licorice root extracts. DBM and all
licorice forms exhibited a component at a retention time of 14.5 minutes. The major
fragment ions detected were m/z 77, 105, 147, 223 and 224 at the identified retention time.
Selected reaction monitoring (SRM) confirmed DBM as a minor constituent of G. glabra.
This study provides a GC-MS/SRM method which helps in the identification of small trace
compounds and minor components in complex biological matrices.
CHED 391
Site-directed mutagensis and spectroscopic studies of the oxygen sensing hemePAS FixL protein
Avery Vilbert, [email protected], EuTchen Ang, [email protected], Mark
Reynolds.Chemistry, Saint Joseph's University, Philadelphia, PA 19131, United States
The oxygen sensing FixL protein from Sinorhizobium meliloti regulates nitrogen fixation in
the hypoxic root nodules of alfalfa plants. FixL is part of the heme-PAS and two-component
histidine kinase families of biological sensors. We have examined the role of conserved F ahelix residues in the heme domain of SmFixL* using site-directed mutagenesis and various
spectroscopies. The Fa-helix variant proteins R200(A, E, Q, H), Y197A and D195A were
expressed at reasonable levels and purified to homogeneity, but the R200I and Y201A
variants did not express in observable quantities. Spectroscopic studies (UV-vis, CD and
resonance Raman) and kinase activity assays of these Fa-helix SmFixL* variant proteins
indicate that R200 and Y197 are likely important in oxygen sensing at the heme site and
signal transduction to the kinase domain. These studies may help elucidate a detailed
mechanism for the gas sensing heme-PAS proteins and other two-component histidinekinase sensors in nature.
CHED 392
Save your Bible the organic way
Soham Mody, [email protected], Rachel Rigsby.Department of Chemistry
and Physics, Belmont University, Nashville, Tennessee 37212, United States
Modern scientists are rigorously trying to mimic nature to solve problems with reduced
toxicity and in less harmful ways. The object of the following research assignment was to
use an organic substance like cinnamon oil (cinnamaldehyde), found naturally in the bark
of the cinnamon tree, to fight common household pest such as mold to save our books.
Cinnamon oil is industrially used as chewing gum flavoring and agriculturally as a plant
pesticide against fungal growth. Previous research has shown that cinnamaldehyde acts as
a non-competitive inhibitor of an essential cell wall component of yeast cell and prevents
fungal growth. The aim of this research is to understand this process better and come up
with a benign way to make paper antifungal.
CHED 393
Translesion synthesis of Y-family polymerase Dpo4
David Wilson, [email protected], Melissa Brulotte, Sam Lone.Department of
Chemistry, Bridgewater State University, Bridgewater, Massachusetts 02325, United
States
It is well understood that mutations in critical genes are responsible for a variety of
diseases including cancer. Chemical carcinogens can lead to mutations by attaching to the
DNA bases and interfering with the normal replication process. Replication through these
DNA lesions is performed by a novel class of DNA polymerases identified as translesion
synthesis (TLS) polymerases. To better understand how these DNA polymerases are able
to replicate across DNA lesions, we are determining the structure and function of archaeal
TLS polymerase Dpo4 bound to free radical lesion 8-oxo-7,8-dihydroadenosine (8-oxo-A).
Single nucleotide template-primer extension analysis reveals that Dpo4 inserts the correct
nucleotide dTTP across from 8-oxo-A lesion. We have successfully crystallized Dpo4/8oxo-A complexes and currently, we are working on crystal optimization, cryoprotection, and
diffraction data collection.
CHED 394
YfdW and YfdU are required for oxalate-induced acid tolerance in Escherichia coli
Karen E Ezelle, [email protected], John M McAfee, [email protected], Cory G
Toyota.Millsaps College, Jackson, MS 39210, United States
E. coli has several mechanisms for surviving low pH stress. We report that oxalic acid, a
small chain organic acid (SCOA), induces a moderate acid-tolerance response (ATR)
under two conditions. Cells adapted at pH 5.5 with 50 mM oxalate and subsequently
challenged in minimal medium at pH 3.0 demonstrate increased surivival. In addition, there
is also a significant protective effect when cells are challenged in the presence of 25 mM
oxalate at pH 3.0. We report that the enzymes YfdW, a formyl-CoA transferase, and YfdU,
an oxalyl-CoA decarboxylase, are required for the adaptation effect, but are not necessary
for the protective effect during challenge alone. The mechanism is not yet understood, but
we demonstrate this oxalate-dependent ATR is not affected by Ca2+ depletion.
CHED 395
Investigation of the capsule polysaccharide expression pathway of Vibrio vulnificus
Joseph M Hazel, [email protected], Anahita Z Mostafavi, [email protected],
Margaret A Chahoud, [email protected], Jerry M Troutman.Department of Chemistry,
University of North Carolina at Charlotte, Charlotte, NC 28223, United States
Vibrio vulnificus is a gram-negative bacterium found in raw shellfish that causes more
seafood-borne fatalities in the US than any other bacterium, and virulence has been linked
to capsule expression. The capsule of strain M06-24 is a repeating tetrasaccharide
composed of three α-N-acetyl-quinovosamine (QuiNAc) residues and one α-N-acetylgalactosamine uronic acid (GalNAcA) residue, yet the role of individual enzymes in the
expression pathway is not yet understood. The operon responsible for capsule production
is believed to contain twelve genes. These genes are hypothesized to encode seven sugar
modifying enzymes and the four glycosyltransferases. The proteins encoded by these
genes have been isolated and purified. My work focuses on the functional identification of
the proteins involved in capsule production. The pathway of enzymes responsible for the
production of GalNAcA has been identified. In addition, the roles of several enzymes
involved in the production of QuiNAc have been elucidated.
CHED 396
Antioxidant activities of quercetin and novel flavonoid derivatives
Scott E York, [email protected], Willibroad Miamo, Chavonda J
Mills.Department of Chemistry,Physics & Astronomy, Georgia College & State University,
Milledgeville, Georgia 31061, United States
Cyclooxygenase is responsible for the oxidation of arachidonic acid into prostaglandins,
which are used in various functions within the body including common processes such as
GI maintenance. One isoform of Cyclooxygenase, Cyclooxygenase-2 (COX-2), is
specifically credited with the role of causing inflammation, and is often overexpressed
within cancerous tumors.Thus, studies suggest that inhibition of COX-2 could be used to
treat and prevent cancer. It is also proposed that due to the selective nature of this isoform,
the inhibition of COX-2 can occur without the harmful effects of COX-1 inhibition. Aurones,
a subclass of flavonoids, express COX-2 inhibitory activity by serving as scavengers of free
radicals. Specifically, the flavonoid derivative, quercetin is being examined for its
antioxidant activity with specific attention towards the presence of hydroxyl groups. Using
DPPH as a free radical producer, quercetin, its methylated counterpart, and novel aurone
derivatives were investigated for their free radical scavenging activities.
CHED 397
Oxalate-dependent acid tolerance response in Escherichia coli
Maryam N Qureshi, [email protected], Cory G Toyota.Department of Chemistry and
Biochemistry, Millsaps College, Jackson, MS 39042, United States
E. coli has evolved several mechanisms for surviving low pH stress. We report that oxalic
acid, a small chain organic acid (SCOA), induces a moderate acid-tolerance response
(ATR) in two ways. Adaptation at pH 5.5 with 50 mM oxalate and inclusion of 25 mM
oxalate in the pH 3.0 minimal challenge medium separately conferred protection: 67 ± 7%
and 87 ± 17% survival after 2 hours, respectively. Combination of oxalate-adaptation and
oxalate supplementation in the challenge medium resulted in increased survival over
adaptation or oxalate in the challenge medium alone. Cells show significant protection after
15 min exposure to 50 mM potassium oxalate. This oxalate-dependent ATR is strongest at
pH 3.0, but there is also significant, but reduced protection at pH 2.5. We theorize that this
oxalate ATR could enhance the pathogenesis of virulent E. coli consumed with oxalatecontaining foods like spinach.
CHED 398
Accurate measurement of protein concentrations in snake venoms using ovalbumin
as a standard protein in the linearized Bradford assay
Christian E Herrera, [email protected], John J Osterhout.Chemistry and
Biochemistry, Angelo State University, San Angelo, Texas 76909, United States
Accurate measurement of protein concentrations in mixtures, such as snake venom, is
difficult due to the unknown extinction coefficients of a mixture and different responses to
protein assays (such as the Bradford assay). The use of extinction coefficients would not
be possible even if the extinction coefficients of all the individual proteins were known.
Here we show that North American, Asian and African snake venoms all demonstrate
approximately the same response to the linearized Bradford assay on a dry weight basis.
The response of ovalbumin to the linearized Bradford assay is approximately the same as
the snake venoms and different from that of other common proteins standards, such as
bovine serum albumin or β-lactaglobulin. The concentration of ovalbumin can be
determined spectrophotometrically, giving accurate and reproducible preparation of
standard curves. The combination of the linearized Bradford and ovalbumin standards
promisses a reproducible and universal assay for snake venoms.
CHED 399
WITHDRAWN
CHED 400
Oxalic acid and Escherichia coli
Kristin M Salmon, [email protected], Cory G Toyota, [email protected]
College, Jackson, MS 39210, United States
Small chain organic acids (SCOA), like acetate and benzoate, have long been used as
preservatives because of their bacteriostatic properties. Interestingly, these same acids
also induce protective effects in Escherichia coli cells that are subsequently challenged
under low pH conditions. Here we report that increasing concentrations of oxalate (1 – 250
mM) have a bacteriostatic effect on cells grown in complex medium (pH 5.5). However,
exposure to oxalate also induces an acid tolerance response (ATR) that protects stationary
phase E. coli for several hours at pH 3.0. Unlike acetate and benzoate, this protective
effect does not appear to be under the control of the sigma factor RpoS, also known as the
master regulator of stress in E. coli. Our deletion mutant data indicate that this oxalatedependent ATR is linked to phoQ, part of the two component PhoPQ signal transduction
system, and gadE a central regulator of acid resistance in E. coli.
CHED 401
Structural and functional studies of the Y-family DNA polymerase Pol κ
Natasha Mariano1, [email protected], Jason Walsh2, Ramya Parasuram2,
Mary Jo Ondrechen2, Penny Beuning2, Samer Lone1. (1) Department of Chemical
Sciences, Bridgewater State University, Bridgewater, Massachusetts 02325, United
States (2) Department of Chemistry and Chemical Biology, Northeastern University,
Boston, Massachusetts 02115, United States
Our cells are continuously attacked by chemical agents, which can lead to the formation of
DNA lesions. The integrity of our DNA is vital for human survival; otherwise, we risk
mutations leading to disease. Recently, the Y-family polymerases were discovered to
perform replication through DNA lesions. Biochemical and structural analysis reveals that
unlike the replicative polymerases, the Y-family DNA polymerases are able to
accommodate the distortions presented by the lesions. Each of the Y-family DNA
polymerases has unique structural components enabling them to accommodate the variety
of DNA distortions created by the lesions. The N-clasp region of DNA Polκ has been
described to be essential for this polymerase's ability to extend mismatched DNA. To
further elucidate the importance of the N-clasp of Polκ, we used POOL and THEMATICS to
predict residues essential for activity. We will present the role of the N-clasp domain in the
bypass of DNA mismatches.
CHED 402
Development of a fluorescence-based assay for RNA-ligand discovery
Shapnil Bhuiyan, [email protected], Danielle N Dremann, Alain Bertous, Moninderpal
Kaur, Christine S Chow.Department of Chemistry, Wayne State University, Detroit,
Michigan 48202, United States
Helix 69, or H69, of the ribosome plays a key role in initiation and termination of translation.
Small-molecule binding to this region could lead to inhibition of protein synthesis, an
essential process throughout phylogeny. The H69 region of bacteria has been shown to
bind certain peptides selectively, which may lead to new antimicrobials. The goal of this
study is to identify compounds that bind to H69 by developing and using an optimized
fluorescence-based assay. The assay uses TentaGel beads with bound synthetic peptides,
biotinylated H69, and streptavidin-tagged quantum dots (Qdots). The interaction of H69
with the immobilized peptide is indicated through Qdot emission, which is visualized under
a fluorescence microscope. The relative fluorescence value is quantified using Adobe
software. In the future, the assay will be used to identify new binding ligands for H69.
CHED 403
WITHDRAWN
CHED 404
Synthesis and evaluation of the glutathione-3-methyleneoxindole conjugate as a
potential inhibitor of human glyoxalase I
Valerie A. Ivancic, [email protected], Edward J. Brush.Department of
Chemistry, Bridgewater State University, Bridgewater, MA 02325, United States
The glyoxalase enzyme system is highly conserved among all organisms and plays a key
role in detoxifying the cytotoxic metabolite methylglyoxal into lactic acid. Glyoxalase I (GxI)
is considered an anticancer target because inhibiting the enzyme will result in a localized
buildup of methylglyoxal, which can potentially induce cell death in those targeted cells.
This research focused on an evaluation of the conjugate between glutathione (GSH) and 3methyleneoxindole (GSMOI) as a potential inhibitor of human GxI. GSMOI were
synthesized and characterized, and subsequently tested as a competitive inhibitor for both
yeast and human GxI. In contrast to previous research on GSH conjugates, this work
suggests that GSMOI inhibits yeast GxI through mixed inhibition instead of pure
competitive. It was also found that GSMOI is an inhibitor of human GxI, and preliminary
results suggest irreversible time-dependent inactivation is occurring.
CHED 405
Stoichiometric analysis of metalloproteins by simultaneous particle-induced X-ray
emission spectroscopy and nuclear reaction analysis
Megan M. Sibley2, [email protected], Andrew J. McCubbin1, Paul A. DeYoung1,
Graham F. Peaslee1. (1) Departments of Chemistry and Physics, Hope College, Holland,
MI 49424, United States (2) Department of Chemistry, Clemson University, Clemson, SC
29708, United States
Particle-Induced X-ray Emission Spectroscopy (PIXE) and Nuclear Reaction Analysis
(NRA) are two highly sensitive ion beam analytical techniques which probe the elemental
constitution and areal density, respectively, of a sample. Using a 1.7 MV tandem
electrostatic particle accelerator, these methods have been utilized simultaneously to
determine the identity and stoichiometry of metal atoms within protein samples of known
metal content; results indicate the technique is a useful tool which can be accurately
extended to proteins of hitherto unknown metal stoichiometry. The nondestructive
technique, originally developed for dried protein spots on a thin support, has been
extended for metalloproteins suspended in polyacrylamide gel. This allows use of the
technique in biochemical applications in which proteins are separated by polyacrylamide
gel electrophoresis (PAGE). Various methods of sample preparation and gel drying have
been considered. Additionally, such factors as the thickness, constitution, and possible
contaminants of the gel have been investigated.
CHED 406
Alkaline phosphatase activation in the presence of trifluoroethanol solution in pH 10
carbonate vs. Tris buffer
Sam Petter, [email protected], Kayarash Karimian, Eva Csuhai.Department of Natural
Sciences and Mathematics, Transylvania University, Lexington, KY 40508, United States
Enzymes typically get inactivated when presented with even minute amounts of organic
solvents. However, there are a few enzymes where this is does not seem to be the case. In
our study, we examined the enzyme known as alkaline phosphatase, obtained from calf
intestines. This enzyme seems to be actually activated by 2,2,2-trifluoroethanol in the
presence of pH 10 carbonate buffer. The focus of this experiment is to determine the
dependence of enzyme activity changes on temperature during the activation of the
enzyme with the carbonate buffer (pH 10) and the various amounts of trifluoroethanol. The
temperatures tested were 45 °C, 65 °C, and 85 °C. The experiment was then extended by
utilizing carbonate and Tris buffers, at a pH of 9, and examining their effects. We report on
the buffer dependence of the activation of alkaline phosphatase in trifluoroethanol.
CHED 407
Algorithm based mutagenesis analysis of the human DNA polymerase kappa Nclasp domain
Jeremy C Maré1, [email protected], Jason M Walsh2, Ramya Parasuram2, Mary
Jo Ondrechen2, Penny J Beuning2, Samer Lone1. (1) Department of Chemical Sciences,
Bridgewater State University, Bridgewater, MA 02325, United States (2) Department of
Chemistry and Chemical Biology, Northeastern University, Boston, MA 02115, United
States
The environmental carcinogen benzo[α]pyrene 7,8-diol-9,10-epoxide (BPDE) has been
reported to be a major constituent in cigarette smoke and a major carcinogen responsible
for lung cancer. DNA damaged by BPDE cannot be replicated by classical DNA
polymerases. However, human DNA pol kappa (polκ) has been shown to perform a special
type of DNA synthesis known as translesion synthesis; allowing for polκ to replicate across
DNA damaged by BPDE. To obtain a deeper understanding of polκ's role in
benzo[a]pyrene bypass, we have used the computational methods THEMATICS and
POOL to select for residues responsible for enzymatic activity. Of significant interest is the
N-clasp domain of polk, which has been shown to be essential for this polymerase's
bypass ability. We have created several variants within the N-clasp domain and we are
currently examining how these changes affect the ability of polk to perform bypass across
DNA that has been site-specifically modified with benzo[α]pyrene.
CHED 408
WITHDRAWN
CHED 409
Investigation into the functionality of the E. coli sliding clamp and polymerase IV
James McIsaac1, [email protected], Philip Nevin2, Penny Beuning2, Sam
Lone1. (1) Department of Chemistry, Bridgewater State University, Bridgewater, MA,
United States (2) Department of Chemistry and Chemical Biology, Northeastern
University, Boston, MA, United States
Understanding the mysteries of the molecular world is of paramount importance where it
concerns the protein machinery that maintains and protects the functions of life. This
project was designed to pierce the veil of this unseen world and uncover answers about the
functionality of polymerase IV and the sliding clamp sub-unit of the Beta clamp.
Polymerase IV is a bacterial enzyme involved in translesion synthesis. In order to
understand what occurs when primer extension fails, unwanted cystines were removed and
an Alexa fluorophors will be attached to detect conformational changes using singlemolecule FRET. The sliding clamp works with other proteins in order to maintain their
proximity to DNA and increase processivity. Mutations have been created by rearranging
the position of domains within the clamp to determine the significance of a nearly identical
geometry between the domains. Protein function will be evaluated using methods such as
in vitro replication assays.
CHED 410
Inhibition of SbnH and select NIS synthetase enzymes in the siderophore
biosynthetic pathways of Staphylococcus aureus
Allyson A Cox, [email protected], Brittany S Soto, Ian P Kelly, David J. A. Schedler,
William Kittleman.Department of Chemistry and Physics, Birmingham-Southern College,
Birmingham, Alabama 35254, United States
Staphylococcus aureus is one of the leading causes of hospital-acquired infections. It is
also notorious for developing resistance to known antibiotics. The purpose of this research
is to develop new therapeutic agents that inhibit, or eliminate, the growth of S. aureus by
targeting the biosynthesis of the essential, iron-scavenging siderophores staphyloferrin A
and staphyloferrin B. Transition state/multi-substrate inhibitors of the citrate-activating NIS
synthetase enzymes SfnaB, SfnaD and SbnE have been designed along with a fluorinated
substrate analogue of the PLP-dependent decarboxylase SbnH. SfnaB and SfnaD
synthetases are located in the staphyloferrin A pathway, while SbnE and SbnH catalyze
the first and second reactions, respectively, of staphyloferrin B biosynthesis. Cloning of all
four enzymes has been carried out along with pilot expression and purification
experiments. Synthesis of the fluorinated SbnH analogue and the enzymatic production of
the SbnH substrate are underway.
CHED 411
Role for the tumor suppressor p27kip1 in cancer cell metabolism
Tyler A. Matheny, [email protected], Steven Kennedy, Robert J.
Sheaff.Department of Chemistry and Biochemistry, The University of Tulsa, Tulsa, OK
74104, United States
Inappropriate proliferation of cancer cells requires the utilization of nutrients to synthesize
the biomolecules needed for production of new cells. . The Warburg effect describes tumor
dependency on aerobic glycolysis rather than the electron transport chain to generate
sufficient ATP and shunt carbons into production of biomolecules needed for proliferation.
While angiogenesis provides the tumor with a means of obtaining the high levels of
required glucose, it occurs rather late in cancer progression. Thus, cancer cells might
utilize other methods and metabolic pathways to obtain nutrients during pre-angiogenic
tumor progression. P27kip1 is thought to function as a tumor suppressor protein via
inhibition of cell cycle progression. However, a comparison of metabolic pathways in p27
+/+ and p27-/- mouse fibroblasts suggests cells lacking p27 can utilize nutrient sources
other than glucose. This may provide cancers with decreased p27 protein with a selective
growth advantage during the early stages of tumorigenesis.
CHED 412
Cancer cell cannibalism
Philip J Gasser, [email protected], Stephen Kennedy, Robert J Sheaff.Department of
Chemistry and Biochemistry, The University of Tulsa, Tulsa, Oklahoma 74104, United
States
Cancer cells must obtain sufficient nutrients for cell duplication. Late-stage tumors promote
angiogenesis to obtain high levels of glucose, but early stage transformed cells cannot. To
investigate how initial stage cancer cells obtain nutrients, tumor formation was
recapitulated in culture using transformed H293s. These cells initially grow as a single layer
of adherent cells, but once space is no longer available will grow on top of one another,
forming a mass of cells (or foci) analogous to a tumor. When non confluent cells were refed
with media lacking growth factors, foci formation was induced. An analysis of cell viability
within the foci suggested cells attached to the plate were preferentially dying, which
suggests cells within the foci mass are cannibalizing attached cells to promote tumor
formation. This ability to obtain nutrients from other cells could be important for early tumor
progression, and may represent a novel target for therapeutic intervention.
CHED 413
Identifying biological targets of the novel naphthoquinone adduct 12,13dihydro-Nmethyl-6,11,13-trioxo-5H-benzo[4,5]cyclohepta[1,2-b]naphthalen-5,12-imine
Timothy E Nissen, [email protected], Stephen Kennedy, Robert J
Sheaff.Department of Chemistry and Biochemistry, University of Tulsa, Tulsa, OK 74104,
United States
The naphthoquinone adduct 12,13dihydro-N-methyl-6,11,13-trioxo-5Hbenzo[4,5]cyclohepta[1,2-b]naphthalen-5,12-imine (hereafter called TU100) has been
identified as a cytotoxic agent against various cancer cell lines. It can function as a
topoisomerase inhibitor, but it is unclear whether this activity is responsible for its effects on
cell viability. TU100 can also inhibit luciferase, a class of oxidative enzyme involved in
bioluminescence. In this regard it is similar to resveratrol, a well known component of red
wine associated with longevity and anti-cancer effects. To identify other potential biological
targets of TU100, tissue culture cells were treated with TU100 and effects on other
oxygenases like monoamine oxygenase and resveratrol targets such as Sirtuin 1 were
analyzed.
CHED 414
Cloning, overexpression, and purification of octopine dehydrogenase from
Argopecten irradians
Timothy Clark1, [email protected], Jennifer Miller2, Alexis Ceasrine2, William
Jordan2, Maureen Krause2, Scott Lefurgy1, [email protected]. (1) Department of
Chemistry, Hofstra University, Hempstead, NY 11549, United States (2) Department of
Biology, Hofstra University, Hempstead, NY 11549, United States
Octopine dehydrogenase (ODH) catalyzes the final step of glucose fermentation in the bay
scallop Argopecten irradians, producing octopine and NAD+ from pyruvate, arginine and
NADH. Three stably maintained alleles of the ODH gene were identified in Argopecten
populations in coastal areas of Long Island, on the basis of differential protein
electrophoretic mobility. The alleles differ by one to three amino acid substitutions outside
the active site. To determine the functional differences between them, the three alleles
were subcloned into a bacterial expression vector, expressed in Escherichia coli as fusion
proteins with an N-terminal affinity tag and purified by column chromatography. The affinity
tag was removed by site-specific proteolysis and subsequent chromatography, yielding 1015 mg of native enzyme per liter of culture. Preliminary data suggest that the three enzyme
variants differ in their amino acid substrate preference.
CHED 415
Substrate selectivity of octopine dehydrogenase from Argopecten irradians
Jessica Spinelli, [email protected], Beena Biju, Nicholas Condiles, Scott
Lefurgy, [email protected] of Chemistry, Hofstra University, Hempstead,
NY 11549, United States
Opine dehydrogenases comprise a family of enzymes that catalyze the final step of
anaerobic glucose fermentation in marine invertebrates. This step includes the NADH to
NAD+ recycling typically carried out by lactate dehydrogenase. These enzymes also
catalyze formation of a carbon-nitrogen bond between pyruvate and an alpha-amino acid
specific to that family member. The product is a single diastereomer with two chiral centers
that is structurally similar to some clinically effective angiotensin converting enzyme (ACE)
inhibitors. The bay scallop Argopecten irradians employs octopine dehydrogenase (ODH),
a family member that is usually specific for arginine. To assess its selectivity for amino
acids, recombinantly expressed and purified ODH was tested in vitro against a panel of
amino acids. Unlike the previously studied ODH homologue in a related scallop, the
Argopecten enzyme shows a relaxed amino acid selectivity that is sensitive to the assay
mixture composition.
CHED 416
Glycosylation of cysteine-containing ankyrin repeat proteins: New multivalent
ligands for wheat germ agglutinin
Lindsay Euers, [email protected], Michael Rodriguez, Jessica
Hollenbeck.Department of Chemistry, Trinity University, San Antonio, TX 78212, United
States
Multivalent interactions are characterized by the simultaneous binding of multiple ligands to
one or more target receptors and can occur through such binding modes as chelation,
clustering, and statistical rebinding. We have shown previously that glycosylated ankyrin
repeat (AR) proteins can be used to cluster multiple copies of the carbohydrate-binding
protein concanavalin A. To demonstrate that the same scaffold can be used to chelate
multiple binding sites on an oligomeric receptor, we have targeted an alternate
carbohydrate-binding protein, wheat germ agglutinin (WGA). WGA forms a stable
homodimer with pairs of binding sites for N-acetyl glucosamine (GlcNAc) separated by 14
Å. The distance between adjacent repeats in the crystal structure of the AR domain is ~10
Å, thus glycosylated AR proteins with >2 repeats should span multiple binding sites.
GlcNAc derivatives were synthesized and conjugated to pendant thiols on the AR scaffold,
generating a new class of multivalent ligands for WGA.
CHED 417
Characterization and inhibition studies of the ornithine racemase involved in
staphyloferrin A biosynthesis in Staphylococcus aureus
Jean D Rugamba, [email protected], Ian P Kelly, David J. A. Schedler, William
Kittleman.Department of Chemistry and Physics, Birmingham-Southern College,
Birmingham, Alabama 35254, United States
Staphylococcus aureus is a gram-positive bacterium responsible for numerous infections
including those of the skin, heart, and soft tissue. It is one of the leading causes of hospitalacquired infections and in extreme cases can lead to death. Due to its continued
development of resistance to current antibiotics there is an urgent need for new drugs to
battle this pathogenic bacteria. The purpose of this research is to develop new therapeutic
agents that inhibit the biosynthesis of staphyloferrin A (SfnA), an iron-binding siderophore
produced by S. aureus. This research characterizes and carries out mechanistic inhibition
studies of the ornithine racemase, SfnaC, located in the staphyloferrin A biosynthetic
pathway. Results of characterization studies include cloning, overexpression and
purification of recombinant SfnaC, results of in vitro activity assays, UV-vis spectral
characterization of bound pyridoxal 5'-phosphate (PLP), and initiation of the synthesis of
two mechanistic-based inhibitors, an ornithine phosphonate and a fluoroornithine analogue.
CHED 418
Inhibiting NF-κB: Peptides designed as biomimetics for the treatment of epilepsy
Candace Brooke Wood, [email protected], Tabitha N Williford, Amanda L
Stewart.Department of Chemistry, Georgia Southern University, Statesboro, Georgia
30460, United States
Nuclear Factor-kappa B (NF-κB) is a transcription factor involved in many physiological
processes including many neurological diseases. NF-κB regulates the expression of
various proteins by binding specific κB DNA sites. One such protein expressed is the brain
derived neurotrophic factor (BDNF). Overexpression of BDNF is associated with seizure
activity. Some research suggests that the relationship between NF-κB and BDNF may be a
key point of regulation within this signaling pathway. Peptides will be designed and
synthesized to mimic the binding site of the NF-κB protein. Peptides that bind the κB DNA
sequence tightly will be incorporated in inhibition studies to determine their ability to
prevent recognition of κB DNA. Using fluorescence binding studies, the peptide binding
affinities for the DNA κB sequence can be determined. The results will have implications for
epilepsy as well as other neurological disorders.
CHED 419
Investigation of chemotaxis protein-protein interactions in Epulopiscium sp. type B
using a yeast two hybrid system
Brie Levesque, [email protected], Andrew Piefer.Department of Chemistry,
Hartwick College, Oneonta, NY 13820, United States
Epulopiscium sp. Type B is a large aquatic bacterium that resides in the gut of surgeonfish.
From genomic data, Epulopiscium (Epulo) is predicted to have a chemotactic sensory and
motility system similar to Escherichia coli and Bacillus subtilis. Our experiments are
designed to test the protein-protein interactions between methyl-accepting chemotaxis
proteins (MCPs) and the Che proteins, CheA (a sensory kinase) and CheW (an adaptor
protein), through the use of a yeast-2-hybrid (Y2H) assay. We hypothesize based on
genetic homology that Epulo chemotaxis proteins will behave in a similar fashion to their
orthologs in B.subtilis and E.coli. The Y2H tests protein-protein interactions in
Saccharomyces cerevisiae. Preliminary results detected an interaction between CheA and
CheW. Other interactions have not yet been detected; possibly because CheW seems to
be toxic to yeast. Alternatively, a CheA+CheW+MCP ternary complex might be necessary
for MCP binding. Further research to explore these possibilities is ongoing.
CHED 420
Peptides designed for biomimetic studies of NF-κB inhibition
Lindsey M Burch, [email protected], Amanda L Stewart.Department of
Chemistry, Georgia Southern University, Statesboro, Georgia 30460, United States
The protein nuclear factor-kappa B (NF-κB) is a transcription factor which is critical in
cellular response to inflammation, apoptosis, and immune response. Inhibitor of kappa B
(IκB) molecules inactivate NF-κB, keeping the protein within the cytoplasm.
Phosphorylation of IκB degrades the inhibitor, allowing for NF-κB passage into the nucleus
where it regulates the expression of numerous genes related to immune and inflammatory
response. While NF-κB is crucial for immune response, its untimely activation and the
overexpression of certain inflammatory proteins can result in various diseases such as
cancer and many neurological disorders. Peptides mimicking IκB will be designed to study
specific interactions that are key to binding of NF-κB by IκB. The peptides with highest
binding affinities for the protein will be screened as broad based inhibitors for the NF-κB
signaling pathway. Fluorescence binding studies and CD structure studies will be
completed to characterize all designed peptides.
CHED 421
Synthesis of heterobifunctional ankyrin repeat proteins by metabolic labeling with
azidohomoalanine
Rachel Barnes, [email protected], Jessica Hollenbeck.Department of
Chemistry, Trinity University, San Antonio, TX 78212, United States
Ankyrin repeat (AR) proteins have a repetitive structure that is ideally suited for the display
of multiple functional groups and/or recognition elements in a well-defined threedimensional array. We have previously demonstrated the use of cysteine-containing AR
proteins to append mannose residues to unique sites on the AR scaffold, and we
hypothesized that we could extend this strategy to synthesize heterobifunctional AR
proteins by incorporating “clickable” methionine surrogates at alternate sites in the protein
backbone. In media lacking methionine, E. coli methionyl-tRNA synthetase will accept the
non-natural amino acid azidohomoalanine (Aha), thereby incorporating a unique chemical
handle at these positions. We have expressed and purified Aha-containing AR proteins
from E. coli and have glycosylated the bifunctional scaffold using a combination of
mannose and N-acetyl glucosamine derivatives.
CHED 422
In vitro self-assembly of type I collagen onto different substrates
Eryn K. Matich2, [email protected], Ming Fang1, Elizabeth L. Goldstein1, Brad G. Orr1,
Mark M. Banaszak Holl1. (1) Department of Chemistry, University of Michigan, Ann Arbor,
Michigan 48103, United States (2) Division of Chemistry, Alfred University, Alfred, New
York 14802, United States
Using atomic force microscopy, the self-assembly process of Type I collagen is followed at
collagen concentrations from 0.5 to 100 µg/mL on muscovite mica, phlogopite mica, glass
capillary tube, molybdenum disulfide (MoS2) and graphite. No fibril formation was found on
MoS2 and graphite. The specific fibril patterns on mica surfaces are related to the mica
crystal structure. The self-assembled collagen fibrils have a distribution of D-spacings, with
an average value of 65-66 nm and a range between 55-70 nm. At 10 mg/mL, dense
collagen fibrils form a gel in capillary tubes. When the gel from these glass capillary tubes
is deposited on MoS2, they exhibit a D-spacing distribution similar to mica. The selfassembled collagen fibrils on various substrates showed similar D-spacing to those
observed in biological tissues. This suggests Type I collagen assembly without heterotypic
collagens or fibrillar cross-links is the origin of the D-spacing distribution.
CHED 423
Solvent isotope effects on DNA-protein crosslinking
Zitadel Anne Perez, [email protected], Christia A Sison, Eric D. A.
Stemp.Department of Physical Sciences, Mount St. Mary's College, Los Angeles, CA
90049, United States
Oxidative DNA damage contributes to cancer and degenerative diseases. Guanine is
particularly vulnerable to oxidation, creating guanine radicals which form crosslinks to
proteins. Here, we investigate the solvent isotope effect on oxidative DNA-protein
crosslinking reactions for the oligonucleotide 5'-AATAXTTTTGTTTGCGTGGATGGTTCTC3' (X = 2-aminopurine, a strong photooxidant). For this oligonucleotide duplex, the amount
of permanent guanine damage in the form of DNA-protein crosslinks depends on
competition between back electron transfer from 2-aminopurine radical anion to the
guanine radical cation and the trapping reaction, which may involve the formation of the
neutral guanine radical. Crosslinking experiments using this oligonucleotide with histone
H2A yielded more damage in H2O than in D2O. In contrast, in a flash-quench system where
back electron transfer has been eliminated, D2O yielded more damage, consistent with
greater yields of guanine radical in D2O. Taken together, these results suggest that
trapping involves the deprotonation of the guanine cation radical.
CHED 424
High speed HPLC/fluorescence (HPLC/FL) analysis of serotonin and its metabolites
in tissue and fluids: Applications in applied neurochemical analysis
Bridgett K. Carter, [email protected], Rebecca M. Baroody, Tyler G. Kethro,
Edward J. Caliguri.Department of Chemistry, Sacred Heart University, Fairfield, CT 06825,
United States
High performance liquid chromatography with fluorescence detection has been used for
some time to measure Serotonin (5-hydroxy tryptophan, 5HT) and its metabolites. Here we
preset separations using both 2.0 micron and 1.6 micron C-18 particulate columns. These
columns should provide increased speed and sensitivity making their use more efficient.
The features of these methods are showcased in initial studies involving Serotonin activity
changes in the brain and body fluids of animals that have been administered statin
medications as well as those that have 5HT-1A receptor deficiencies.
CHED 425
Investigations of the active site of 5, 10-methenyltetrahydrofolate synthetase
(MTHFS) from Mycoplasma pneumoniae
Casey R. Wojtera, [email protected], Timothy W. Johann.Department of
Chemistry, Roanoke College, Salem, Virginia 24153, United States
The enzyme, 5, 10-methenyltetrahydrofolate synthetase (MTHFS) plays a significant role in
the folate metabolism of an organism. MTHFS is the only enzyme known to convert folinic
acid into 5, 10-methenyltetrahydrofolate. Amino acids hypothesized to interact with folinic
acid were investigated. Gene sequences of MTHFS were mutated using site directed
mutagenesis. Through several transformations, induction, and various purifications, mutant
enzymes were obtained and were tested kinetically. Based on inferences made from the
calculated KM and kcat values, the amino acids Y122, Y123, E55, and F118 were concluded
to be important for binding folinic acid in the active site and for maintaining catalytic
efficiency of the enzyme. In addition, the mutation of glutamine to alanine at position 144
yielded an enzyme that bound the substrates of ATP and folinic acid weaker than the wildtype enzyme, but demonstrated a 2.74 fold increase in kcat.
CHED 426
Isoprene synthase: A key to cellular relief from toxic isoprenoid precursors in E.
coli?
Jordan A Killop, [email protected], Tami Sivy.Department of Chemistry, Saginaw Valley
State University, University Center, MI 48710, United States
Practicing recombinant DNA technology has shown great potential to decrease both the
cost and the environmental impact of developing important prenyl-based drugs such as the
anti-malarial artemisinin and tumor-suppressor Taxol. For reasons not fully understood,
progress has been limited by the decreased cell growth of bacterial hosts used to produce
these drugs. The cause of death is suspected to be toxicity of isoprenoid precursors. We
studied the effects of decreasing the levels of the putative toxic compounds, DMAPP and
IPP, by expressing an isoprene synthase from poplar in E. coli. As this enzyme uses
DMAPP as a substrate to produce the volatile and releasable isoprene, we hypothesize
that its activity could be used to relieve the cytotoxicity. The isoprene synthase expression
was varied and paired with increased flux through a heterologous isoprenoid pathway in
order to test the hypothesis and examine the influence of intermediate levels on
cytotoxicity.
CHED 427
Cisplatin-induced apoptosis in HeLa cells to determine potential mechanisms for
drug resistance
Mackenzie M. Shipley, [email protected], Andrew J. Piefer.Department of
Chemistry, Hartwick College, Oneonta, New York 13820, United States
The purpose of this project is to study the cisplatin-induced apoptosis mechanism in HeLa
cells. Apoptosis or programmed cell death occurs when molecular lesions are formed in
genomic DNA. By using small-interfering RNA (siRNA), the oncogene c-Abl will be knocked
down. c-Abl encodes a cytoplasmic and nuclear protein tyrosine kinase involved early in
the apoptotic pathway. A colorimetric assay kit will be used to measure the amount of
caspase-3 present in cells (indicative of apoptosis) before and after knockdown of c-Abl.
The results of this research will determine if c-Abl is involved in cisplatin mediated
apoptosis in a cervical cancer cell line and may reveal potential drug resistance
mechanisms.
CHED 428
Quantitative analysis of metal ion, chlorophyll, and antioxidant activity in senescing
Ginkgo biloba leaves
Ashley M. Mannix, [email protected], Virginia S. Smith.Department of
Biochemistry, United States Naval Academy, Annapolis, MD 21412, United States
A vital source of antioxidants, the leaves of the Ginkgo biloba tree represent a promising
field of medicinal research. A full year of Ginkgo biloba leaf extracts were analyzed to
determine peak antioxidant activity via sample time delays in the Briggs-Rauscher
oscillating reaction. The assays revealed that senescent (yellow) Ginkgo leaves have a
higher average antioxidant activity than the green leaves, suggesting antioxidant
compounds may protect against metal-ion induced oxidation after chlorophyll is gone.
Metal ion concentrations were determined by performing microwave digestion in hydrogen
peroxide and nitric acid followed by atomic absorption spectroscopy. Analysis of calcium,
iron, and magnesium ions indicate that peak levels correlate to the senescent phase of
Ginkgo leaves. Chlorophyll levels determined by UV-visible and fluorescence spectroscopy
were also correlated to the levels of metal ions. The combined analysis of antioxidants,
metal ions, and chlorophyll levels provide a detailed chemical profile of Gingko leaf
senescence.
CHED 429
Synthesis and evaluation of alkyne derivatives of parthenolide for identification of
cellular protein targets
Myungsun Shin, [email protected], Thanprakorn Chiramanewong,
[email protected], Rebecca E. Connor.Department of Chemistry, Dickinson College,
Carlisle, PA 17013, United States
The sesquiterpene lactone, parthenolide, is a natural product found in the medicinal plant
feverfew. Parthenolide is known for its anti-inflammatory effects and potential of its amino
derivatives as chemotherapeutic agents for the treatment of leukemia and other cancers.
Parthenolide contains an electrophilic γ-butyrolactone functional group that will covalently
modify biological nucleophiles, such as amino acids in proteins. We have synthesized
alkyne derivatives of parthenolide in order to identify proteins modified by or binding to
parthenolide using copper-catalyzed azide-alkyne Huisgen cycloaddition (CUAAC). The
alkyne-parthenolide derivatives have been tested as reagents in CUAAC reactions with
azidopropylbiotin using TBTA as the ligand. Covalent modification of model proteins by the
alkyne derivatives has been used to validate the use of CUAAC. Protein targets in human
acute myelogenous leukemia (THP-1) cells will be identified following cellular treatment
with the derivatives, using CUAAC to append an azide-biotin tag for affinity capture.
CHED 430
Oxidative crosslinking between tRNA and protein
Bridgett Cabrera, [email protected], Pia Cartagena, [email protected],
Alyson Thien, [email protected], Zitadel A Perez, Kelsey Miller, Eric
Stemp.Department of Physical Sciences, Mount St. Mary's College, Los Angeles, CA
90049, United States
Oxidation of guanine can lead to DNA-protein crosslinking. Transfer RNA molecules
encounter many proteins during translation and we investigated whether guanine oxidation
can also produce RNA-protein cross-linking. tRNAPhe in the presence of histone or
poly(lysine) was subjected to the flash-quench technique, a method known to selectively
oxidize guanine. Irradiation of ethidium or Ru(phen)2dppz2+ [phen = phenanthroline, dppz =
dipyridophenazine] in the presence of Co(NH3)5Cl2+ (an oxidative quencher) led to a loss in
the intensity of the free band for the tRNA and a corresponding appearance of bands with
lesser mobility in gel shift experiments. In addition, in the chloroform extraction assay, a
drop in the 260 nm absorbance of the RNA was observed upon flash quench treatment.
These results are consistent with RNA-protein cross-linking as a result of guanine oxidation
and suggest that this may be another consequence of oxidative stress.
CHED 431
Effects of alkynyl-parthenolide derivatives on cellular viability, glutathione levels,
and cellular signaling of human leukemia cells, THP-1
Gabriel J. DiNatale, [email protected], Rebecca E. Connor.Department of
Chemistry, Dickinson College, Carlisle, PA 17013, United States
Parthenolide, a natural extract from the feverfew plant, and its water-soluble amino
derivatives have been proven to be effective in killing leukemia stem cells. Parthenolide
and its derivatives are capable of the covalent modification of proteins through an
electrophilic α,β-unsaturated exocyclic methylene group. We have synthesized derivatives
of parthenolide modified with alkyne functional groups for the identification of cellular
protein targets of these electrophilic molecules. This work describes the characterization of
parthenolide and our synthesized derivatives for their effects on the viability of THP-1 cells
both in suspension and after differentiation into macrophages. The effect on cellular
glutathione levels over time and with increasing concentration of parthenolide and our
derivatives was compared to the effect produced by phorbol-12-myristate 13-acetate, a
known inducer of THP-1 monocyte differentiation. Changes in cellular signaling after
treatment were assayed by immunoblot for the NFκB and heat shock response pathways.
CHED 432
Characterization of Aspergillus niger cellulase for biomass conversion
Jennifer A. Hill, [email protected], Lovepreet Singh, Robert C. Steinmeier.Department of
Chemistry, University of Arkansas at Little Rock, Little Rock, Arkansas 72204, United
States
Enzymes capable of hydrolyzing cellulose are found in filamentous fungi and bacteria. The
study undertaken was of the extracellular cellulase cocktail from Aspergillus niger which
included cellobiohydrolase, endoglucanase, and β-glucosidase activities that work
synergistically to break down cellulose. The effects of organic solvents on different enzyme
activities were analyzed as well. Inhibition of different enzyme activities by ethanol and
dimethylsulfoxide was studied using selected substrates. Compared with T. reesei, A. niger
cellulase had much higher β-glucosidase activity for cellobiose or p-nitrophenyl-β-glucoside
(PNPG) and also had higher activity with Avicel. Gluconolactone completely inhibited
reaction with PNPG but not cellobiose. Reaction of A. niger cellulase with p-nitrophenyl-βD-cellobioside was kinetically complex and p-nitrophenyl-β-D-lactoside was unreactive.
With CMC as the substrate, inhibition of A. niger cellulase by ethanol or DMSO is more
pronounced than with T. reesei. The same is true for ethanol inhibition of β-glucosidase
activity with PNPG as the substrate.
CHED 433
Effects of an enaminone library with amino acid functionalities on protease activities
Kevin Thomas, [email protected], Phillip Goree, Stephen Kennedy, Robert J
Sheaff.Department of Chemistry and Biochemistry, The University of Tulsa, Tulsa, OK
74104, United States
Proteases are enzymes which hydrolytically cleave peptide bonds at specific amino acid
residues in proteins. They play many important biological roles associated with human
disease, such as in cancer metastasis, viral infection, and certain neurological disorders.
Thus, protease inhibitors make up a whole class of pharmaceutical compounds. A library of
enaminones with amino acid functional groups was analyzed for its effects on protease
activity. The 31 synthesized compounds underwent screening against four different purified
proteases (bromelain, trypsin, chymotrypsin, and protease A) to determine their effects on
proteolytic activity using BSA as a substrate. A few compounds demonstrated both
activation and inhibition of protease activity, especially when utilizing bromelain. This
capacity for modulating protease activity suggests that some of the enaminones might
have biological activity and serve as promising intermediates for the synthesis of novel
compounds with therapeutic potential.
CHED 434
Decay of guanine radical produced by the flash quench technique: Dependence
upon quencher
Evelyn Carrillo, [email protected], Veronica L Torres,
[email protected], Jenny Garcia, [email protected], Eric Stemp,
Robert Senter.Chemistry, Mount Saint Mary's College, Los Angeles, CA 90049, United
States
Oxidative damage to DNA is a causative factor in disease and guanine can be readily
oxidized by the flash quench technique. Here, we compared the guanine radical decay in
DNA, with the quenchers Ru(NH3)63+ and Co(NH3)5Cl2+. Using nanosecond transient
absorption spectroscopy at 373 nm, the guanine radical decays within 100 µs with
Ru(NH3)63+ as quencher, but persists for milliseconds with Co(NH3)5Cl2+. On a longer
timescale, excitation with a camera flash produces a detectable transient species with an
absorbance maximum of ~390 nm. In related studies using guanosine-5'-monophosphate,
flash quench with the cobalt quencher produces a broad absorption between 300 nm and
380 nm that decays on the seconds time scale; in contrast, Ru(NH3)63+ gives no signal.
These results can be explained by the lability of the Co(II) complex formed upon reduction
and formation of a guanine radical that decays into another related radical species on a
longer timescale.
CHED 435
Optimizing the expression of recombinant nitrobenzene dioxygenase ferredoxin
from Comamonas JS765 in E. coli
Mark D Bostrom, [email protected], Matthew Neibergall, Brock Cash, Paige
Murray.Department of Biochemistry, Bethel University, St. Paul, Minnesota 55112, United
States
The nitrobenzene dioxygenase enzyme system (NBDOS) initiates the degradation of
nitroaromatic compounds in the bacterium Comamonas JS765. The primary goal of this
research project is to optimize the conditions for over-expressing the NBDOS ferredoxin
component in E. coli. This report describes how the following variables impact protein
expression: Media formulation, temperature, induction time, and inducer concentration. The
results will advance research on the nitrobenzene dioxygenase system.
CHED 436
Electrochemical phenomena in the Venus flytrap
Chrystelle L. Vilfranc, [email protected], Alexander G. Volkov.Department
of Chemistry, Oakwood University, Huntsville, Alabama 35896, United States
The total hunting cycle of the Venus flytrap consists of the following 5 stages: open state,
closed state, locked state, constriction and digestion state, and the semi-open state. The
opening of the trap after digestion consists of two steps: the opening of the lobes and the
changing of their curvature from a concave shape to a convex shape. Each stage of the
hunting cycle has different electrical characteristics. The biologically closed electrochemical
circuits in the Venus flytrap are analyzed using the charge-stimulating method. If the initial
voltage applied to the Venus flytrap is 0.5V or greater, changing the polarity of the
electrodes between the midrib and one of the lobes will result in a rectification effect and
different kinetics of a capacitor discharge. These effects are due to the fast transport of
ions through voltage gated ion channels. The electrical properties of the Venus flytrap were
investigated. The equivalent electrochemical circuits, within the upper leaf, were proposed
to explain the experimental data.
CHED 437
System for comparing relative rates of back electron transfer and crosslinking
Christina Khorozyan, [email protected], Melissa Marquez,
[email protected], Shushan Khorozyan, [email protected], Zitadel
Anne Perez, Kelsey Miller, Eric Stemp.Department of Physical Sciences, Mount St. Mary's
College, Los Angeles, CA 90049, United States
Electron holes produced upon DNA oxidation are mobile and can move throughout the
base stack. One possible trapping reaction for guanine radicals is the formation of DNAprotein crosslinks. The fluorescent analogue, 2-aminopurine can photo-oxidize guanine
and undergo back electron transfer. Titration of 2-AP with guanosine-5'-monophosphate
results in quenching, consistent with redox. We placed 2-aminopurine into a DNA strand at
two different distances from the nearest guanine base to determine the relative rates of
back electron transfer and crosslinking to protein. Crosslinking was detected by gel shift
assay. A 29-mer DNA duplex containing a 5'-G(T)nX-3' sequence was used (n=0,4 and
X=2-aminopurine). Upon irradiation, no change was seen in the mobility of n=0. However,
n=4 showed a decrease in free DNA bands and the appearance in lower mobility bands; in
the n=4 duplex, back electron transfer, does not compete as well with the protein trapping
reaction.
CHED 438
Quantitative analysis of the binding of mammalian linker histone isotopes to
chromatin in vivo
Jacob Files1, [email protected], David T Brown2. (1) Biochemistry
Department, Spring Hill College, Mobile, Alabama 36608, United States (2) Biochemistry
Department, University of Mississippi Medical Center, Jackson, Mississippi 39201, United
States
The linker or H1 histone is a protein that binds and compacts DNA. Recent investigations
have shown that these histones are mobile proteins, constantly moving from one strand of
DNA to another. This movement of the H1 histone is thought to regulate chromatin
compaction. In this experiment, the mobility of different linker histone subtypes (H1a, H1b,
H1c, and H1d) was measured and compared to the control (H10). To achieve this purpose,
DNA plasmids were created that were contained two different H1 protein genes, each
attached to a different fluorescent protein. These plasmids were introduced into mouse
fibroblast cells and the cells produced the different histone subtypes that were coded for on
the plasmid. The mobility of each histone subtype was determined using a method called
FRAP (Fluorescent Recovery After Photobleaching). The results showed that this
experimental system is superior to other methods and that there are significant differences
among these subtypes with respect to their affinity to chromatin. In addition, chromatin decompaction, which is dependent upon H1 mobility, is necessary for efficient DNA repair.
Some radiation-resistant tumors have elevated levels of proteins that promote H1 mobility,
therefore producing hyperactive DNA repair systems. The information and techniques
developed in this experiment will be useful for understanding this phenomenon in greater
detail and might provide clues for effective treatments of these radiation-resistant tumors.
CHED 439
Employing linear free energy relationships (LFERs) to deduce solvolytic reaction
mechanisms
Jasbir K Deol1, [email protected], Maryeah T Pavey1,
[email protected], Malcolm J. D'Souza1, Dennis N. Kevill2. (1)
Department of Chemistry, Wesley College, Dover, DE 19901, United States (2)
Department of Chemistry & Biochemistry, Northern Illinois University, DeKalb, IL 60115,
United States
Substituted benzyl carbamate herbicides are synthesized using the appropriate benzyl
chloroformate and a substituted benzyl amine in an inert solvent. The compound, 4,5dimethoxy-2-nitrobenzyl chloroformate (1 ) is a fine powder. A literature survey also
showed that 1 is being used as a caged precursor to the capsaicin receptor TRPV1 and the
ioniotropic purinergic receptor P2X2, in which the photorelease of its active compounds
allow the agonists to be administered to neuron cells. In this undergraduate research
project, we analyzed the solvolytic rates of reaction of 1 in a variety of organic solvents with
widely varying nucleophilicity and ionizing power values. The reaction rates at 25.0oC were
determined using acid-base titrations over a select period of time. The addition of water to
any pure organic solvent except 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) caused an
increase in the reaction rate, hinting that water induces the leaving group to break quicker.
However in HFIP the exact opposite occurs; where the addition of water decreases the rate
of reaction. This suggests that 1 may follow a dual pathway which is strongly dependent on
both solvent nucleophilicity and solvent polarity (H-bonding effects). This project is
supported, in part, by the Delaware INBRE and EPSCoR programs ‐ supported by grants
from the National Center for Research Resources‐NCRR (5P20RR016472‐12) and the
National Institute of General Medical Sciences ‐ NIGMS (8 P20 GM103446‐12) from the
National Institutes of Health (NIH); a National Science Foundation (NSF) Delaware
EPSCoR grant EPS‐0814251; and a NSF ARI‐R2 grant 0960503.
CHED 440
Solid phase immobilization of a superoxide dismutase mimic
Edmund I Sharp, [email protected], Craig N Streu.Department of Chemistry and
Biochemistry, St. Mary's College of Maryland, St. Mary's City, Maryland 20686, United
States
Superoxide (O2-), one of the reactive oxygen species (ROS), is a toxic molecule produced
in the mitochondria during aerobic respiration and in the immune system to kill invasive
microorganisms. Given its toxicity, it must be removed to limit unwanted cellular damage.
Superoxide dismutases catalyze the dismutation of superoxide into molecular oxygen and
hydrogen peroxide. The presence of superoxide can be quantified by measuring the
hydrogen peroxide produced upon reaction with superoxide dismutase. In the interest of
developing an inexpensive flow cell for determining superoxide levels in biological tissues,
an artificial biomimetic MnIII-salen superoxide dismutase was synthesized as previously
described and immobilized onto magnetic beads containing amine groups. The synthesis,
loading, and activity of the particles are described.
CHED 441
Structural and functional bioinformatics analysis of proteins from Candidatus
Liberibacter asiaticus
Luis I Rosa2, [email protected], Nancy Arroyo3, Monica M Arroyo1. (1) Department of
Chemistry, Pontifical Catholic University of Puerto Rico, Ponce, PR 00717, Puerto Rico (2)
Department of General Science, Pontifical Catholic University of Puerto Rico, Ponce, PR
00717, Puerto Rico (3) Department of Biotechnology, Pontifical Catholic University of
Puerto Rico, Ponce, PR 00717, Puerto Rico
Huanglongbing (HLB) greening disease damages citrus crops costing millions of dollars in
Asia, Latin America, the United States, and Puerto Rico, among many countries. HLB
infection affects socio-economic development since there are several countries in
quarantine unable to export citrus, including Puerto Rico. The disease is caused by the
proteobacterium Candidatus Liberibacter asiaticus, transmitted by the Asian citrus psyllid
(Diaphorina citri Kuwayama). Infection may be due to a blockade of the phloem of the
plant, leading to significant accumulation of starch until it dies following obstruction of
nutrients. The HLB mechanisms of interaction with citrus plants are not well understood
and there are no therapies available. Initial analysis of 10 hypothetical proteins revealed
that they may be involved in transport, chemotaxis, adhesion, ligand binding interactions,
and metabolism. We hope our results will contribute to the advancement of research to
understand the proteobacterium's pathogenicity and infectivity, and subsequent
development of therapies.
CHED 442
Genetic analysis of rev variation in equine infectious anemia virus
Brandon Gines1,2, [email protected], Hyelee Loyd1, Susan Carpenter1. (1)
Department of Animal Science, Iowa State University, Ames, IA 50011, United States (2)
Department of Chemistry, Spring Hill College, Mobile, AL 36608, United States
Closely related to HIV is the Equine Infectious Anemia Virus (EIAV), a virulent pathogen of
horses. Genetic variation in the regulatory protein Rev of EIAV was examined throughout a
clinically dynamic disease course of an experimentally infected pony. Following infection
with the virulent EIAVwyo, the pony underwent a variable disease course, including an acute
fever episode at 11 days post-infection (DPI), recurrent fever episodes until 363 DPI, a
prolonged subclinical period, and several late fever episodes. Viral RNA was isolated from
sequential sera samples, and the rev exon 2 was amplified, cloned, and sequenced.
Sequence and phylogenetic analyses indicated that Rev was under selective pressure
throughout infection and suggested a linear progression of rev evolution characterized by
transience and divergence. These results suggest that genetic and perhaps biological
variation in rev may be a contributing factor in EIAV disease progression.
CHED 443
Delivery of paclitaxel with elastin-like polypeptides
Cassie Caudill1,2, [email protected], Jayanta Bhattacharyya3, Ashutosh
Chilkoti3. (1) Department of Chemistry, Transylvania University, Lexington, KY 40508,
United States (2) Department of Chemistry, Duke University, Durham, NC 27708, United
States (3) Department of Biomedical Engineering, Duke University, Durham, NC 27708,
United States
Paclitaxel, an anti-tumor drug that acts through mitotic inhibition, has poor solubility in
water and produces undesired side effects. A new method of delivering paclitaxel with a
biologically inspired polymer, elastin-like polypeptides (ELP), has been developed.
Paclitaxel was chemically conjugated to the elastin-like polypeptide delivery system via a
pH sensitive hydrazone bond that allows for release of the drug in the acidic environment
of tumors. Drug binding, micelle formation, and solubility of the paclitaxel-elastin-like
polypeptide conjugate were assessed. Cytotoxicity of the paclitaxel-elastin-like polypeptide
conjugate was evaluated with a cell proliferation assay using human and mouse breast
cancer cell lines. The retained cytotoxicity of the drug when bound to the delivery system
and the increased solubility at body temperature suggest that delivery of paclitaxel with an
elastin-like polypeptide transport system will increase effectiveness of this cancer-fighting
drug.
CHED 444
Paraaminobenzamidine linked iron oxide nanoparticles for bioseparations
Jose Javier Rosado, [email protected], Osvaldo Vega, Abimael Rodriguez,
Veronica Forbes, Vibha Bansal.Department of Chemistry, University of Puerto Rico at
Cayey, Cayey, PR 00736, United States
Cardiovascular disorders are the leading cause of disease related death in the USA; these
disorders can be treated using Plasminogen activators (PAs). The problem with this
treatment is that it is highly expensive due to inefficient downstream processing of PAs.
Magnetic nanoparticles (MNPs), as separation matrices, offer several advantages over
other common separation matrices. The main objective of this project was to develop
magnetic affinity nanoadsorbents for isolation of PAs. Iron oxide MNPs were synthesized,
functionalized with aminopropylsilane, and then linked to Para-aminobenzamidine, which is
known to be an affinity ligand for PA. The particles were tested for their ability to bind PA
from a monocomponent system (pure PA solution) as well as multicomponent system
(mammalian cell culture broth). The particles bound PA successfully in both the systems.
Results showed a 200-fold pure PA preparation after the separation. The purity of the
preparation was visualized through electrophoresis.
CHED 445
Quantitative determination of DNA affinity for PEGylated PAMAM dendrimer gene
delivery vehicles
Kyle Odell Chamberlain, [email protected], Lisa E Prevette.Department of
Chemistry, University of Saint Thomas, Saint Paul, Minnesota 55105, United States
Polycations have become popular non-viral gene delivery agents due to their easy
synthesis and ability to carry large amounts of DNA. To prevent toxic side effects and
aggregation, polyethylene glycol (PEG) is conjugated to the polymers to mask their charge.
Unfortunately, high PEG conjugation ratios can inhibit DNA binding. To optimize a
polymeric gene delivery agent's effectiveness, an ideal PEG length and ratio of PEG to
positive charge must be found. This study has used electrophoretic mobility shift,
isothermal titration calorimetry, and ethidium bromide exclusion assays to determine an
optimal PEG length and conjugation ratio for generation 5 polyamidoamine (G5 PAMAM)
dendrimer. PEG chain lengths of 750, 2000, and 5000 M.W. were conjugated to PAMAM at
1:3, 1:12, and 1:30 ratios. Results indicate greater PEG chain lengths inhibit PAMAM-DNA
binding affinity at all PEGylation ratios. Furthermore, at all PEG chain lengths, binding
affinity is greater at lower conjugation ratios.
CHED 446
Investigation of the potential for biofuels and other uses for duckweed in Oklahoma
Abe G. Blackburn, [email protected], Cord M. Carter, [email protected], Ricky
E. Lemons, Nicholas J. Wade, Dianne Baze, Nancy L. Paiva,
[email protected] of Chemistry, Computer & Physical Sciences,
Southeastern Oklahoma State University, Durant, OK 74701, United States
The overall goals were to investigate the potential of duckweed as a biomass source for
conversion to biofuels, as well as its utility for water purification and animal feed source.
Duckweed is a tiny floating aquatic plant native to Oklahoma, which grows rapidly to cover
ponds, doubling its biomass every 2-7 days while removing excess nutrients from water
and CO2 from air. Small (60-200 L) artificial pond cultures of duckweed were used to
produce biomass under different growth conditions for analysis and comparison with
natural farm pond samples. Oxygen bomb calorimetry revealed that the energy content of
dried duckweed samples compared favorably to switchgrass, a major biomass crop in OK,
and increases in %C correlated well with increased energy content. Growth conditions are
being tested to try to induce additional starch accumulation, further increasing the %C and
energy content.
CHED 447
Biomass growth and lipid extraction of Nannochloropsis oculata under natural and
artificial light in the Pacific Northwest
E. Lee Brewer, [email protected], Brandon Vance, Aaron Coby.Department of
Biology, Saint Martin's University, Lacey, WA 98503, United States
Fossil fuels play a significant role in the energy demands of the world and have significant
environmental and ecological effects. As populations increase, more people as well as
nations become dependent on these limited resources, and it becomes increasingly
important to find renewable energy sources that are cost efficient, easily implemented and
environmentally friendly. This experiment investigted the efficiency of growing lipidproducing algae in the Pacific Northwest under natural and artificial light. We hypothesize
that the artificial light sources will promote a larger algae biomass, and that because of the
intensity and wavelengths, the LED lighting system will produce the most extractable lipids
from the algae strain Nannochloropsis oculata, and that utilizing energy efficient lighting
sources such as LED's can make algae biofuel production a cost feasible operation which
can reduce or eliminate many of the energy requirements in distribution and some of the
energy requirements for growth and production.
CHED 448
Tat peptide-mediated gene delivery: Complex formation and interaction with cellsurface glycosaminoglycans
Danielle Francen, [email protected], Lisa Prevette.Department of Chemistry,
University of St. Thomas, St. Paul, Minnesota 55105, United States
Gene therapy consists of the delivery of foreign DNA to cells. Cell penetrating compounds,
such as Tat peptide, have been shown to facilitate DNA delivery through the formation of a
Tat/DNA complex. Different complex +/- ratios were tested using an electrophoretic
mobility shift assay with the goal of finding the stoichiometric ratio at which Tat fully binds
plasmid DNA. These results were confirmed and interaction thermodynamics were
determined by isothermal titration calorimetry (ITC). Complex hydrodynamic diameter was
determined in solvents of increasing ionic strength using dynamic light scattering. Positively
charged Tat was found to interact electrostatically with negatively charged cell surface
glycosaminoglycans (GAGs). A competitive displacement assay was conducted to find the
concentration of GAG needed to completely displace DNA from the Tat/DNA complex.
Results support Tat-GAG affinities measured by ITC and lend insight into potential cell
uptake mechanisms of these complexes.
CHED 449
Charge density and stereochemistry affect the interaction of PAMAM dendrimer with
glycosaminoglycans
Kristin J. Braden, [email protected], Lisa E. Prevette.Department of Chemistry,
University of St. Thomas, 1949 Lincoln Ave., St. Paul, MN 55105, United States
Cell-penetrating compounds, such as polyamidoamine (PAMAM) dendrimer, are often
attached to drugs to induce cellular uptake. We hypothesize that electrostatic interaction
occurs between the positively charged primary amines of PAMAM and negatively charged
glycosaminoglycans (GAGs) found on all cell surfaces to different extents. The interactions
between generation 5 PAMAM dendrimer and four GAGs have been studied using
isothermal titration calorimetry (ITC), dynamic light scattering (DLS), and gel
electrophoresis. ITC experiments revealed the binding thermodynamics. DLS was used to
confirm complex aggregation. Competitive displacement of DNA cargo from PAMAM by the
individual GAGs was studied using gel electrophoresis. It has been determined that
PAMAM-GAG affinity is dependent upon GAG charge density and stereochemistry. GAGs
can disrupt PAMAM-DNA complexes, which has implications at the cell surface during
nucleic acid delivery.
CHED 450
Understanding students' use of physical models in organic chemistry
Danielle L. Koch, [email protected], Madelyn G. Shore, Nathaniel P. Grove.Department
of Chemistry and Biochemistry, University of North Carolina Wilmington, Wilmington, NC
28403, United States
Molecular model kits are a ubiquitous presence in many organic chemistry classroom.
Paradoxically, many students purchase these kits yet never use them or fail to use them to
their full potential. This study attempts to better understand how students use molecular
model kits in organic chemistry to enhance their understand of course content and the
barriers they face in so doing.
CHED 451
Identification and quantitation of cocaine on U.S. banknotes collected from the
metro Detroit area by gas chromatography-mass spectrometry (GC-MS)
Yiwei Deng, Steven Akins, [email protected], Mariam Ayyash,
[email protected], Marwa Ayyash, Darcy Kemter-Munson, Harkamal Jhajj, Khadija
Jawad, Lyndsey Sass.Department of Natural Sciences, University of Michigan-Dearborn,
Dearborn, MI 48128, United States
Cocaine (benzoylmethylecgonin) is one of the most commonly abused illicit drugs in the
world. Many cocaine users use a wrapped banknote to sniff this drug. Banknotes become
contaminated during the abuse, exchange and storage of cocaine as well as other illicit
drugs. The presence of trace levels of illicit drugs is frequently used as a part of the
forensic evidence establishing a link between a suspect and these drugs. In this study, a
gas chromatography – mass spectrometry (GC-MS) method for cocaine analysis was
adopted for the Instrumental Analysis course at the UM-D. The method was employed for
identification and quantitation of cocaine on banknotes collected from various locations in
the Metro Detroit area. Cocaine was detected in 42% of the banknotes tested and the
amount of cocaine on each bill was in the range of 53 to 86 micrograms.
CHED 452
Size controlled synthesis of quantum dots for biological and chemical detection
Lauren Gagnon, [email protected], Faina Ryvkin.Department of Chemistry,
Emmanuel College, Boston, Massachusetts 02115, United States
Quantum dots have well-recognized applications for the detection of biological and
chemical materials due to their unique optical characteristics and are capable of being
synthesized in undergraduate physical chemistry courses. Hot solution decomposition is a
commonly used method of CdSe quantum dot synthesis at this level. However, the current
experimental procedure is limited by ineffective quantum dot size control. In an effort to
modify synthesis, bottom-up approaches including hot-solution decomposition,
microemulsion, and sol-gel synthesis, were investigated in terms of yield, recovery, and
size control process. Products were analyzed using absorbance and emission
spectroscopy to determine radial sizes. They have been used in combination with specific
aptameric sensors for the detection of a variety of materials. The several new approaches
to quantum dot synthesis and the creation of a quantum dot based sensor will be
discussed.
CHED 453
Science demos: Science lectures beyond the board
Naomi Pierre, [email protected], Patricia Santana, [email protected], Laura Osorio,
Shantell Rolle, Mayra Exposito.Chemistry, Florida International University, Biscayne Bay
Campus, North Miami, Florida 33181, United States
This project aims at creating an interactive learning environment through demos that aids
in the comprehension of scientific abstract definitions and concepts through the method of
visualization; thus-by, the project futuristically facilitates the understanding of the bond
between lab and lectures as one unit. Demos are found to be an excellent way of
demonstrating chemical changes in a captivating but educational manner. Some demos,
such as “Fire-Proof Balloon”, use common household objects and help emphasize the
need for awareness in our everyday lives. All in all, the areas of focus include: Physics,
Chemistry, Biology, Environmental Science and Biomedical Science. These demos
emphasize an Inquiry-Based learning process through questions generated from the
interests, curiosities and perspectives/experiences of the learner and it is a cyclic process
as well through this concept, the project provides tools to the under-represented, first
generation high school students pursuing a college degree.
CHED 454
Incorporating green chemistry principles into general chemistry and AP-level labs
for qualitative analysis, redox titration, and enthalpy of a reaction
Samantha L. Howard, [email protected], Sally A. Henrie.Department of
Chemistry, Union University, Jackson, TN 38305, United States
Many colleges and high schools across the nation are concerned about potential health
hazards and disposal costs associated with typical laboratory experiments. This project
focuses on developing a laboratory manual that utilizes “greener” experimental procedures
for advanced placement and general chemistry courses. It also teaches students about
green chemistry and the growing need for its use in chemical processes. Topics for these
experiments were based on the College Board's recommendations for an AP chemistry
course. Additionally, these experiments were designed to be incorporated into a webbased kit so that experiments may be safely done even in non-traditional settings. This
research specifically developed laboratory experiments where students investigate
qualitative analysis, oxidation-reduction titrations, and enthalpy of a reaction.
CHED 455
Investigating student anxiety within the chemistry laboratory
Zoebedeh Malakpa, [email protected], Jana Jensen, Stacey Lowery
Bretz.Department of Chemistry and Biochemistry, Miami University, Oxford, Ohio 45056,
United States
Courses that include a laboratory session can be associated with greater levels of anxiety.
In areas such as chemistry, students are asked to apply their knowledge in a hands on
manner, which may not always be easy for students. Decreasing students' anxiety levels in
the laboratory setting could lead to better experiences in these courses. The purpose of
this study is to create a tool to measure students' anxiety levels. This survey is to be
administered during the laboratory check out. The survey incorporates instruments
developed by researchers in chemistry education and those with background in
psychology. Responses will be collected from several chemistry courses, ranging from
those for chemistry majors in general and organic chemistry, to those for non-majors, for
the pre-med track, to labs designed to meet a liberal education requirement. Students will
report their attitudes regarding the chemistry laboratory. Preliminary results of this study
will be presented.
CHED 456
Preparation of pentamidine analogs for the treatment of human African
trypanosomiasis (HAT)
Aziz Mamur, [email protected], Robert Aslanian.Department of Chemistry, New
Jersey City University, Jersey City, New Jersey 07305, United States
Human African trypanosomiasis (HAT) is a parasitic disease that is endemic in 36 subSaharan African countries. It is 100% fatal if not treated. The early stage of the disease is
characterized by flu-like symptoms. The latter stage of the disease is characterized by
behavioral changes, confusion, and changes to the normal sleep cycle. This last symptom
obviously led to the common name of the disease, African sleeping sickness. HAT is
currently treated with several old compounds including the bis-amidine, pentamidine.
However, none of these compounds has an ideal profile and most are characterized by
serious side effects and poor pharmacokinetics. As part of our efforts to develop new
compounds aimed at the treatment of parasitic infections, we are synthesizing heterocyclic
and bicyclic analogs of pentamidine with the goal of improving activity and physicochemical
properties. This poster will discuss progress towards the synthesis of those analogs and
plans for future analogs.
CHED 457
Design and presentation of interactive VSEPR theory video
Haley M Snyder, [email protected], Janet G Coonce, Scott H
Northrup.Department of Chemistry, Tennessee Tech University, Cookeville, Tn 38501,
United States
To help students visualize the important concept of the VSEPR theory, a short educational
video was created to help supplement course activities. The hypothesis for this project is
that when students are shown a short, interactive video with an accompanying handout,
they will perform better on related exam questions. The effectiveness of this video was
tested on a total of 9 undergraduate chemistry for science majors laboratory sections of
students (N=620) after a short lecture and before a hands-on model building activity. The
video was shown to students (N=120) in three sections; three more sections of students
(N=120) were shown the same video and given an accompanying handout. These two
groups, along with a control group of students (N=110), were immediately given a short
quiz over the presented material. The results from this quiz, along with two questions on
the common final exam, will be presented.
CHED 458
Bilingual teaching practice and investigation in the course of “Introduction to green
chemistry and chemical engineering”
Zhongping Yao, [email protected], Ying Song, Dangqing Liu, Qiu Sun, Zhaohua
Jiang.Department of Chemical Engineering, Harbin Institute of Technology, Harbin, China
Bilingual teaching–an important part in the undergraduate education in China–can
effectively expand the students' international vision and improve English language skills.
However, there are also some practical problems and obstacles in the development of
bilingual teaching mode, such as issues with using PowerPoint and writing on the
blackboard in English, which is difficult for Chinese students due to the long reaction time
and new vocabulary. English words used by chemistry and chemical industry professionals
are complex and long. In this work we describe practices and experiences from our
bilingual class “Introduction to green chemistry and chemical engineering”. The specific
measures are proposed, such as previewing before class, teaching English formation for
professional words, and correlating multi-disciplines systematically and harmoniously. In
this way, better teaching effects are obtained. From the evaluation of teaching, the above
specific measures are effective and found to be useful by both students and teachers.
CHED 459
WITHDRAWN
CHED 460
Different time scales in NMR and Raman spectroscopy: Aqueous phosphate
solutions from pH 1 to 14
An Nguyen, [email protected], Dac Vu, [email protected], Michelle A Steiger,
Thomas B Malloy Jr.Department of Chemistry, University of St. Thomas, Houston, TX
77006, United States
An undergraduate experiment which illustrates the difference in NMR time scales vs
vibrational Raman spectroscopy time scales has been developed and refined over several
years. The experiment comprises measuring the 31P spectra and Raman spectra of
phosphate solutions at constant total phosphate concentration from pH 14 to pH 1 in ~0.5
pH increments with an Anasazi Eft-60 FTNMR instrument and a Delta Nu Advantage 633
Raman spectrometer. Details of the experiment, including some of the considerations
dictated by the instrumentation, will be presented. This has been developed as a physical
chemistry experiment and as a special project for freshman students.
CHED 461
NMR experiments for freshmen
Hoa Tran, [email protected], Nicholas Zaibaq, [email protected], Dac Vu,
[email protected], Cesar Trivino, Elizabeth Maccato, Joveline Ollero, Dipa Balsara,
Elizabeth Kuncewicz, Lara Al-Fady, Olivia Durr, Thomas B Malloy Jr.Department of
Chemistry, University of St. Thomas, Houston, TX 77006, United States
The sophomore organic course is normally the first time students at St. Thomas encounter
NMR. The last several years have seen the use of the Anasazi Eft-60 FTNMR incorporated
in organic, inorganic, instrumental, biochemistry and physical chemistry laboratory courses.
Magnetic resonance is a key technique in structural chemistry, biochemistry, biology and
medicine. In this freshman program, selected students learned some of the fundamentals
of NMR, the operation of the instrument and the interpretation of some proton spectra. The
concepts addressed included chemical shifts, simple spin-spin splitting patterns, the effect
of exchange reactions, the quantitative application of NMR, and the use for NMR to
elucidate molecular structure. The program relies on the mentoring of freshman students
by upperclassmen. This poster discusses some of the experiments developed and the
principles mastered by the students.
CHED 462
Validation of qNMR analysis of purity of ethanol: An undergraduate chemistry
laboratory experiment
Karl S. Mueller, [email protected], Peter T. Bell, William L. Whaley, Linda D.
Schultz.Department of Chemistry, Geosciences, and Environmental Science, Tarleton
State University, Stephenville, TX 76402, United States
Although Nuclear Magnetic Resonance Spectroscopy (NMR) is usually considered a
qualitative technique, quantitative NMR (qNMR) spectroscopy can be used as an analytical
tool by utilizing integration areas of species present in spectra of compound mixtures. The
quantity of an unknown is determined at the per cent level by comparing the relative
integration area of the unknown to that of a known amount of a standard. In this lab
experiment, 1H NMR spectroscopy is used to determine the purity of an unknown ethanol
sample using dimethyl sulfoxide (DMSO) as the internal standard and D 2O as the NMR
solvent. The experiment was tested in a Quantitative Analysis Laboratory in fall, 2012. Five
students analyzed unknown mixtures over a concentration range of 65% to 95% to which
water was added as an impurity. Relative average per cent error was less than 2% and a
plot of experimental v actual concentration was linear.
CHED 463
Construction of the surface chemistry course for different teaching students
Zhaohua Jiang, [email protected], Zhongping Yao, Li Zhao, Li Liu, Jiupeng Zhao,
Yuyan Liu.Department of Chemical Engineering, Harbin Institute of Technology, Harbin,
China
Harbin institute of Technology of China is engaged in building an interface chemistry
course group to meet the needs of students at different levels (undergraduates, masters
and doctoral students). This course group is constructed, based on the basic principles of
interface chemistry as the course core and the universal surface phenomena as the course
axis; with the aim to cultivate the students with different levels to analyze and solve the
problems of the surface science in terms of surface view. The common basic principles of
interface chemistry is built as the shared platforms, the course models with different depths
and breadth are built based on relationships of the specialty and the discipline. We have
established three courses as follows: “applied surface chemistry” for the undergraduates,
“surface physical chemistry” for masters students and “physical chemistry of solid surface”
for doctoral students.
CHED 464
Tennessee women in chemistry: The bio project 2.0
Rachel Davies, [email protected], Judith Iriarte-Gross.Department of Chemistry,
Middle Tennessee State University, Murfreesboro, Tennessee 37132, United States
Tennessee women are currently underrepresented in many STEM fields, including
chemistry. In Tennessee, possibly due to a more conservative culture, the history of
women in STEM is especially inaccessible. Recognizing that role models, especially those
that share similar backgrounds, are a major influence on the career choices of women and
girls, we have created The Bio Project, an effort to promote women role models in STEM
from Tennessee. For this project, we have identified and researched Tennessee women in
STEM, focusing on their achievements and challenges. We then conducted a survey to
ascertain the baseline awareness level of these women among Tennesseans, and found
that there was little to no awareness of their names, let alone their achievements. Using
these data, we will be able to assess our progress and efficacy as we promote these role
models in the future.
CHED 465
Chocolate as a basis for teaching students
Catherine M Reed, [email protected], Maria J Schroeder.Department of Chemistry, US
Naval Academy, Annapolis, MD 21402, United States
While all students recognize chocolate, most are unfamiliar with its ingredients, processing
methods, and unique physical properties. The developed investigations are centered on
the structure/property relationships in chocolate illustrating that macroscopic properties are
related to the microscale structure and behavior of molecules. One main area of focus is
the thermal properties of chocolate. The fat molecules (cocoa butter) in chocolate are
polymorphic, and the presence of certain crystal forms of cocoa butter greatly affects
chocolate's physical properties. Differential Scanning Calorimetry (DSC) is used to
characterize the thermal properties of various chocolates and map the crystal formations.
Chocolates containing various types and sizes of crystals are prepared, and their
properties, through tastings, are related to microstructure. Other areas of development
include chocolate tempering, crystal formation through nucleation, and cold extrusion of
chocolate. Examples of the classroom activities as well as the DSC experiment suitable for
advanced students will be presented.
CHED 466
Fermentation experiments to spark college student interest
Stephen C Meidus, [email protected], Maria J Schroeder.Department of Chemistry,
US Naval Academy, Annapolis, MD 21402, United States
Beer is fascinating to study from both a chemical and biological perspective. There are also
issues involving processing and storage relevant to engineers and food scientists. With a
steady decline in college students pursuing STEM majors, laboratory experiments involving
the beer fermentation process could spark student interest and illustrate some possible
future career paths. The developed experiment involves utilizes fermentation to produce
high ethanol content products, which could be used in alternative fuels. Using the beer
fermentation process as the starting point, students will study various yeasts, sugars, and
experimental conditions, and determine which will lead to high ethanol content. Students
will also learn about yeast fermentation and factors that control this process as well as
proper sampling procedures. The ethanol content of the products will be quantified by gas
chromatography. The experiment, a supplies list, safety precautions, and suggestions for
laboratory implementation and student activities will be presented.
CHED 467
Undergraduate kinetics laboratory experiment: The catalytic degradation of common
food dyes using the FeIII-TAML system
HanByul Chang1, [email protected], Dwight Thusdy1, Terrence Collins2. (1)
Department of Chemistry, Gordon College, Wenham, MA 01984, United States (2)
Department of Chemistry, Carnegie-Mellon University, United States
The FeIII-TAML (Tetra-Amido Macrocyclic Ligand) catalysis system has been successfully
used for the degradation of a variety of pollutants through the activation of hydrogen
peroxide. In addition to showing great promise for field applications, TAML catalysis also
provides an excellent model system for undergraduate teaching labs. This study focuses
on the TAML-catalyzed decay kinetics of common FD&C food dyes. The peroxide and food
dyes used in this experiment can be purchased in grocery stores, and are both
environmentally and budget friendly. The teaching lab experiment involves the complete
determination of the rate law under various conditions, specifically those in which relatively
large TAML or peroxide concentrations facilitate the determination of simple observed
kinetics. Different dyes exhibit very different degradation kinetics allowing for the
exploration of multiple aspects of chemical kinetics. In addition to serving as a didactic
kinetics experiment, this lab also provides an excellent introduction to green chemistry
principles.
CHED 468
Art as a context for inquiry-based learning in chemistry education
Colleen Fisher, [email protected], Steve Gravelle.Chemistry, St. Vincent
College, Latrobe, PA 15650, United States
The goal of this study was to use art as a context for inquiry-based learning in secondary
and undergraduate chemistry classrooms and labs. Inquiry-based learning is a strategy
that can be used to engage students to increase interest in science classes, particularly for
non-science majors. By incorporating art, laboratory experiments may appeal to students
not generally interested in science by showing a real-world application of the techniques
used. This experiment focuses on the study of inorganic pigments used in paintings
throughout history. Some of the pigments studied were purchased from an art supply
company; others were synthesized in the lab. Physical observations and chemical tests
were performed to aid in pigment identification. In addition, various microscopic and
spectroscopic techniques, ncluding polarized microscopy, UV-visible absorbance, and UVvisible fluorescence, were explored. Using the information collected through analysis, a
laboratory experiment was designed for use in a high school level or non-majors course.
CHED 469
Physical chemistry laboratory experiment: Measuring the speed of sound using
nitrocellulose
Brandon A Burnette, [email protected], Karl A Reyes, Karen S
Molek.Department of Chemistry, The University of West Florida, Pensacola, Florida 32514,
United States
The speed of sound was experimentally determined through various gases and under
several temperature conditions using a machined vacuum apparatus designed using
SolidWorks. Nitrocellulose, a low order explosive, was synthesized and ignited to generate
the sound-wave. A pair of microphones, in combination with custom made amplifiers and a
Tektronix TDS 210 oscilloscope, measured and collected the speed of sound data.
Measurements were collected in Argon, Carbon Dioxide, Helium, Nitrogen, and
atmospheric gases at ambient and reduced pressure (760 to 1.0x10 -4 torr), as well as
ambient and several reduced temperatures (25 to -20 °C). The vacuum tube was cooled
using liquid nitrogen in combination with a layer of pipe insulation. This data was compared
to previously reported literature values to confirm accuracy. Results from the
aforementioned experiments will be presented.
CHED 470
Sonneborn Refined Products internship experience
Allison Abbey1, [email protected], Clay Rosoc2, Susan Yochum1. (1) Department
of Chemistry, Seton Hill Univeristy, Greensburg, PA 15601, United States (2) Sonneborn
Refined Products, Petrolia, PA 16050, United States
This presentation discusses an internship experience at Sonneborn Refined Products in
Petrolia, Pennsylvania. The history of the company is explained, along with experiences in
the three main laboratories. The laboratories are: barium and sodium sulfonate, petrolatum
and microcrystalline wax, and white mineral oil. Sodium Sulfonates are discussed most in
depth, explaining what they are and focusing on properties and uses in the chemical
industry. White mineral oil and microcrystalline waxes are briefly explained and will be
centered on their various applications.
CHED 471
Spectrophotometric determination of acetaminophen content and release time from
over-the-counter gel capsules
Diana M. Cedillo, [email protected], K. Christopher Smith.Department of
Chemistry, University of Texas-Pan American, Edinburg, TX 78539, United States
Acetaminophen is a commonly used over-the-counter medicine counted on for quick
alleviation of pain symptoms. This lab experiment allows for the spectrophotometric
analysis of the total amount of acetaminophen as well as the rate of release of
acetaminophen from commonly advertised gel capsules using a system involving the
oxidation of acetaminophen by iron(III) ions followed by the complexation of the resulting
iron(II) ions with 1,10-phenanthroline to form a deep red-orange colored complex. The
colored complex is monitored, and by using a calibration curve and Beer's Law, the total
amount of acetaminophen and the rate of release of acetaminophen are determined. This
poster will describe the experiment in more detail, as well as the results of trials of the
experiment with general chemistry students.
CHED 472
Convenient portable demonstration modules
Robert G Maglott, [email protected], Rachel N Mason.Department of Chemistry, The
University of Texas of Tyler, Tyler, TX 75799, United States
Chemical demonstrations can generate excitement about learning science and provide
concrete visual reinforcement of abstract concepts. Sometimes preparing, transporting and
setting up the demonstrations discourage instructors from classroom or community event
demonstrations. Our goal was to reduce the inconvenience factor by providing a set of
reliable experiments which could be easily and safely transported and used in non-science
venues with minimal preparation efforts. We created a set of plastic shoeboxes containing
all the resources required for the demonstrations. While most chemicals are not stored in
the shoeboxes, appropriately sized and labeled containers are. The lid of the shoebox
contains an inventory, the experiment procedure and the expected outcome. Also included
is an explanatory handout geared to the 6th-8th grade level. Preparation is thus limited to
obtaining the needed chemicals. In most cases the use of dedicated equipment has also
reduced the clean-up burden.
CHED 473
Exploring energy through chemistry at Carroll University
Elizabeth Ebensperger, [email protected], Jamie Platz, Katelan Hall, Michael
Harland, Gregory Marks.Deparment of Chemistry and Biochemistry, Carroll University,
Waukesha, Wisconsin 53186, United States
In order to promote both Carroll University's and American Chemical Society's theme of
energy, our chemistry club sponsored events focused on energy. Our goal was to educate
both science and non-science individuals about how energy is involved in different aspects
of chemistry and their lives. Going beyond the college level, we also invited classes from
local elementary and high schools to join us. We started by explaining and demonstrating
the different types of energy. We then focused on heat, light, and electrical energies by
putting on demonstrations such as “genie in a bottle,” chemiluminescence, and making a
lemon battery. We also discussed food energy by doing peanut calorimetry and making
liquid nitrogen popsicles, which demonstrates loss of heat. Through the theme of energy,
we were able to do our part in educating people in chemistry, as well as bring members of
the community and campus together through science.
CHED 474
Five-part purification of an oxidoreductase from unicellular algae: An undergraduate
biochemistry laboratory
Bahinah Callahan, [email protected], Allyson McDonald, Betsy Leverett.Department of
Chemistry, University of the Incarnate Word, San Antonio, TX 78209, United States
A series of five experiments for biochemistry laboratory featuring the purification and
characterization of glutathione reductase (GR) from unicellular algae is described. The
experiments are demonstrated using the marine diatom, Phaeodactylum tricornutum, and
the freshwater green alga, Chlamydomonas reihnardtii, as sources for the enzyme. The
algae are grown economically using ethanol-sterilized glassware and air tubing, with
aeration provided by an aquarium pump. This GR purification introduces unicellular algae
as a study subject, and exemplifies techniques in ion-exchange and affinity
chromatography, size-exclusion techniques, dialysis, and enzyme activity analysis.
CHED 475
Development and preliminary analysis of the ACELL orientation to laboratory
instruction survey (OLIS)
Misha Asif1, [email protected], Akanksha Sharma1, [email protected],
MaryKay Orgill1, Thomas J. Bussey1, Nathan Barrows2, Allison Kay2, Megan Robb2,
George M. Bodner3, Barbara L. Gonzalez4. (1) Department of Chemistry, University of
Nevada, Las Vegas, Las Vegas, NV 89154-4003, United States (2) Chemistry
Department, Grand Valley State University, Allendale, MI 49401-9403, United States (3)
Department of Chemistry, Purdue University, West Lafayette, IN 47907, United States (4)
Department of Chemistry and Biochemistry, California State University, Fullerton, Fullerton,
CA 92831, United States
As a component of the 2012 Advancing Chemistry by Enhancing Learning in the
Laboratory (ACELL) summer workshop, we developed the Orientation to Laboratory
Instruction Survey (OLIS). This survey was designed to assess workshop participants'
experiences and attitudes toward learning and teaching in the laboratory environment—
including their views of inquiry-oriented laboratory teaching strategies—both before and
after the ACELL workshop. The development of the OLIS was informed, in part, by
published surveys, reports of students' views of inquiry-based laboratories, and instructors'
misconceptions about inquiry-based teaching. In this poster presentation, we will discuss
the development and implementation of the OLIS. In order to identify any changes in
participants' instructional beliefs that may have occurred as a result of participating in the
workshop activities, we will compare participants' pre-workshop survey responses with
their post-workshop responses to the OLIS. We will also discuss future plans for the
development and refinement of the OLIS.
CHED 476
Influences of life experiences on women's science career decision-making across
generations
Tori Quist, [email protected], Dawn Del Carlo.Department of Chemistry and Biochemistry,
University of Northern Iowa, Cedar Falls, IA 50614-0423, United States
Previous research has shown several factors including self-efficacy affect women's choices
of majors and careers (Grunert and Bodner, 2011). Most research has focused on a small
age range of women, mainly from the completion of their undergraduate degree through
the very early stages of their career. This qualitative study explored the differences in life
experiences of women from diverse generations who have chosen to pursue science at a
primarily undergraduate institution (PUI). Participants in the study included women
beginning their science undergraduate degree through women well into their science
careers. Participants completed personal statements and in-depth interviews which
explored past choices as well as current perceptions of the results of those choices.
Results indicated that the primary factors that influence women's career choices were their
accomplishments and goals, challenges, confidence, motivation, support, and interest in
science. Women's stories about their specific challenges, support, and interest in science
will be presented.
CHED 477
Nitrate and phosphate analysis by ion chromatography: Teaching and assessing
analytical skills of introductory students
Elizabeth J. Childress, [email protected], Shelly B. Bradley, Liz U. Gron.Chemistry,
Hendrix College, Conway, Arkansas 72032, United States
We use ion chromatography as a green tool to teach basic analytical skills to our very
greenest introductory students. This experiment introduces General Chemistry students, in
their fourth laboratory day, to volumetric analysis by creating a standard series from a stock
solution. Student solutions are analyzed by ion chromatography and the students create
calibration curves to calculate the concentration of environmental nitrate or phosphate
samples. Although students are graded on a traditional laboratory report, we want to
assess the laboratory effectiveness as a starting point for teaching analytical skills.
Students' laboratory work is evaluated by examining linearity and slope of their calibration
curves while students' conceptual understanding is evaluated using concept maps.
CHED 478
"Greener education": Green chemistry in the high school curriculum
Steffani Zuraw, [email protected], Jason Vohs.Department of
Chemistry, Saint Vincent College, Latrobe, Pennsylvania 15605, United States
The importance of educating today's students on the awareness of green chemistry has
become a grand subject of interest in the world of education. By use of the twelve
principles of green chemistry, the green mass metrics, both intertwined with the holistic
green star analysis, the assessment of the greenness of the synthesis of acetylsalicylic
acid, aspirin, was conducted through various synthesis routes, including the variation of
reaction conditions, catalysts, and reagents. Using the green assessments of these
reactions, a secondary education laboratory procedure for the synthesis of acetylsalicylic
acid was devised along with a brief text concerning general information on green chemistry
and its development in the world. Students are instructed to calculate and analyze the
mass metrics for comparisons of the greenness of multiple performed aspirin synthesis
routes. A suggested area of implementation of green chemistry through this laboratory
procedure is provided for the high school chemistry curriculum.
CHED 479
Greener dehydration chemistry: Montmorillonite clay-catalyzed dehydration of
alcohols
Rachael M. Albury, [email protected], Justin L. Andrews,
[email protected], Irvin J. Levy.Department of Chemistry, Gordon College,
Wenham, MA 01984, United States
Traditionally, the synthesis of alkenes from alcohols has been catalyzed by concentrated
mineral acid at high temperatures. Montmorillonite clay shows promise as a much greener
and safer substitute. In a continued effort to demonstrate the viability of a Montmorillonite
KSF clay catalyzed method as a greener alternative to the traditional method, the clay and
mineral acid catalyzed methods were analysed and compared with respect to yield,
regioselectivity and the versatility of the method when applied to several different alcohols.
Initial results indicate that, for some alcohols, regioselectvity for formation of the product is
improved with the clay-catalyzed approach.
CHED 480
Implementing green chemistry practices in the traditional undergraduate organic
laboratory
Jamie L Resnick, [email protected], Robyn M Hyde.Department of
Chemistry, Westminster College, Salt Lake City, Utah 84105, United States
The scientific community is striving to find energy efficient chemical processes that limit
environmental hazards and harmful waste products in industrial settings. Until recently, the
undergraduate laboratory has been overlooked as an environment that would benefit from
the implementation of these industrial discoveries. Such changes would not only reduce
hazards and energy consumption, but also provide an opportunity to teach chemical
consciousness. Current literature on green chemistry was evaluated to identify adaptations
that could be implemented. The initial goal of this project was to maintain the same
educational focus of the labs, while making changes that would reduce the use of
environmentally unfriendly solvents. Specifically, efforts were aimed at adopting solventfree syntheses and modifying purification techniques. Additionally, laboratories were
modified to utilize compounds that are synthesized by students the previous year.
Evaluation of success included the consideration of robustness, cost, yield, purity,
efficiency and the demonstration of specified learning objectives.
CHED 481
Antioxidant profiling experiment for undergraduate biochemistry
Damaris Delgadillo, [email protected], Kaela Caballero, Betsy Leverett.Department of
Chemistry, University of the Incarnate Word, San Antonio, TX 78209, United States
A series of antioxidant profiling experiments for undergraduate biochemistry laboratory is
described. The antioxidant status is estimated for several species of unicellular algae by
analysis of cell lysates for peroxidase activity, superoxide scavenging, and total antioxidant
capacity. This series may also be used to compare antioxidant activity in a single species
under variable growth conditions of salinity, available nitrogen, and temperature. These
experiments are designed to exemplify concepts in redox biochemistry, to familiarize
students with enzyme analysis, and to introduce the theory and practice of luminescence
techniques in biochemistry.
CHED 482
Hypoxia induction in unicellular algae: An undergraduate biochemistry laboratory
Kaela Caballero, [email protected], David Coleman, Betsy Leverett.Department of
Chemistry, University of the Incarnate Word, San Antonio, TX 78209, United States
A series of experiments is described which demonstrates metabolic responses to hypoxia
in unicellular algae. Algae are cultivated in commercially available media, and a system for
gas delivery allows for four different oxygen conditions to be maintained. Induction of
hypoxia is demonstrated by changes in selected metabolites and alterations in nitrogen
metabolism and the citric acid cycle enzymes. These experiments provide an illustrative
tool in discussions of aerobic and anaerobic metabolism, glycolysis and the citric acid
cycle.
CHED 483
Synthesis, characterization, and catalysis of zeolite-based iron amino acid
complexes
LaQuita M. Holt1, [email protected], L. Shannon Davis2. (1) Department of
Chemistry, Georgia Southern University, Statesboro, GA 30460, United States (2)
Department of Physical Sciences, Pensacola State College, Pensacola, FL 32504, United
States
There are numerous naturally occurring enzymes that oxidize chemical compounds, such
as methane, into more industrially useful chemicals, such as methanol. Mimics of these
enzymes based on iron amino acid complexes supported in zeolites have been
synthesized and their catalytic activity determined. The oxidation of benzyl alcohol
produced benzaldehyde in stoichiometric quantities. Future work includes examining these
materials for the oxidation of other substrates such as phenol, vanillin, cyclohexanol, and 1hexanol.
CHED 484
High school students comprehension of stoichiometry using ratio and proportions
Patrick R. Escott, [email protected], Cynthia P. Guevara,
[email protected], Maritza Silva, Michael F. Z. Page.Department of Chemistry,
California State Polytechnic University, Pomona, Pomona, California 91768, United States
In high school level chemistry classes, many students have a difficult time understanding
the chemical theory behind stoichiometric problems. Teachers often use multiple
approaches to improve student problem-solving strategies. A traditional method employed
by many instructors to solve these types of problems is known as Dimensional Analysis
(DA), which focuses on the cancelation of units. There is an alternative method known as
Ratio and Proportions (RAP), which emphasizes the relationship between the molar ratio,
molar mass, and the balanced equation. In this study high school chemistry teachers
incorporated the RAP method to teach stoichiometry rather than their traditional method of
DA. This study will help determine which of these two methods results in a deeper
understanding of stoichiometry by comparing student performance on in-class
assessments, district wide assessments, and state standardized exams.
CHED 485
Ongoing analysis of interactions and argumentation during process oriented guided
inquiry learning (POGIL) in general chemistry
Meredith Frazier, [email protected], Theodora Bairaktaris, Carolyn L. Draus, Patrick L.
Daubenmire.Department of Chemistry, Loyola University Chicago, Chicago, Illinois 60626,
United States
Prior research has identified discrete student interactions characterized as phases and
bridges during POGIL general chemistry instruction, which uses group activities to foster
constructivist learning via investigation of data, formation of
trends/relationships/conclusions and application of learned concepts to new situations. As
a well-established model developed for practical reasoning, the Toulmin Model of
Argumentation reflects scientific thinking effectively. This research analyzed video
transcripts of POGIL based general chemistry classes, coding for both the POGIL Phases
& Bridges interactions and the Toulmin Model in order to characterize the overlap between
the two. Levels of Toulmin arguments found in the group's dialogues were used to assess
the overlap of POGIL instruction and their use of scientific thinking. Assessment of when
different levels of argument were taking place served as evidence to support claims about
POGIL interactions vis-à-vis expert thinking.
CHED 486
Combining FTIR spectroscopy and the Vernier GC for the analysis of a binary
mixture: A general chemistry investigation
Logan Schmitz, [email protected], Kimberly Gerling, Joseph M. Fritsch, David
B. Green.Department of Chemistry, Pepperdine University, Malibu, CA 90263, United
States
We present a laboratory investigation in which a binary mixture of organic compounds are
analyzed first by FTIR spectroscopy to identify the predominant functional groups
possessed by the components in the mixture, followed by the determination of the
components of the mixture after gas chromatographic separation using the Vernier Mini
GC. The components are identified by comparison to authentic standards. Students gain
experience in functional group elucidation, selecting operating conditions for a gas
chromatographic separation, and operating a simple gas chromatograph early in their
academic career. To our knowledge, this represents the first reported coupling of the
methods of FTIR spectroscopy and the Vernier GC in the traditionally first-year chemistry
course.
CHED 487
Concentrations of nitrogen dioxide as distance increases away from a highway
Emilia Ben, [email protected], Michael Schuder.Department of Chemistry, Carroll
Univeristy, Waukesha, WI 53186, United States
Concentrations of NO2 were determined at various sites at Carroll University's Greene
Field Station in southeast Wisconsin. Palme's passive diffusion tubes were mounted to find
concentrations of NO2 as distance increased away from a highway. The absorbent,
triethanolamine (TEA), was applied to the stainless steel meshes fixed within the diffusion
tubes. TEA converted NO2 molecules into nitrite anions. The nitrite anions reacted with
sulphanilamide to form a diazo cation which reacts with N-1-naphthyl ethylene diamine and
will form a conjugated azo dye. The solution of the conjugated azo dye has absorption at
540 nm.
CHED 488
Simple and facile hydrogenation of ethyl trans-cinnamate: An undergraduate organic
chemistry laboratory experiment
Hamid Yazdekhasti, Michael Castaldi, [email protected], Catalina Adorno,
[email protected], Enhui Chen, [email protected] of
Chemistry, Saint Peter's University, Jersey City, NJ 07306, United States
A simple and facile hydrogenation of ethyl trans-cinnamate has been developed and
carried out using ammonium formate as a hydrogen source in the presence of palladium on
carbon (Pd/C). The reaction takes place at room temperature and atmospheric pressure
without the need for special equipment. This experiment will serve as a practical addition to
an undergraduate organic chemistry laboratory
CHED 489
Creation of a fiber database using micro-spectrophotometer/FTIR
Samuel Yatzkan, [email protected], Sherry T. Brown.Department of Physical Sciences,
York College of Pennsylvania, York, PA 17403, United States
The identification and classification of fibers is very important to the field of criminal
investigation. By examining fiber evidence found on clothing, chairs, rugs, and similar
items, a possible match could link the victim to the crime scene, and to the suspect. Using
an Excalibur 3100 FTIR with a Varian UMA600 Microscope attachment I constructed a
fiber library in house that will be used by forensic classes at York College of Pennsylvania
for the analysis of mock crime scene evidence. The fabric swatches I used as a source of
the fibers, was created by Kathryn Hatch and purchased through Textile Fabric
Consultants, Inc. The Excalibur 3100 FTIR with Varian UMA600 Microscope attachment
not only allows for recording the infra-red spectrum of a fiber, but a visual image of the fiber
can be captured as well. Using micro-spectrophotometer FTIR, students will become
familiar with current instrumentation as well as how the identification of fibers is done.
CHED 490
Detecting the presence of gunshot residue of a 9mm handgun equipped with a
suppressor
David J Millard, [email protected], Sherry T Brown.Department of Physical Sciences,
York College of Pennsylvania, York, Pa 17403, United States
One of the harshest penalties in the American federal system today occurs when one is
found in possession of a homemade device that muffles the sound of a gunshot, also
called a suppressor; this is why the United States Government has strict guidelines
pertaining to obtaining a suppressor. With gun violence being a major issue in recent
years, a study was performed to detect gunshot residue with different means of
suppression. A 9 millimeter semi-automatic handgun was fired into white cotton T-shirts, at
eight different distances ranging from contact to 36 inches. A control of the unsuppressed
handgun was fired first, followed by the firing of a commercially sold suppressor on the
same gun. The homemade suppressor, 20 fl oz plastic soda bottle, was then attached to
the muzzle of the handgun. The shirts were tested by inductively coupled plasma (ICP) for
trace elements in the gunshot residue.
CHED 491
Detection of blood using hemascein and fluorescein
Amanda K Lagace, [email protected], Sherry T Brown.Department of Physical Sciences,
York College of Pennsylvania, York, Pennsylvania 17403, United States
The detection of blood at crime scenes, when not easily detected by the eye, can be of
great value. The purpose of this study is to test the effectiveness of using Hemascein and
fluorescein in detecting latent blood stains. This experiment will use Hemascein and
fluorescein on varying dilutions of blood samples in order to test their sensitivity based on
the reaction time of the compounds. (The companies who manufacture these detection
materials will be referenced.) Blood samples that have been combined with the Hemascein
and fluorescein will also be tested with various presumptive color tests to determine the
effect of these compounds on the tests. This experiment will be rewritten as a component
of a laboratory experiment for students taking advanced forensic science courses.
CHED 492
Identification of inks by thin-layer chromatography and high-pressure liquid
chromatography
Nicole Dixon, [email protected], Sherry T Brown.Department of Physical Sciences, York
College of Pennsylvania, York, Pennsylvania 17403, United States
In document analysis, ink identification is an important part of identifying the possible tool
and then eventually identifying the writer of the document. This same process can be used
to prove the validity or fraudulent nature of a document. A common type of ink used by
everyone sometime in their life is that of a ballpoint pen. By using the methods of thin-layer
chromatography and high-pressure liquid chromatography, the purpose of this experiment
was to identify chemical properties of the inks of popular brands of ballpoint pens. This
work was then developed into a laboratory exercise for students in a capstone course in
and undergraduate forensic science program.
CHED 493
Establishment of an infrared and ultraviolet drug library for use in an advanced
forensic course
Kathleen A Vautier, [email protected], Sherry T Brown.Department of Physical Sciences,
York College of Pennsylvania, York, PA 17403, United States
Drugs cause both physical and mental impairment. These factors greatly influence
behavior that can lead to criminal activity. The easy acquisition of drugs can be the lone
cause of criminal activity. It is important to have correct identification of drugs so that this
criminal activitiy is verified. Body fluids, blood and urine particularly, are analyzed for the
presence of drugs to determine if these were factors in the activity. Many different chemical
instruments and techniques are used to analyze powdered substances or pills found at a
crime scene or in someone's possession. Up until now, there has been no reference library
for undergraduate students and faculty at York College of Pennsylvania to use when
analyzing drugs that were acquired from mock crime scenes. This study used infrared and
ultraviolet instrumentation to analyze many common drugs, some considered 'street' drugs
and other pharmaceuticals. Spectra will be saved for future use for undergraduate
students. Several pills composed of multiple drugs were also examined to determine if
each drug was detectable.
CHED 494
Student perspective of and outcomes from the 18th Conference of Parties of the
United Nation framework convention on climate change
John P Siller1, [email protected], Gregory P Foy1, Keith E Peterman1, Marla Bianca2, Diane
W Husic2. (1) Department of Chemistry, York College of Pennsylvania, York, Pennsylvania
17403, United States (2) Department of Biological Sciences, Moravian College,
Bethlehem, Pennsylvania, United States
In an effort to encourage youth involvement in promoting climate change literacy, the
American Chemical Society sponsored four student members to participate in the 18th
Conference of Parties (COP18) of the United Nations Framework Convention on Climate
Change (UNFCCC). We attended this UN climate conference in order to observe the
impact of NGO's, to interpret the important outcomes of the COP, and to report back to
students and chemists around the country, particularly the youth of the world who are not
represented in these negotiations. A primary outcome of our participation is to make a
positive difference for our future sustainability by uniting with other youth leaders and
increasing climate literacy. Youth of the world, we need to let our voices be heard – join us
in the conversation.
CHED 495
Influence of climate science research on policy negotiations at the 18th Conference
of Parties
Nicole M. DeLuca, [email protected], Gregory P. Foy, Keith E. Peterman.Department of
Chemistry, York College of Pennsylvania, York, Pennsylvania 17403, United States
In its endeavor to promote climate science literacy, ACS sponsored four students to attend
the United Nations Framework Convention on Climate Change (UNFCCC) 18 th Conference
of Parties (COP18) in Doha, Qatar. We aspired to engage our peers and communities in
climate change discussions through social media networking and local newspaper
publications with a special emphasis on the communication of climate science research to
the delegations of policy makers. As young people we represent one half of the world's
population. While not officially represented in the international negotiations, the world's
youth will face the consequences of climate change and manages a drastically different
world if CO2 emissions do not peak in 2015. We have used this opportunity to set an
example for educating ourselves and taking action in hopes of inspiring our elders, peers,
and future generations about climate change and our role in it.
CHED 496
Introduction of HP-LC instrumentation to undergraduate students by quantitative
analysis of caffeine and common analgesic drugs in locally available OTC
formulations
Mary Alvarez, [email protected], Miriam Jaziri, [email protected], Peter Iles,
Neil Bastian, Ron Valcarce, Luther Giddings, Yessenia Garcia, Kristi Nuckles, Sydney
Richards.Department of Chemistry, Salt Lake Community College, Salt Lake City, Utah
84123, United States
Undergraduate community college students worked together to design, develop,
implement, and test a procedure for the first semester organic chemistry laboratory class
which implements valuable hands-on experience with LC-MS instrumentation. The
relatively simple and cost effective quantitative analysis of nonprescription analgesic drugs
was selected to meet the following criteria. The procedures developed fit within the
standard 4 hour lab period and fit within the standard lab curriculum, including TLC
analysis and use of serial dilution to create standards for quantitative analysis with linear
regression. The experiment developed was also integrated appropriately with the
curriculum of the first semester organic chemistry course, including the topics of functional
group identification, polar-nonpolar interactions and MS fragmentation. Finally, the lab
creates an awarenes for the worldwide problem of counterfeit drugs and was designed to
relate to students interests; in particular, students who are on the pre-medical, pre-dental,
and pre-pharmacy track.
CHED 497
Adaption of analytical procedures for GC-MS into undergraduate organic chemistry
laboratories
Mary Alvarez, [email protected], Sydney Richards, [email protected], Peter
Iles, Lacie Cates, Kristine Buttars, Spencer Bremer, Kylee Shumway, Mckinsie Oblad,
Miriam Jaziri, Ron Valcarce, Neil Bastian, Luther Giddings.Department of Chemistry, Salt
Lake Community College, Salt Lake City, Ut 84130, United States
Salt Lake Community College has aquired a GC-MS. The chemistry department is in the
processs of incorporating this analytical technique into current organic chemistry labs.
Undergraduate students are adapting a current essential oils extraction lab to include use
of GC-MS for identification of the essential oil. The students are also creating a library of
common household items that lab students can bring to class to run steam distillations and
extractions on. The library will consist of GC-MS scans that students can compare their
extractions against.
CHED 498
Fluoride by flow injection analysis: A new general chemistry experiment
Peter Iles, Brad Foster, [email protected], Zach Jones, Sarah Moore, Joseph Warren,
Neil Bastian, Luther Giddings, Mary Alvarez, Ron Valcarce, Nathan Butler, Michael Tranter,
Brian Louie, Shauna Mendes-Thorpe, Mahsa Adabkhah.Department of Chemistry, Salt
Lake Community College, Salt Lake City, UT 84130, United States
An experiment for general chemistry lab to determine the amount of Fluoride in tap water
was developed. The performance of Chemflow FIP-3 and FIP-4, and a Global FIA flow
cells were evaluated with respect to sample through-put, precision and detection limit. The
Chemflow FIP-3 and FIP-4 flow cells flow cell with an in-built reference system outperformed the Global flow cell in all parameters. Sample through-puts of 120 per hour were
easily obtained. Though the Global flow cell had far slower sample throughput it could still
be used in the time available for the lab class. The voltage measurements are performed
with Microlab instruments and laptop computers. This experiment introduces students to
the analytical applications of Voltaic cells as well as lab automation and micro and
nanofluidic devices through Flow Injection Analysis while providing the students with an
opportunity to make measurement that relate to their local community.
CHED 499
New general chemistry experiment: Analysis of trace metals by squarewave
polarography in local rivers
Peter Iles, Chris Thurman, [email protected], Neil Bastian, Ron Valcarce, Mary
Alvarez.Department of Chemistry, Salt Lake Community College, Salt Lake City, Ut 84130,
United States
A new experiment for General Chemistry 2 lab where the students determine the amount of
trace metals by squarewave polarography in local rivers is reported. The SLCC chemistry
department has been investigating pollutants in the local rivers over the past 3 years and
this has lead to the development of a new experiment for the general chemistry 2 lab
where we are replacing some outdated electrochemical experiments with new instrumental
methods. In this case the students are not only exposed the principles of electrolysis but
also the quantitative aspects at trace level concentrations. Lead, cadmium and copper
have been detected at ppb levels. The experiment allows the students also to make
measurements on samples of local relevance.
CHED 500
Expansion of the Science Resource Center at Salt Lake Community College
Peter Iles, Sydney Richards, [email protected], Jory Lusk, Neil Bastian, Luther
Giddings, Ryan Holcomb, Mary Alvarez.Department of Chemistry, Salt Lake Community
College, Salt Lake City, Ut 84130, United States
The Science Resource Center at SLCC, originally established as a chemistry center,
currently meets the needs of students, adjunct and full-time faculty for tutoring, computing,
consultation, and group study in all the physical sciences. Data on the number of students
and faculty served and the costs involved is reported. The developmental history of the
center is reported here along with improvements in tutorial quality due to a second influx of
one time funds. Examples of this are the expansion of the subjects covered, such as
geosciences and engineering, as well as the SRC can now run summer PCAT review
classes. The relationship between quality and the number of students assisted is
presented. The history the various factors influencing the development, the funding and
space issues and the blending with other resources of the division and school of Science
Math and Engineering as well as outside sources.
CHED 501
Synthesis and LCMS analysis of the pharmaceutical Phenytoin demonstrating the
pinacol rearrangement
Peter Iles, Subash Basnet, [email protected], Spencer Bremer, Jonathan Fisher,
Nicholas Astorga, Mahsa Adabkhah, Amy H Ton, Ron Valcarce, Neil Bastian, Mary
Alvarez, Luther Giddings.Department of Chemistry, Salt Lake Community College, Salt
Lake City, UT 84130, United States
The purpose of this research project was to develop an undergraduate organic laboratory
experiment to provide a demonstrable example of the Pinacol rearrangement. Phenytoin,
an antiepileptic drug that was first synthesized in 1908 by the Biltz, is synthesized in this
experiment is. This synthesis involves base catalyzed addition of urea to benzil followed by
Pinacol rearrangement to form Phenytoin. This is an ideal synthesis for demonstrating the
Pinacol rearrangement at the undergraduate level, since the starting materials are readily
accessible, the synthesis can be achieved and product isolated within a three to four hour
time frame and the product is easily characterized using FTIR and LCMS.
CHED 502
Rate a drug: A community health project
Peter Iles, Hazhar Yousif, [email protected], Sheeva Aboutaleb, Jonathan Fisher,
Meghann Daw, Subash Basnet, Nicholas Astorga, Amy Ton, Kelly Ma, Michael Tranter,
Macabe Coombs, Michael Smith, Darren Seegmiller, Darion Bevan, Ron Valcarce, Neil
Bastian, Luther Giddings, Mary Alvarez.Department of Chemistry, Salt Lake Community
College, Salt Lake City, UT 84130, United States
Understanding side effects, successful medications, and pathogenic effects is crucial to
chemistry students going into a health related field. Working with the company
rateadrug.com, the Salt Lake Community rate a drug group (RAD) has endeavored to
address the many what it takes to understand and educate the public on pharmaceuticals.
Patient evaluations were carried out by patient perception surveys on the rate a drug
website and addressed side effects and efficacy of medications and supplements. The
work focuses specifically on a health condition where a blog was created and weekly
updated to share with the public RAD's findings. Published information on side effects,
dosage and details of specific drugs is also posted on rateadrug.com. The aim of the
RAD's research is to raise awareness among students in our school, members of our
community and, optimistically, the nation, about the personal responsibility to educate
oneself about the medications being used.
CHED 503
Optimizing a nitration experiment
Tracey Engesser, [email protected], Robert Eliason, Noelle J.
Beyer.Department of Science, Southwest Minnesota State University, Marshall, Minnesota
56258, United States
Electrophilic aromatic substitution reactions illustrated by nitration reactions are common in
undergraduate organic laboratories, but no experiments utilize a stepwise addition of nitro
groups to the aromatic system. The procedure of the well-known synthesis of 2-(2',4'dinitrobenzyl)pyridine from 2-benzylpyridine gives dinitration exclusively. We are trying to
enhance the pedagogical utility of this experiment. We have worked out a nitration
procedure that leads to the formation of the mononitro product, 2-(4'-nitrobenzyl)pyridine,
and we have successfully nitrated the mononitro product to 2-(2',4'-dinitrobenzyl)pyridine.
We are currently working to optimize reaction conditions for use of this experiment in our
organic chemistry course.
CHED 504
Effects of concept mapping on formal report quality in the general chemistry
laboratory
Jerica L. Briggs, [email protected], Isaiah Cochran,
[email protected], Megan Wojtowicz, Heidi J. Fletcher, Evonne
Baldauff.Department of Chemistry and Forensic Science, Waynesburg University,
Waynesburg, PA 15370, United States
A reoccurring issue in the general chemistry laboratory is that students fail to make
connections between the data collected and the overall purpose for the experiment. This
becomes apparent in the results and discussion section of the lab report and implies that
the objectives of the experiment are not obvious or interpretable for the student. The use of
concept mapping as a supplemental learning tool is a research-proven technique for
improving student understanding of abstract concepts. The LabMap is a student-designed
concept map intended to help students construct links between the purpose of the lab, the
key data collected, and the results. All groups will perform the same experiment and be
asked to write a formal report, with selected sections completing their concept map prior to
writing the report. Final grades on all reports will be analyzed to create improvement
curves. The LabMap documents will be collected, coded, and analyzed.
CHED 505
Development of an instructional laboratory experience utilizing 1H-NMR to determine
fat characteristics from food samples
Amy C. Moore, [email protected], Aaron M. Hartel.Department of Chemistry,
Winthrop University, Rock Hill, SC 29733, United States
Student engagement should be a priority in developing new laboratory experiences. We
have developed a laboratory exercise in which students analyze packaged “convenience”
foods (crackers, cookies, chips, candies) to determine several characteristics about the
food's fat content. In this lab, students extract the fat from a sample of the food and
gravimetrically determine the amount of fat per serving. The students acquire a 1H-NMR of
the recovered fat and use the data to determine the levels of saturated, unsaturated,
monounsaturated and polyunsaturated fats in the food. Students can then compare their
results to the information provided on the food package label. This experiment engages
students in the learning process by connecting with their prior knowledge and familiarity of
the foods used. By performing the exercise, students learn several important concepts and
techniques of organic chemistry such as extraction, filtration, structure-solubility
relationships, NMR spectroscopy, and structural characteristics of fats.
CHED 506
Youth involvement at the 18th Conference of Parties and the need for climate science
literacy
Parker D McCrary1, [email protected], Nicole M DeLuca2, Gregory P Foy2,
Keith E Peterman2, Robin D Rogers1. (1) Center for Green Manufacturing and Department
of Chemistry, The University of Alabama, Tuscaloosa, AL 35487, United States (2)
Department of Physical Science, York College Pennsylvania, York, PA 17403, United
States
Based on the increasing emphasis placed on climate science literacy by the American
Chemical Society, a group of students were chosen to travel to Doha, Qatar to participate
in the United Nations Framework Convention on Climate Change (UNFCCC) 18 th
Conference of Parties (COP18). Our primary purpose for attending the conference was to
help engage the youth of our world and to promote youth involvement in the United States
through social media networking. Although climate science literacy is increasing, more
effort must be taken to advance the discourse in order to help promote sustainability and
green chemistry. Our efforts are a small step towards climate science literacy, but our
country must begin to take giant leaps. In this presentation, We discuss our experiences in
attending COP 18 with a special emphasis on youth involvement and the need for climate
science literacy.
CHED 507
Fabrication of a new metal organic framework for future gas storage applications
Anh T. Vu, [email protected], Anne M. Marti, Kenneth J. Balkus Jr..Department of
Chemistry & The UTD NanoTech Institute, The University of Texas at Dallas, Richardson,
TX 75080, United States
Metal organic frameworks (MOFs) are crystalline materials consisting of inorganic metal
ions and organic linkers forming a variety of porous structures with high surface area and
tunable properties. MOFs have been studied for applications such as gas separation and
storage, as well as catalysis and chemical sensing. Our study involves the generation of a
new MOF by extending the organic linker of an already known MOF, STU-1, which
incorporates zinc and/or cobalt metal ions and linker molecules of 4imidazolecarboxaldehyde. This involves the synthesis of a new crystalline organic linker by
reacting two 4-imidazolecarboxaldehyde molecules with one ethylenediamine molecule,
forming an imine bond, characterized by XRD, FT-IR, and SEM. The new organic linker
has been utilized in the formation of the new MOF by solvothermally reacting it with zinc
metal ions. We expect the new MOF to exhibit a high affinity for CO2 and become an
interesting candidate for CO2 capture.
CHED 508
Small molecules, big ideas: Integrative chemistry and prison exchange
Zak A Johnson, [email protected], Samantha Glazier.Department of Chemistry, St.
Lawrence University, Canton, New York 13617, United States
The goal of this project is to create a chemistry course for the Inside Out program at the
Upstate Correctional Facility in Malone, NY that will develop students' reasoning along with
central chemistry concepts of atomic structure, bonding, entropy, and enthalpy, to name a
handful. Inside Out is a national prison exchange program that brings a college course to a
prison, defined by collaboration between college students and incarcerated persons to
learn a topic together. College students serve as a model for incarcerated persons in the
development of study habits, creative thinking, logical reasoning and peer discussion with
the intention of enriching personal academic experience. A complete syllabus outlining
course requirements, evaluation criteria, and twelve new lesson plans will complete the first
half of the project. The second half of the project will be the implementation of the course at
Upstate Correctional Facility during the spring semester.
CHED 509
Evaluating effects of the Arlington undergraduate research-based achievement for
STEM (AURAS) program on the performance of engineering students in chemistry
courses
Emmanuel Varona, [email protected], Pricscila Martinez-Avila, Doug D.
Carlton Jr., Abegayl Thomas, Kevin A. Schug.Department of Chemistry and Biochemistry,
The University of Texas at Arlington, Arlington, Texas 76019, United States
Studies show that STEM students are poorly retained in their major. To address this
problem, The University of Texas at Arlington developed a retention program to support
STEM students. Arlington Undergraduate Research-based Achievement for STEM
(AURAS) includes an Emerging Scholar Program (ESP) to support students in required
chemistry courses. A learning outcomes-based assessment was developed to measure
individual progress of students and to reinforce topics with poor performance. Quizzes and
exams were aligned with learning outcomes and were used to assess individual mastery of
course material. The assessment showed an upward trend in topics mastered and a high
retention rate. Overall, there was a significant difference on test scores and course pass
rates by students in ESP versus non- ESP students. Specifically, in fall 2011, 83% of ESP
students earned a C or better in the course, as opposed to 57% of non- ESP students.
CHED 510
WikiHyperGlossary (WHG): New knowledge frameworks for historical documents
and the role of Web APIs
Andrew P. Cornell1, [email protected], Mich A. Bau2,3, Daniel Berleant2, Robert E.
Belford1. (1) Department of Chemistry, University of Arkansas at Little Rock, Little Rock,
AR 72204, United States (2) Department of Information Science, University of Arkansas at
Little Rock, Little Rock, AR 72204, United States (3) Joint Bioinformatics Program,
University of Arkansas for Medical Sciences, Little Rock, AR 72204, United States
One of the challenges early 21st century scientists and educators face is the
implementation of digital ICTs (Information and Communication Technologies) in an
information landscape paradigm based on Gutenberg era print-based communications.
Through automated markup and Web APIs (Application Programming Interfaces) the
WikiHyperGlossary (WHG) bridges these ICTs, directly connecting digitized printed
documents to modern chemical information services and cheminformatic software agents.
The result is the possibility of enhanced learning by connecting both current and historical
print-based documents to social and semantic knowledge frameworks that provide new
opportunities for knowledge discovery and verification. This poster will focus on the role of
Web APIs and chemical identifiers in the WHG architecture. Specific examples will be
provided along with a description of how the architecture enables the development of new
features and supports extending this technology to other disciplines.
CHED 511
Video instructions for use of chemical instrumentation
Wojciech T Osowiecki, [email protected], Christine DiMeglio, Eric K
Paulson.Department of Chemistry, Yale University, New Haven, Connecticut 06520, United
States
Contemporary multimedia technology has made it possible for almost anyone to produce
and distribute video content, and students are increasingly beginning to expect tailored
video content as a standard part of their learning process. In the Yale Chemical &
Biophysical Instrumentation Center, we have made a series of targeted training videos
covering the usage of specific analytical instruments and related software, including NMR,
GC-MS, FTIR and MALDI-TOF MS. These videos, distributed via YouTube, complement
written instructions and serve as an introduction for new users in the facility. They also
lessen the work of faculty and staff by serving as a reference for the most frequently asked
questions about the instruments. In this poster, we detail our experiences shooting videos
in an often noisy open-access instrument center environment, and show how we have
integrated video instruction into an undergraduate organic chemistry laboratory course.
CHED 512
Ratemyprofessors.com: General chemistry students' contribution and use patterns
Patrick McKeny, [email protected], Todd A Gatlin, Adrian Villalta-Cerdas, Santiago
Sandi-Urena.Department of Chemistry, University of South Florida, Tampa, FL 33620,
United States
Online rating websites such as Ratemyprofessors.com (RMP) influence college professor
and course selections. However, their use often sparks skepticism among instructors
because of the self-selected nature of raters. Prior research on this topic in chemistry
education concluded that RMP might be used as a valid source of supplemental
information for evaluating instruction. The objectives of this study were to determine
students' motives behind contributing to the site and to determine how students use the
site to inform their decision making process. 500 General Chemistry students over the
course of two years completed a 50-question survey addressing RMP use patterns.
Findings suggest the majority of students use RMP and found it useful. Contributors'
motives varied but were quite different from commonly held conceptions (e.g. They post to
rant.). The contention is put forth that chemistry departments and professors may find a
valuable supplemental source of information in RMP data.
CHED 513
Combined video and laboratory exercise for project-based isolation of medicinal
compounds from osage orange
Margaret J. Risher, [email protected], William Whaley.Chemistry, Geosciences and
Environmental Science, Tarleton State University, Stephenville, TX 76402, United States
Project-based learning experiences can be used to simulate a research problem in the
Organic Chemistry teaching laboratory. A set of video recordings was developed to rapidly
introduce the historical background for a project-based exercise that involves extraction
and purification of two isoflavones from Osage orange. These isoflavones, osajin and
pomiferin, differ by the presence of a single oxygen atom (in pomiferin); however, they
have very different chemical and medicinal activities. Using a prepackaged Alumina-B
cartridge, it is possible to rapidly purify these compounds in milligram quantities. These
preparations are sufficient to allow analysis of these compounds by several instrumental
methods. After students have had an opportunity to verify the structures of these purified
compounds, they can experience a video that discusses potential uses of these
compounds as medications or personal care products. The combination of video and
laboratory exercise provides a time-efficient manner to deliver a project-based learning
experience.
CHED 514
Simple lecture demonstrations of interfacial energy concepts using modern
materials
Matthew A Luckey1, [email protected], Phillip W Alexander2, William A
Alexander1. (1) Department of Chemistry, The University of Memphis, Memphis, TN
38152, United States (2) Department of Chemistry, Marshall University, Huntington, WV
25755, United States
Understanding intermolecular interactions is of paramount importance for students to
develop a robust chemical intuition. Intermolecular interactions are inherently microscopic
phenomena, which hardly lend themselves to effective and instructive classroom
demonstrations. We use simple video equipment (i.e. “web cams”) to project the
macroscopically-visible wetting behavior of droplet/surface systems, which results from
specific interfacial intermolecular interactions. Using self-assembled monolayers as well-
ordered model surfaces, we alter the interfacial chemical functionality, giving rise to
variation in the contact angle of a sessile droplet. The different wetting properties of pine
boards with 1) no treatment, 2) chemical pressure treatment, and 3) wood acetylation
treatment are also compared. In addition to gaining an appreciation for how microscopic
intermolecular interactions become important in the macroscopic world, using acetylated
wood samples exposes students to a “new” chemical technology, and prompts discussion
of “green chemistry” practices in wood preservation. Results from ongoing learning
outcome assessments will be reported.
CHED 515
Spectroscopic and photochemical studies of sunscreen active ingredients: An
undergraduate physical chemistry experiment
Megan S Claflin, [email protected], John D Thoemke.Department of Chemistry
and Geology, Minnesota State University, Mankato, Mankato, MN 56001, United States
We have developed an undergraduate physical chemistry laboratory experiment examining
the properties of three compounds that are active ingredients in common sunscreen
products: avobenzone (1-(4-tert-butylphenyl)-3-(4-methoxyphenyl)-1,3-propanedione),
oxybenzone (2-hydroxy-4-methoxybenzophenone), octyl 4-methoxycinnamate (OMC) (2ethylhexyl-4-methoxycinnamate). Aqueous solutions of the compounds are exposed to
simulated sunlight in a merry-go-round photochemical reactor. Students work through a
kinetic analysis of the direct photolysis of each compound using high performance liquid
chromatography (HPLC) determination. Students also use rates of furfuryl alcohol
consumption in the irradiated solutions to analyze the quantum yield of singlet oxygen
production. Finally, absorbance and fluorescence spectra, along with each compound's
molecular structure are evaluated. Students are then asked to correlate which compounds
undergo direct photolysis, generate singlet oxygen, or resist photodegradation based on
the compounds' molecular and spectroscopic characteristics.
CHED 516
Why do some students privilege chemistry knowledge while other students privilege
consumer knowledge when confronting cost-benefits questions in chemistry?
Janessa` Dunn1, [email protected], Steven Culliper2, Shainaz M Landge1,
Hannah Sevian2. (1) Department of Chemistry, Georgia Southern University, Stateboro,
Georgia 30458, United States (2) Department of Chemistry, University of Massachusetts
Boston, Boston, Massachusetts 02125, United States
Students apply both consumer and chemistry knowledge to solving problems in chemistry,
particularly when those problems have relevance to their lives. In the context of studying a
learning progression on chemical design across the timespan of middle school through
graduation from university, undergraduate students' understanding of benefits, costs and
risks in the design of chemical processes is being investigated. Preliminary data collected
through surveys and interviews about a case study on refrigeration compounds revealed
that, while students applied both consumer (common) knowledge and chemistry (schoolbased) knowledge to the case study, most undergraduate students taking general and
organic chemistry at two culturally divergent universities privileged consumer knowledge
over chemistry knowledge, while the opposite occurred with a small number of students. A
second series of interviews intends to uncover relationships among demographic, interest,
and ideology variables that may partially explain why one type of knowledge is privileged
over the other.
CHED 517
Bridging the gap: A comparison of students' high school and general chemistry lab
experiences
Megan Robb1, [email protected], Allison Kay1, [email protected], Thomas
Bussey2, MaryKay Orgill2, Nathan Barrows1. (1) Department of Chemistry, Grand Valley
State University, Allendale, MI 49401, United States (2) Department of Chemistry,
University of Nevada, Las Vegas, Las Vegas, NV 89154, United States
General chemistry is often an overwhelming experience for students. Although the
laboratory component is often viewed by instructors as another way to increase student
understanding of concepts, the lab experience can be quite frustrating and add to students'
confusion. Whereas instructors might attribute difficulties in lab to negative attitudes, poor
preparation for lab, or inattention to lab procedures, they often forget that their students
bring a wide variety of high school lab experiences to the college classroom. Difficulties in
lab may exist due to the disparity between the lab skills taught at the high-school level and
the performance expectations of college lab instructors, but relatively few research studies
have directly examined this factor via student interviews. This qualitative study investigated
students' lab experiences at the high school and college levels via focus group and
individual interviews. The recordings were transcribed and analyzed using methods
informed by grounded theory.
CHED 518
Fun and frustration: Students' perspectives of college-level laboratories
Allison Kay1, [email protected], Megan Robb1, [email protected], Thomas
Bussey2, MaryKay Orgill2, Nathan Barrows1. (1) Department of Chemistry, Grand Valley
State University, Allendale, MI 49401, United States (2) Department of Chemistry,
University of Nevada, Las Vegas, Las Vegas, NV 89154, United States
For the past several decades, the lab curriculum of college-level chemistry courses has
gradually shifted to incorporate more inquiry-based investigations. While some students
and instructors respond favorably to these changes, others are more resistant. Although
instructors and students might be expected to have very different perspectives of lab
activities, students are by no means a homogeneous group in this regard. This study
investigated the experiences, preferences, and frustrations of 24 students regarding their
college-level chemistry labs. Preliminary data analysis indicates that students attached
strong negative and positive feelings to specific lab activities, the organization of the lab
environment, and the extramural requirements associated with a chemistry laboratory.
CHED 519
Spelling words using chemical element symbols
Nizhonabah Williams, [email protected], Sunny McCabe,
[email protected], Josie Martinez, [email protected],
Ashley Shondee, [email protected], Kassie Shondee,
[email protected], Mariah Yazzie, [email protected],
David J. Duncan.DEPARTMENT OF CHEMISTRY, GANADO UNIFIED SCHOOL
DISTRICT, Ganado, AZ 86505, United States
One of the struggles of a first year Chemistry student is to be able to learn chemical
element names, and chemical element symbols. Each student is essentially a Science
Language Learner (SLL). This lesson incorporates using chemical symbols to spell
ordinary words. It helps familiarize the students with the spelling of the elements and their
pronunciations. It causes students to become familiar with element locations on the
periodic table. In addition, they are able to translate from element to symbol and from
symbol to element name. Some students really enjoy this lesson. From 72 student's
submissions we were able to compile a list of over 1400 unique words using over 109 of
118 different symbols.
CHED 520
Live action chemistry displays and related material science
Tate J Campbell, [email protected], Thomas W. Killingsworth.Department of
Chemistry & Biochemistry, California State University, Chico, Chico, CA 95926, United
States
Development of live-action chemistry demonstrations for display cases and museums will
be presented. We have been developing self-contained chemical reactions. These selfcontained set ups are designed last for weeks. They are also chosen to develop interest
and keep viewers coming back for more time-after-time. Systems that have been
developed, are being developed and planned to be developed will be presented.
Correlation of the systems with the NRS standards for informal science education will also
be presented. The focus of our systems is on small, airtight apparatus' which contain two
separate aqueous solutions. These systems can be used in order to study evaporation and
diffusivity of gaseous species in the atmosphere, typically strongly ammoniacal solutions in
conjunction with ionic cuprous solutions have been used in the past.
CHED 521
Synthesizing cadmium selenide quantum dots for an educational demonstration on
fluorescence
Jessica Barilone, [email protected], Patrick Wallace, Alex Blanchard, Henry
Brown, Peter Woodruff.Department of Chemistry, University of Southern Maine, Portland,
Maine 04104, United States
The USM Chemistry Club works to develop new and interesting ways to educate students
of all ages about a variety of chemical principles. Each year we work to incorporate new
demonstrations that highlight a different principle. The University of Southern Maine
Chemistry Club synthesized quantum dots as a means to demonstrate the various
fluorescence capabilities of molecules, and the different energies associated with different
wavelengths of light. Quantum dots are a type of nanoscale particle whose electronic
energy levels are dependent on their individual size, quantum dots of various diameters
emit photons of different energy levels due to quantum confinement effects. The unique
properties of quantum dots have made them useful in applications such as optoelectronics,
wavelength tunable lasers, and bioanalytical methods. Quantum dots can be used as a
safe, interactive way for children to observe the effects of electronic excitation, and photon
emission.
CHED 522
University of Southern Maine department of chemistry encourages local teens to
embrace STEM fields through hands-on laboratory experiments
Alex Blanchard, [email protected], David Finocchietti, Courtney Pizzo, Peter
Woodruff.Department of Chemistry, University of Southern Maine, Portland, Maine 04104,
United States
The University of Southern Maine Department of Chemistry and Chemistry Club work in
concert to connect with students from local high schools. This year a collaborative project
was developed to encourage students to enroll in STEM (science, technology, engineering,
mathematics) programs. Members of the USM Chemistry club worked alongside chemistry
faculty to teach basic laboratory techniques to local high school students. Over 100
students from Casco Bay High School's sophomore class were invited to work in
laboratories at the University of Southern Maine. The students worked in the analytical,
organic, and biochemistry laboratories and learned about 1) organic extractions via column
chromatography, 2) thin layer chromatography and 3) fluorometry. The goal of this project
was to expose students to basic laboratory techniques and instrumentation in hopes that it
will encourage them to pursue a career in the STEM fields.
CHED 523
Affinity capillary electrophoresis for the study of glycosaminoglycan-protein
interactions
McKenna Feltes, [email protected], Brittany Sanders, [email protected], Albert
Korir.Department of Chemistry, Drury University, Springfield, Missouri 65802, United States
Glycosaminoglycans (GAGs), such as heparin and heparan sulfates, are known to
influence in-vivo activities of a wide range of proteins. GAGs consist of repeat disaccharide
units that differ in basic monosaccharide sequence, substitution pattern, and
stereochemistry of the glycosidic linkages. The structural complexity of GAG chains
present considerable challenges in studying their molecular interactions with proteins. We
present an affinity capillary electrophoresis (ACE) method to study GAG-protein
interactions. ACE is well suited for highly anionic analytes, such as heparin-derived
oligosaccharides, for which large differences in electrophoretic mobility can be observed
between the complex and the free target protein. Binding parameters can be obtained
reproducibly with minimal sample consumption. Results obtained will be validated using
computational approaches and nuclear magnetic resonance (NMR) spectroscopy.
Elucidation of GAG-protein interactions can provide critical insight into mechanisms
underlying important biological processes.
CHED 524
Solvent free stereoselective reduction of carbonyl groups
Emmanuel Lopez-Nogueras1, [email protected], David Sanabria2, Ingrid
Montes-Gonzalez1, Sara M Delgado-Rivera1. (1) Department of Chemistry, University of
Puerto Rico Rio Piedras Campus, San Juan, Puerto Rico 00931, Puerto Rico (2)
Department of Chemistry, Interamerican University of Puerto Rico Metro Campus, San
Juan, Puerto Rico 00926, Puerto Rico
Stereoselective reductions are very important in organic synthesis. Reduction reactions
have been thoroughly discussed in undergraduate organic chemistry laboratory textbooks,
however most procedures highlight the reaction with little or no emphasis on its
stereoselectivity. This poster presents an experiment using the guided-inquiry approach for
a systematic study on the stereoselective reduction of cyclohexanone derivatives applying
green chemistry principles. This approach consists mainly, but not exclusively, of a solvent
free media. Parameters such as stoichiometry, stirring time, and temperature were studied.
Spectroscopic techniques were implemented to characterize and determine the
stereoselectivity of the products. It is expected that after the laboratory, the student will
have a more in-depth knowledge of NMR spectroscopy and understand the full advantages
of this technique. This will help them to integrate learned fundamental concepts and
encouraging them to explore a research-type experience in the solution of problems.
CHED 525
Electrophoretic deposition of Co nanoparticles for Co3O4 films
Don-Hyung Ha2, Richard Robinson2, Diana M Gooding1,
[email protected]. (1) Department of Physics, Transylvania University,
Lexington, Kentucky 40508, United States (2) Department of Materials Science and
Engineering, Cornell University, Ithaca, NY 14853, United States
Co3O4 nanoparticles are an attractive material for Li-ion battery anodes, because they have
a volumetric and gravimetric capacity 2.5 times greater than that of graphite. These anodes
can be prepared through calcination of electrophoretically deposited films of Co
nanoparticles. While this method produces battery anodes with high gravimetric (>830
mAh/g) and volumetric (>2100 mAh/cm3) capacities, the deposited film's thickness and
density are crucial to the battery's capacity and longevity. This work demonstrates control
over the thickness and density of Co3O4 NP films through the variation of electrophoretic
deposition (EPD) parameters. Starting with Co nanoparticles, we altered the solution
concentration and applied voltage across an EPD cell. Generally, the resulting films'
density increases with increasing voltage, and decreases with increasing concentration.
Because these trends hold for films in the Co3O4 phase, we demonstrate the ability to tune
the thickness and density of Co3O4 films starting simply with EPD parameters.
CHED 526
Bridging knowledge gaps in chemical concepts
Connie Gabel, Cristina Winchester, [email protected], Jeremy O'Brien,
[email protected] of Chemistry, Metropolitan State University of
Denver, Denver, Colorado 80217, United States
General chemistry knowledge is important for chemistry and biology students. By
improving chemistry knowledge, biology students should have a more conceptual
understanding of these topics. Students are expected to have prior knowledge of algebraic
methods when they enter general chemistry. In assessing their ability to apply these skills
to chemistry problems, their understanding of these concepts is determined. Supplemental
Instruction (SI) provides an opportunity for students, outside of traditional lecture, to apply
chemical knowledge to problems and discussion. The SI Peer Leader serves as the expert
in constructing chemical knowledge. Students are often unable to identify gaps in their
knowledge. By asking appropriate questions, the expert is able to identify knowledge gaps
and help students make connections between chemical concepts. In this way, students are
able to achieve greater depth of knowledge. The purpose of this research was to assess if
there is a benefit to students participating in SI.
CHED 527
Green organic chemistry labs at a community college
Pei Shan Chen, [email protected], Homar Barcena.Physical Sciences,
Kingsborough Community College, Brooklyn, NY 11235, United States
Green organic chemistry labs were tested for use in a community college classroom
setting. Experiments were adapted for teaching colleges that have few resources and are
not equipped with a fume cupboard for each student to use. Standard laboratory glassware
were used, as well as characterization methods. Multiple-step reactions were also
developed sequentially to follow the pace of the lecture.
CHED 528
Design and implementation of high school chemistry labs utilizing remote scanning
electron microscopy
Joseph H. Gault, [email protected], Emily L Janicki, Kimberly A Rosmus, Nolan R
Larry, Jennifer A Aitken.Department of Chemistry and Biochemistry, Duquesne University,
Pittsburgh, PA 15219, United States
Scanning electron microscopy uses electrons to produce magnified images of samples with
a resolution on the order of several nanometers and large depth of field. The SEM at
Duquesne University was set up for remote access through a standard Internet connection.
To begin with, two chemistry labs were designed to implement the use of the scanning
electron microscope (SEM) in a high school classroom setting. An introductory laboratory
using a copper penny serves to introduce students to the microscope and basic techniques
of microscopy. A more advanced laboratory on imaging aluminum hydroxide crystals
obtained from the decomposition of a standard aluminum can was also designed. For each
lab, a presentation tutorial, student and teacher handouts, video tutorials, and pictures of
the samples were created. Additionally, the concepts of the labs include Pennsylvania
State Standards, which are highlighted in the respective laboratory manuals that were
prepared in this work.
CHED 529
Synthesis of a fluorescent conjugated polymer in the undergraduate teaching
laboratory
Teresa Mako, [email protected], Mindy Levine.Department of Chemistry, University of
Rhode Island, Kingston, RI 02881, United States
Reported herein is the synthesis of a fluorescent conjugated polymer in an undergraduate
teaching laboratory. While fluorescent polymers have tremendous utility in research
laboratories and in industry, there are only a handful of examples of polymer synthesis in
the undergraduate laboratory setting. Previous syntheses of MEH-PPV (poly[2-methoxy-5(2'-ethylhexyloxy)-p-phenylene vinylene]) were examined and modified into a procedure
amenable for an undergraduate teaching laboratory. This modified synthesis was
performed in a three-hour laboratory period without requiring a glovebox or excessive inert
atmosphere conditions. Once synthesized, the polymer was characterized by absorbance
and fluorescence spectroscopy, as well as NMR spectroscopy. The polymer was also used
for the synthesis of nanoparticles and thin films. In summary, 13/14 students in the
laboratory were able to successfully synthesize and characterize the polymer, MEH-PPV,
using our newly developed procedure.
CHED 530
Novel approach to increase student satisfaction and performance in organic
chemistry
Jacob R Acharte, [email protected], Holly L Sebahar,
[email protected], University of Utah, Salt Lake City, Utah 84115, United
States
In an Organic Chemistry classroom of 200+ students it can be both overwhelming and
difficult for the professor and students to build a relationship. This lack of connection can
have negative affects on the student's overall grade, college experience, and future career.
Method used: TA's would meet with students once a week to go over the previous
discussion worksheet. TA's got to get to know their students and were able to identify their
needs. After each session the TA's reported back to the professor clarifying the student
struggles. Students with lower grades were selected to comprise the majority of the group,
but it was critical that a few students within the group have high grades. The students in the
program reported back with 100% satisfaction. Data also revealed that students in the
program scored 10.2% points higher than the class average on each exam and 14.4%
higher on the final.
CHED 531
Acquire the practical skills and knowledge needed for the chemical industry with an
associate's in industrial chemistry technology alongside a bachelor's degree
Kimberly R Johnson1, [email protected], Joseph C Christy-Saviano1, B Q Wierckz1,
Tyler Weatherwax1, Pasquale R Di Raddo. (1) Department of Physical Sciences, Ferris
State University, Big Rapids, MI 49307, United States
With an associate's degree in Industrial Chemistry Technology that easily coincides with
any science major, a new graduate has more practical laboratory skills and knowledge of
chemical safety than the average graduate with only a bachelor's. Employers and graduate
recruiters see these students as more resourceful and qualified because of the extra
preparation that this program has to offer. The program focuses on the main components
of working in industry stressing laboratory calculations, safety hazards of common
chemicals and keeping an excellent laboratory notebook. The Chemical ManufacturingAnalysis class provides the greatest preparation for an upcoming graduate by replicating
an actual work day in industry. It focuses on the preparation and analysis of various
materials by using FT-IR, NMR, Mass Spectrometer and Gas Chromatography. Students
also partake in an ongoing research project by varying reaction conditions to develop a
more efficient reaction pathway of the production of a dye called dibenzanthrone.
CHED 532
Using computational chemistry in biochemistry: Why did nature not select silicon
for biological molecules?
Blakely Sanders1, [email protected], Haley Norris1, Chelsea Swords2,
Maureen K. Murphy1, [email protected]. (1) Department of Chemistry and
Biochemistry, Huntingdon College, Montgomery, AL 36106, United States (2) Department
of Biology, Huntingdon College, Montgomery, AL 36106, United States
We have used computational chemistry (HyperChem 8.0) to compare minimized energies,
lowest energy conformations, bond angles, and bond lengths in a series of biologically
important molecules including the small peptide hormone oxytocin, glucose, protoporphyrin
IX dimethylester (PPIXDME), tetraphenylporphyrin, ATP, cocaine, NADH, propofol, and
limonene. A comparison of the energies, bond measurements, and lowest energy
conformations of the carbon-based molecules with their silicon analogs showed unsual
structures and energies of the silicon analogs.
CHED 533
Conformational influence of fluorine substitution on peptides derived from β-amino
acids
Alec D. Emerling1, [email protected], Gary S. Kedziora2, Joseph J. Urban1. (1)
Chemistry Department, U. S. Naval Academy, Annapolis, MD 21402, United States (2)
High Performance Technologies, Wright Patterson AFB, OH 45433, United States
Fluorine's unique ability to participate in a number of subtle stereoelectronic effects has
prompted its use as a tool to control the conformation of peptide analogs. The
conformational energies of model β-amino acid peptides, and their fluorinated analogs,
have been explored using a combination of correlated wave function and density functional
theory calculations. Results from a variety of methods including ωB97X-D/cc-pVTZ,
b3lyp/6-311++G**, and M062X/cc-pVTZ are compared to benchmark results from coupledcluster calculations (CCSD(T)) employing complete basis set (CBS) extrapolation methods.
The impact of aqueous solvation on the conformational profiles is also examined via a
continuum solvation model. These results contribute to a better understanding of the
impact of selective fluorination on the conformational preferences of model peptide mimics.
CHED 534
Conformational preferences for C-F bonds adjacent to carbonyls
Eric W. Emerling1, [email protected], Gary S. Kedziora2, Joseph J. Urban1. (1)
Chemistry Department, U. S. Naval Academy, Annapolis, MD 21402, United States (2)
High Performance Technologies, Wright Patterson AFB, OH 45433, United States
In compounds containing a fluorine adjacent to a carbonyl, a preference for the
conformation with the C-F bond anti to the C=O bond has been noted. This effect is
particularly pronounced in α-fluoroamides, but has been described in other functional
groups as well. The goals of this work are to employ computational chemistry methods to
explore the generality of this effect by examining a variety of functional groups, to
determine if trifluoromethyl groups participate in a similar effect, and to determine the
impact of solvent medium on the effect. Rotational profiles about the C-C bond in
compounds containing X-C-C=O, where X = F, CF3, have been generated at the ωB97XD/cc-pVTZ level of theory. Examples where the carbonyl is part of an aldehyde, ketone,
amide, acid, or ester have been considered. The minima found in the gaseous phase and
in an aqueous environment as described by a continuum solvation model are compared.
The conformational preferences are analyzed in terms of a number of underlying effects
including sterics, electrostatics, and orbital considerations.
CHED 535
Computational analysis of thiolated gold nanoparticles
Morgan R Olsen, [email protected], Kevin Range.Department of Chemistry, Lock Haven
University, Lock Haven, PA 17745, United States
Gold nanoparticles are being studied extensively for their optical, electronic, and molecular
recognition properties. Thiolated gold nanoparticles behave differently than traditional bulk
materials. The goal is to use computational chemistry to see the effect of putting different
terminated ends on thiolated gold nanoparticles.
CHED 536
Effect of dielectric constant on bond critical point descriptors in model nucleotide
dimers
Christian M Posea, [email protected], Harry L Price.Department of Chemistry, Stetson
University, DeLand, Florida 32723, United States
Hydrogen bonding plays an important role in modulating the stability of molecular
complexes. The goal of this investigation is to examine the effect that dielectric constant
has on H-bonds present in adenine-thymine and adenine-uracil dimers. Specifically, we are
interested in determining whether H-bonds in these dimers are equivalent, and how each
responds to changes in dielectric constant. To begin to address these questions the
electron density and laplacian of the electron density at the bond critical point (BCP) were
calculated for geometry-optimized complexes in six media having dielectric constants
ranging from 0 to 78.36 Debye using the Self-Consistent Isodensity Surface Polarizable
Continuum model. Understanding the differential response of these descriptors to changes
in dielectric constant may contribute to a better understanding of the importance H-bonding
has as a modulator of these dynamic associations.
CHED 537
Computational study of selenoproteins involved in the activation of thyroxine.
Zachary B. Gottleib, [email protected], William M. Davis.Department of Chemistry, Texas
Lutheran University, Seguin, Texas 78155, United States
The understanding of selenoproteins, such as Iodothyronine deiodinase, plays an
important role in the activation and inactivation of thyroxine. While this class of proteins
does contain selenocysteine, a unique feature is the use of a cysteine to cooperatively
bond to selenium while halogen bonding to iodine so that thyroxine can be activated. This
combination occurring in the human body is strange because as calculated by Debasish
Manna the use of two selenium atoms is the most energy efficient way to remove iodine
from thyroxine. This study takes a computational approach using Gaussian 03 and Spartan
to look at the energies of the model complexes to see if this trend continues with the
addition of tellurium to the model complexes, as well as to see if there are significant
energy differences in the complexes depending on which chalcogen is participating in the
halogen bond to iodine. Though the limitations of basis sets in the Gaussian software and
only preliminary analysis through Spartan have revealed little to the bonding and energy
trends of the model complexes.
CHED 538
Correlation between band gap and electronegativity of substituted atoms in the TiO2
crystalline structure
Andrew J Glaid, [email protected], Matthew N Srnec, Jennifer A Aitken, Jeffry D
Madura.Department of Chemistry and Biochemistry, Duquesne University, Pittsburgh,
Pennsylvania 15219, United States
The electronic structure of TiO2 has been extensively studied through a variety of
experimental and computational methods. Its properties range from thin film photovoltaic
cells to optics. TiO2 provides an excellent model to study computationally due to the wealth
of experimental data and its inexpensive computational cost. Our hypothesis is that the
electronegativity of a substituent changes the band gap of crystalline TiO 2. Atoms of
different electronegativities were selected for substitution into the three polymorphic forms
of TiO2, which are rutile, anatase, and brookite. Our computational approach utilizes the
linearized augmented plane wave approach of density functional theory in the WIEN2k
computational software, and includes the incorporation of the modified Becke-Johnson
potential, to determine the band gap and density of states for each case. Initial results
showed that there was a positive correlation between the electronegativity of the
substituent and the structure's band gap.
CHED 539
Micellization of small biomolecules: Molecular dynamics simulation
Daniel Daigle, [email protected], Caleb Delaune, [email protected], HyeYoung Kim.Department of Chemistry and Physics, Southeastern Louisiana University,
Hammond, LA 70402, United States
We have performed molecular dynamics simulations using GROMACS to study the
micellization of a newly synthesized amphiphilic antioxidant molecule, Vecar [1]. The
chemical structure of the molecule is composed of a truncated vitamin E and a slightly
modified Carnosine which are, respectively, linked to the opposite ends of a simple carbon
chain of varying numbers of carbon atoms (0 to 18). The force field of this new molecule is
generated from the Automatic Topology Builder. We will report the progress and results of
our computer simulation study. This research is supported by Louisiana BOR grant
(LEQSF(2012-15)-RD-A-19) and by the Louisiana Optical Network Institute (LONI).
[1] C. Astete, D. S. Meador, D. Spivak, and C. Sabliov, Synthetic Communications, DOI:
10.1080/00397911.2011.632829 (published online in 20 April 2012).
CHED 540
PM3 and PM6 calculations on organometallic dehydrogenation catalysts
Alison Konieczki, [email protected], Lauren Martin, Sarah Schwartz, Jeff
Seyler.Chemistry, Univ of Southern Indiana, Evansville, IN 47712, United States
Semi-empirical methods have been used to investigate the catalytic mechanisms for
Iridium
pincer dehydrogenation catalysts. The intent of the current study is to compare the results
of past PM3 calculations (Spartan '10, Wavefunction, Inc.) with results using the newer
PM6 level of theory. For this report, the pincer ligand included the isopropyl-substituted
PCP systems, and cyclooctane was used as the organic substrate in the formation of H 2
and cyclooctene. Geometry optimizations with PM6 have proven to be problematic with
these organometallic systems. In cases where PM6 optimization failed to generate
appropriate geometries, single point calculations were performed using the PM3 optimized
geometries. Transition states for oxidative addition of cyclooctane and beta elimination in
cyclooctyl complexes were obtained with both PM3 and PM6. This presentation will provide
some mechanistic details in the catalytic cycle following these semi-empirical calculations
with the Iridium pincer complexes.
CHED 541
Computer simulations of anion adsorption to metal organic frameworks
Jennifer N. Loftin, [email protected], Jordan M. Lovejoy,
[email protected], Jeffrey N. Woodford.Department of Chemistry, Missouri
Western State University, Saint Joseph, Missouri 64507, United States
A new class of materials, metal organic frameworks (MOFs), have potential applications in
many areas, including catalysis, gas storage, drug delivery, biomedical imaging, and
chemical separations. MOFs can be designed for specific applications by joining certain
metals with organic linkers. We are investigating the adsorption of selected anions, such as
nitrate, perchlorate and chloride, with cationic MOFs. Specifically, we will study Cu(II) and
Al(III) MOFs because they have been shown to exhibit selective anion exchange and have
stability in aqueous solution. Our investigation is composed of two parts. The first part is
comprised of ab initio calculations to find interaction energies between anions and MOF
structural binding units (SBUs). The second part involves performing molecular dynamics
simulations to compare the equilibrium distribution of anions in the MOF pores compared to
bulk solvent. Results will be presented based on these simulations.
CHED 542
Catalytic effect of Cu modified FAU zeolite on nitrous oxide
A. William Barber, [email protected], Joo Young Yim, [email protected],
Heriberto Hernandez.Department of Chemistry, Grinnell College, Grinnell, IA 50112, United
States
We investigated the absorption of N2O on a Cu-FAU zeolite using density functional theory.
Computations were performed with a two layer ONIOM method. For the high layer, we
used B3LYP/6-31+G(d) level of theory, and for the lower layer we used Molecular
Mechanics (MM) employing the Universal Force Field (UFF). The results showed that a
covalent bond formed between O and Cu upon absorption, with binding energy of 154.9
kJ∙mol-1. Furthermore, the N-O bond elongated by 15.5% of its original bond length
suggesting that N2O dissociates to produce N2(g) upon interaction with a Cu-FAU zeolite.
CHED 543
Investigating the sticking of hydrogen on graphene
Andrew D. Geragotelis1, [email protected], Dennis P. Clougherty2. (1) Department of
Chemistry, Siena College, Loudonville, New York 12211, United States (2) Department of
Physics, University of Vermont, Burlington, VT 05405, United States
Theoretical physics at low temperatures allows us to learn about the fundamental
properties of materials at nanoscale dimensions. This work focuses on the interaction
between a hydrogen atom and a graphene sheet. We calculated the physisorption rate of
atomic hydrogen at normal incidence onto graphene using Fermi's Golden Rule. The
calculation shows a bound state energy of -24.9 meV. Over the range of incident energies
considered (1-10 meV), we find that the sticking probability decreases as the incident
energy of the hydrogen atom is increased. The work was performed as part of the REU on
Complex Materials at the University of Vermont under the supervision of Dennis
Clougherty.
CHED 544
Electronic structure modeling to explore the existence of pnictide analogs to HCN
species
Cameron P Glagola, [email protected], Deborah Sunderland, Robbie J
Iuliucci.Department of Chemistry, Washington and Jefferson College, Washington, PA
15301, United States
Pnictides are chemical compounds that contain Group 15 elements. Currently, synthetic
pathways are known for the compounds HCN and HCP; however, the heavier Group 15
analogs (namely HCAs, HCSb, and HCBi) have yet to be synthesized. The theoretical
existence of these molecules was explored via a Gaussian quantum chemistry composite
method as well as frequency calculations in order to predict their thermodynamic
properties, their molecular orbitals, and to probe bond length trends.
CHED 545
Cycloadditon reactions of sulfinyl carbenes with alkenes and alkynes
Danielle J Turnquest2, [email protected], Fillmore Freeman1. (1) Department of
Chemistry, University of California, Irvine, Irvine, CA 92651, United States (2) Department
of Chemistry, Florida Memorial University, Miami Gardens, FL 33054, United States
Moeller-Plesset perturbation theory (MP2) and the hybrid density functionals B3LYP,
B3PW91, and PBE1PBE with the 6-311+G(d,p) basis set and also CCSD(T) and QCISD(T)
with the cc-pVTZ and cc-pVQZ basis sets have been used to study the structures of sulfinyl
carbenes and the mechanisms of their cycloaddition reactions to alkenes to form
cyclopropanes and to alkynes to form cyclopropenes. Electron donation of the lone pair
electrons on sulfur into the vacant p orbital of the singlet carbene serves to stabilize it. In
addition to the transition states, the dipole moments, atomic charges, singlet-triplet gaps,
and vibrational frequencies of the sulfinyl carbenes were also studied.
CHED 546
Role of tyrosine O-sulfation in the CXCR4-SDF-1 chemokine receptor complex
Sara Snow, [email protected], Chaya Rapp.Department of Chemistry and
Biochemistry, Stern College for Women, New York, New York 10016, United States
The CXCR4-SDF-1 chemokine receptor complex is involved in both normal and
pathological functions in the body, including cancer metastasis. The CXCR4 receptor is
post-translationally modified by tyrosine sulfation at three sites on its N terminus, and this
modification is required for binding to the SDF-1 chemokine. To study the role of tyrosine
sulfation in the structure and dynamics of the CXCR4-SDF-1 complex, we conducted
molecular dynamics simulations on experimentally determined complexes of CXCR4-SDF1 that were unsulfated, partially sulfated, and fully sulfated. A comparison of hydrogen
bonding and torsional motions in the simulation trajectories shows that sulfation plays a
role in dimer stabilization, and that each additional sulfation site adds to the stability of the
dimeric complex. It is hoped that this work will contribute to therapeutic efforts which target
sulfated systems.
CHED 547
Configurational dependence of temperature in the potential energy landscape
ensemble
Matthew Fritz, [email protected], Jeb Kegerreis.Department of Chemistry,
Shippensburg University, Shippensburg, PA 17257, United States
Low cost computational methods were employed to evaluate the configurational
dependence of temperature in the potential energy landscape ensemble for glassy atomic
systems with o-terphenyl (OTP) as the model. In addition to the global minimal
configuration, local minima were explored and each produced a significantly different
temperature and landscape energy implying another ensemble may be more descriptive of
glassy atomic systems.
CHED 548
Comparative analysis of symmetry-adapted perturbation theory
Alden Grant Ryno, [email protected], Trent Parker, C. David
Sherrill.Department of Chemistry and Biochemistry, Georgia Institute of Technology,
Atlanta, Georgia 30332-0400, United States
Noncovalent interaction are prevalent in chemical systems including protein folding,
organic crystals, nucleic acids, and the formation of materials. These interactions are
quantitatively and qualitatively studied by employing computationally expensive
wavefunction-based quantum chemical methods. One method in particular, SymmetryAdapted Perturbation Theory(SAPT), allows the interaction energy to be computed along
with the electrostatic, exchange, induction, and dispersion energies. Here, various levels of
SAPT were tested using the S22, HSG, HBC6, and NBC10 databases in order to find a
lower level of SAPT that produced accurate results at a low computational cost. Four levels
of SAPT and 10 Basis sets were used in this study with the best overall test pairs being
SAPT2+/aDZ and SAPT2+(3)/aDZ. However, since both SAPT2+ and SAPT2+(3) are
higher levels of theory, they are quite costly. For both high accuracy and low computational
expense, the SAPT0/jaDZ test pair is an exceptional match. SAPT0/jaDZ produced a mean
unsigned error of less than 0.5 kcal mol-1 at roughly one-half and one-quarter the
computational times for SAPT2+/aDZ and SAPT2+(3)/aDZ, respectively.
CHED 549
Beyond octanitrocubane: A theoretical C-8 octanitro compound having an oxygen
balance of zero
Jesse L Hansen, [email protected], John A Bumpus.Department of Chemistry and
Biochemistry, University of Northern Iowa, Cedar Falls, IA 50613, United States
Octanitrocubane is a relatively new high energy density material (HEDM) that has potential
use as a high explosive. However, its large scale use is prevented because of its high
production cost. Our laboratory is interested in the identification and computational
characterization of other C-8 octanitro compounds as targets for possible synthesis and
development as high explosives. We characterized octanitrotetracyclo[4.2.0.02,5.03,8]oct-1ene. This compound is unique with regard to other theoretical C8 octanitro compounds that
we have studied in that, like octanitrocubane, it has an oxygen balance of zero. In addition
to oxygen balance, several other parameters (power index, explosive velocity and
detonation pressure) indicate that this compound would be at least as effective as
octanitrocubane as a high explosive.
CHED 550
Effects of tyrosine O-sulfation on binding affinity in CXCR4-SDF-1 complexes
Talya S. Laufer, [email protected], Chaya Rapp.Department of Chemistry and
Biochemistry, Stern College for Women, Yeshiva University, New York, New York 10016,
United States
Certain secreted proteins in biological systems undergo the post-translational modification
of tyrosine O-sulfation, wherein a number of Tyr residues are sulfated at their hydroxyl
groups, forming what is referred to as a Tys residue. The current study investigates the
effects of tyrosine sulfation on the strength of protein-protein interactions, as attested to by
the binding energies of the CXCR4 chemokine receptor in complex with its SDF-1
chemokine ligand. The Protein Databank includes three distinct dimeric CXCR4-SDF-1
structural complexes: 2k04, 2k03, and 2k05. 2k04 is the un-sulfated protein complex; 2k03
is sulfated once in each monomer on residue Tyr21; 2k05 is sulfated on Tyr7, Tyr12, and
Tyr21 in both monomers. A program called APBS was used to determine the binding
energies of the dimeric complexes and of their corresponding monomers. APBS utilizes the
Poisson-Boltzman equation to incorporate solvation free energies in the calculation of
binding energies. Results of APBS calculations showed that as the degree of tyrosine
sulfation increases, the binding energies of the complexes become more favorable, with
the most significant decrease in binding energy occurring between the partially sulfated
(2k03) and fully sulfated (2k05) dimeric complexes. The increased stabilization of the
dimeric complexes as compared to the monomeric complexes is a result of interactions
occurring across the dimer interface, i.e. between each sulfated CXCR4 chain and both
SDF-1 ligands. This indicates that sulfation serves both to enhance binding affinity between
CXCR4 and SDF-1, and to stabilize the dimeric state of the CXCR4-SDF-1 complex.
CHED 551
Modeling and understanding of solvent effects on 13C NMR spectroscopy
John P Siller, [email protected], James B Foresman.Department of Physical Sciences, York
College of Pennsylvania, York, Pennsylvania 17403, United States
Differences arise in Nuclear Magnetic Resonance (NMR) spectroscopy when analyzing the
same solute with different solvents. These solvent effects shift the NMR spectra in different
ways. Electronic structure codes such as Gaussian 09 can represent solvent effects using
a continuum model and also by including specific solvent molecules in the calculation of
13C chemical shifts, but current methods are limited and do not precisely match
experimental data. The objective of this study is to close the gap between experimental
and calculated spectral data by determining the factors that affect this data and better
represent these factors with computational techniques. This study attempts to discern what
amount of error is due to neglect of solvent and what error is due to the theoretical model.
CHED 552
Evaluating HADDOCK's ability to use experimental data in docking a protein-ligand
complex
Tracy L Wormwood, [email protected], Jeffrey S Grinstead.Department of
Chemistry, University of Puget Sound, Tacoma, Washington 98416, United States
With the advent of docking systems for modeling the interactions of proteins, HADDOCK is
a docking tool powerful in its abilities to use experimental data and allow for protein
flexibility in docking of proteins with other biomolecules including ligands. The present
research evaluates the influence of real experimental data on the docking of a proteinligand interaction between protein tyrosine phosphatase 1b (PTP1b) and one of its
chemical inhibitors: 5-iodo-2-(oxalylamino) benzoic acid. Either NMR chemical shift
perturbation data, or known binding-site residues were used to drive consequent docking.
The effect of different starting protein conformations was measured. Success of each
docking was evaluated by comparing the HADDOCK score to ligand-RMSD and fraction of
native protein-ligand contacts.
CHED 553
Benchmarking screened hybrid and "Rung 3.5" density functionals for transition
metal thermochemistry
Katelyn E. Poole1,2, [email protected], Marie L. Laury2, Angela K. Wilson2, Benjamin
G. Janesko1. (1) Department of Chemistry, Texas Christian University, Fort Worth, TX
76129, United States (2) Department of Chemistry, University of North Texas, Denton, TX
76203, United States
Accurate, computationally tractable thermochemical predictions for transition metal (TM)
complexes remain an important challenge in electronic structure theory. Density functional
theory (DFT) is widely applied to TM complexes, and “hybrid” DFT methods (including the
widely used B3LYP) can provide reasonable accuracy for many TM properties at modest
computational cost. New screened hybrid and “Rung 3.5” DFT functionals are designed to
incorporate important aspects of hybrid DFT at reduced computational cost. We
benchmark these functionals against a large data set of accurate experimental data for 3d
TM complexes (J. Chem. Theory Comput. 2012, 116, 870-885). The predicted enthalpies
of formation of the 3d TM molecules in the test set suggest that both classes of functionals
can provide reasonable accuracy for TM thermochemistry.
CHED 554
Computational studies of transition states in bicyclic intermediates
Phillip Esempio, [email protected], Hernando Trujillo.Department of Chemistry,
Wilkes University, Wilkes-Barre, PA 18766, United States
During 1,3 dipolar reactions of unsymmetrical mesoionic Münchnones (1) to substituted
nitrostyrenes (2), bicyclic intermediates (3) are formed, which then decompose to two
observed products (4, 5), the ratio of which is contrary to what would be expected based on
known electrostatics. As part of a larger study of this set of reactions, a computational
study of possible transition states, both to and from the intermediate, was conducted in
order to clarify the mechanism by which this reaction occurs, and shed light on the
unexpected ratio of products.
CHED 555
Predicted structures of aggregates of the human gamma-D crystallin protein found
in cataracts
Sarah A. Richards, [email protected], Bao-Linh Nguyen, Ralph A. Wheeler.Department
of Chemistry and Biochemistry, Duquesne University, Pittsburgh, PA 15282, United States
Human age-onset cataracts are a disease caused by the aggregation of gamma-D
crystallin, a structural protein in the lens of the eye. The resulting aggregation causes
progressive blindness. The purpose of this research is to determine the causes of these
aggregates and their resulting structures. It is hypothesized that a hydrophobic core, five
contiguous hydrophobic residues, is critical for the aggregation of gamma-D crystallin.
Initial molecular dynamics simulations of small peptides containing a hydrophobic core of
gamma-D crystallin were performed to examine possible aggregate structures. Accurate
structures of the aggregates will provide a basis for the long-term goal of designing drugs
that will inhibit these aggregations to potentially prevent or treat cataracts.
CHED 556
Origin of enantioselectivity in helical dual hydrogen-bonding catalysts
Ulises Rangel, [email protected], Steven E. Wheeler.Chemistry, Texas A&M
University, College Station, TX 77840, United States
Stereoselective reactions play an important role in chemistry, especially in the synthesis of
pharmaceutical compounds. For this purpose, there are presently insufficient methods for
asymmetric catalysis without the use of toxic and costly transition-metal based compounds.
Here we report a computational study of the enantioselective addition of 4,7-dihydroindoles
to trans-nitroalkenes catalyzed by a novel dual hydrogen-bonding helical catalyst recently
developed by Takenaka and co-workers [J. Am. Chem. Soc. 2010, 132, 4536]. Through the
use of density functional theory (DFT) methods at the B97-D/TZV(2d,2p) level, the
mechanistic pathways for this reaction were explored to identify the key features of the
transition state (TS). It is shown that the helical structure of the catalyst induces a stepwise
mechanism through non-covalent interactions resulting in kinetic discrimination and high
enantioselectivity. Ongoing studies involve application of the distortion-interaction model to
quantify the role of these non-covalent interactions in the enantioselectivity. Understanding
the salient features of this reaction is essential for the rational design of improved
organocatalysts that utilize similar hydrogen-bonding interactions.
CHED 557
Binding of heparin oligosaccharides to proteins: Validating a computational
methodology
Cynthia B. Lombardo1, [email protected], Christos Deligkaris2. (1) Hoffman
Department of Chemistry, Drury University, Springfield, Missouri 65802, United States (2)
Department of Physics, Drury University, Springfield, Missouri 65802, United States
Heparin glycosaminoglycans play an important role in many biological mechanisms such
as metabolism, growth signaling, and metastasis. An understanding of the binding of
heparin oligosaccharides to various protein receptors is impeded by the difficult process of
fractionation and crystallization as well as by cost. Because of this, a computational
method is highly desirable. To validate our computational method, we minimize a free
energy function with the aid of a Lamarckian Genetic Algorithm (LGA) to compute the
binding site of a heparin tetramer on a basic fibroblast growth factor (PDB code 1BFB) as
well as other systems for which the binding site is known from crystal structures. The free
energy function includes a van der Waals term, an electrostatic term with a distancedependent dielectric function, a directional hydrogen bonding term, a solvation term, and a
torsional term. We also systematically vary LGA parameters to achieve the best
compromise between accuracy and efficiency.
CHED 558
1,3-Dipolar cycloadditions of azomethine ylides: Prospects for covalent
functionalization of carbon nanotubes
Jacqueline M Maguire, [email protected], Jacob W. G. Bloom, Steven E
Wheeler.Department of Chemistry, Texas A&M University, College Station, TX 77843,
United States
The properties of single-wall carbon nanotubes (SWNTs) have become a prevalent topic of
study in the scientific community in recent years. Covalent functionalization is used to tune
their physical and electronic properties for applications in energy storage and optical
devices, as well potentially separating metallic from semiconducting SWNTs. We
investigated the 1,3-dipolar cycloaddition reactions of azomethine ylides with SWNTs using
computational chemistry. Focal point analyses of the 1,3-dipolar cycloaddition reactions of
the azomethine ylide with ethylene and benzene were compared with density functional
theory (DFT) for use with larger systems [CCSD(T)/CBS vs. B3LYP-D/6-31G(d) and B97D/TZV(2d,2p)]. These functionals were used as a benchmark for the same reaction with
(6,6) SWNTs for two-layered ONIOM method geometries [B3LYP-D/6-31G(d) vs. B3LYPD/6-31G(d)//B3LYP/6-31G(d):UFF and B97-D/TZV(2d,2p) vs. B97-D/TZV(2d,2p)// B97D/TZV(2d,2p):UFF]. Future work will allow this method to be applied to larger systems, and
adding substituents onto the ylide could alter the reactivity of the systems through stacking
interactions.
CHED 559
Efficacy of transition metals as Sonogashira co-catalysts: Computation and
experiment
Mercedes S. Black, Talia M. Fanelli, Alexis C. Konja, Mariam A. Saco, Michelle M. Smith,
Ciara J. Viola, Jenna L. Wonsowicz, Matthew J. Mio, [email protected], Jonathan E.
Stevens.Chemistry and Biochemistry, University of Detroit Mercy, Detroit, MI 48221-3038,
United States
Ab initio molecular orbital and density functional calculations optimize the structures of
complexes of acetylene to selected transition metal cations. These computations also
determine the deprotonation energy of these complexes, and provide predictions about the
efficacy of these cations as Sonagashira co-catalysts. These predictions are compared to
the quantitative yields of synthetic attempts which implement these ions in the co-catalyst
role. Correlation is observed between the theoretically-predicted acetylene complex
energies and the utility of the transition metal co-catalysts as measured by percent yields in
a common Sonogashira transformation.
CHED 560
Geometry optimizations with effective fragment potentials
Anthony J. Burand Jr., [email protected], Andreas V. Copan,
[email protected], Rollin A. King.Department of Chemistry, Bethel University, St. Paul,
Minnesota 55112, United States
The effective fragment potential (EFP) method models discrete solvent molecules
according to their electrostatic, polarization, dispersion, exchange-repulsion, and charge
transfer effects, allowing for computational analysis of systems in a solvent environment
within a reasonable time-frame. This project aims to integrate EFP with the optimizer of
PSI4, an open source, ab initio quantum chemistry program. Implemented algorithms
include GS2 (2nd order Gonzalez-Schlegel) reaction-path-following, RFO and P-RFO
(partitioned rational function optimization), Newton-Raphson optimization, and steepestdescent minimization. Model systems used for comparison to the literature include water
dimer and water-formamide.
CHED 561
Molecular docking studies of novel flavonoid derivatives as acetylcholinesterase
inhibitors
Olivia M Newman, [email protected], Chavonda J Mills.Department of
Chemistry, Physics, & Astronomy, Georgia College, Milledgeville, GA 31060, United States
Studies show that one of the many factors contributing to Alzheimer's disease is the
hydrolysis of acetylcholine (ACh) from the enzyme acetylcholinesterase (AChE). Research
has also found that AChE inhibitors decrease the rate at which ACh is metabolized,
therefore increasing the concentration of ACh in the brain. Thus, the development of AChE
inhibitors for the treatment of Alzheimer's disease is essential. The proposed research
presents docking studies of novel flavonoid derivatives at the AChE active site. Autodock
4.0 as well as Autodock Vina were used to determine binding free energy and inhibitory
concentration (IC50) values were calculated. The results will facilitate the design of novel
flavonoid derivatives as AChE inhibitors.
CHED 562
Computational modeling of dietary dibenzoylmethane for targeting GR binding sites
in hormone refractory prostate cancer
Lydia A Ruffner, [email protected], Leyte Winfield, Kimberly M
Jackson.Department of Chemistry, Spelman College, Atlanta, GA 30314, United States
Prostate cancer continues to pose a public health challenge to the United States. It's the
most commonly diagnosed cancer and second leading cause of cancer related deaths in
U.S. males with approximately 240,000 new cases and 34,000 deaths in 2011. Initially,
prostate cancer begins as an androgen-dependent tumor. Over time, prostate cancer
eventually progresses or emerges to an androgen independent or refractory state for which
there is no effective treatment. Small molecules such as dibenzoylmethane (DBM) which
specifically target the glucocorticoid receptor (GR) signaling pathway may provide an
effective treatment for hormone refractory prostate cancer. Computational and modeling
data suggest that DBM interacts within different locations on the GR. Molecular models
were constructed based on the crystal structure of human GR-LBD in the complex of a
glucocorticoid (GC) ligand using the Molecular Operating Environment (MOE). Models
were obtained from the Research Collaboratory for Structural Bioinformatics Protein Data
Bank (RSCB PDB). Alternate binding sites for DBM based on DBM conformation within the
GR-LBD binding pocket will be explored using the docking tool in the MOE software.
Protein alignment will be utilized to compare the conformation of GR-LBD in complex with
DBM and the conformation of the protein when a GC is bound. Binding affinities and
conformation energies will be calculated for each ligand-protein complex for overall good
fit. The amino acid sequence of the DBM-GR binding site will be determined using the
sequence editor tool in MOE. This will provide information on changes in protein
conformation and ligand affinity that occur in the presence of DBM.
CHED 563
Global optimization of carbon and boron nitride clusters using a genetic algorithm
Hallie Harbison, [email protected], Eric D Glendening.Department of
Chemistry and Physics, Indiana State University, Terre Haute, IN 47809, United States
A genetic algorithm is a global optimization method that mimics the natural selection
processes of evolution. Members of a population mate to form offspring which, according to
their fitness, are either discarded or join the population. Mutations occasionally occur, and
the resulting mutant offspring can potentially join the population too, whether they are fit or
not. We have implemented a genetic algorithm that can be interfaced to Gaussian-09,
GAMESS, or MOPAC9 to determine the geometry of a cluster of atoms corresponding to
the global energy minimum. The algorithm uses a combination of mating, permutation, and
mutation to maintain a population of candidate cluster geometries. Test cases reveal that
the population tends to converge on the global energy minimum. We report results from
semi-empirical and density functional calculations on small carbon and boron nitride
clusters.
CHED 564
Sulfur dioxide adsorption at surfaces of ionic aqueous solutions
Omar Kyle Hite2, [email protected], Geraldine Richmond1, Kevin Johnson2. (1)
Materials Science Institute, University of Oregon, Eugene, OR 97403, United States (2)
Chemistry, Pacific University, Forest Grove, OR 97116, United States
Sulfur dioxide is a major atmospheric component and is introduced into the environment
both naturally and industrially. However, under certain conditions, sulfur dioxide can cause
acid rain and cloud nucleation. Therefore, it is imperative to understand how sulfur dioxide
adsorbs onto aqueous surfaces at the molecular level and in particular, ionic aqueous
solutions. This adsorption process was modeled using classical molecular dynamics, which
provides a detailed picture of the adsorption process. From the simulation data we were
able to perform statistical analysis to determine interfacial density and molecular orientation
for both water and sulfur dioxide. It was found that relatively high concentrations of ions in
the aqueous solution hinder the sulfur dioxide's ability to adsorb onto surface which
decreases the solubility of the sulfur dioxide.
CHED 565
Resonance-assisted hydrogen bonding (RAHB) in carboxyphosphate by computed
31P NMR shielding constants and shifts
Sarah E. Kochanek1, [email protected], Teresa M. Dierks1, Steven M. Firestine2,
Jeffrey D. Evanseck1. (1) Department of Chemistry and Biochemistry, Duquesne
University, Pittsburgh, Pennsylvania 15282, United States (2) College of Pharmacy and
Health Sciences, Wayne State University, Detroit, Michigan 48201, United States
Resonance-assisted hydrogen bonding (RAHB) is a controversial phenomenon that
describes flow of charge and π-system electrons, which can potentially modulate the
strength of an intramolecular hydrogen bond. RAHB was investigated as a possible
explanation for the unusually high stability (+11 kcal/mol) of the pseudo-chair conformation
of dianionic carboxyphosphate. Using Truhlar's Minnesota M06-2X functional and
Dunning's aug-cc-pVnZ (n=D,T,Q,5) basis sets, the 31P NMR shielding constants and
chemical shifts have been calculated and compared to the analogous values for
monohydrogen phosphate. 31P NMR properties were calculated for nine phosphorus
systems with known experimental values with phosphoric acid and phosphine used as the
reference systems. The calibration is used to validate the differences between
carboxyphosphate's and hydrogen phosphate's chemical shifts. The computed difference
of carboxyphosphate shifts, nucleus-independent chemical shifts (NICS) and relation to
RAHB will be discussed as an explanation for the increased stability of dianionic
carboxyphosphate.
CHED 566
Hydrogen bonding in substituted benzoates
Damen R Gee, [email protected], Kevin Range.Department of Chemistry, Lock Haven
University of Pennsylvania, Lock Haven, Pennsylvania 17745, United States
The objective of this research is to determine whether or not there is hydrogen bonding in
5-bromo-2-(bromomethyl)-benzoic acid, ethyl ester (CAS Registry Number: 950741-84-1).
Research has shown the possibility of an intramolecular hydrogen bond between a
bromomethyl hydrogen and an ester oxygen. Density functional theory calculations were
used to attempt to verify the above hypothesis. The 5-bromo-2-(bromomethyl)-benzoic
acid, ethyl ester was not the only molecule studied, 5-bromo-2-(methyl)-benzoic acid, ethyl
ester, water, and water dimers were also observed to better understand the
possibility/characteristics of hydrogen bonding in molecules that are known to have these
bonds or the possibility.
CHED 567
DFT study of the mechanism of the photo-oxidation of dihydrobiopterin in aqueous
media
Crissie Vandehoef, [email protected], Christopher B. Martin.Department of
Chemistry & Biochemistry, Lamar University, Beaumont, TX 77710, United States
Dihydrobiopterin (H2Bip) and biopterin (Bip) are two molecules in the pterin family that
accumulate in the white patches of the skin in patients with the disease vitilgo. Using
HPLC, fluormetric, and other techniques, Thomas and co-workers proposed an eleven-step
mechanism by which H2Bip is photo-oxidized to Bip in aqueous media. (“Photochemistry of
Dihydrobiopterin in Aqueous Solution”, Thomas et.al. Org. Biomol. Chem., 2010 , 8, 800810.) In the present work, we present the results of a collaboration with the above
mentioned authors where the proposed mechanism is investigated using Density
Functional Theory (DFT) calculations. The calculations explore the various photochemical
spin states (excited-singlet and -triplet states), electron-transfer reactions, and radical
reactions using the PCM (Polarizable Continuum Model) for solvation using water as the
dielectric constant for all species. These thermodynamic results, and their known
limitations, are used to support the feasibility of the literature proposed mechanism.
CHED 568
Hydration of a coarse-grained methyl-ion solute
Marcus E Parry, [email protected], Tricia D. Shepherd.Department of
Chemistry, Westminster College, Salt Lake City, Utah 84105, United States
Studying toxic methyl mercury in aqueous environments is essential to understanding
mechanisms of food chain contamination. While there is much research investigating
solute-solvent interactions of aqueous metal ions or nonpolar molecules in water, we are
interested in the solution properties of a simple methyl-ion model developed to mimic the
behavior of aqueous methyl mercury. Coarse-grained parameters for several hydrophilic
ion-like particles without charge are presented representing metal ions Zn 2+, Hg2+, Na+, and
K+. Despite the use of only short-ranged interactions, the coarse-grained ion models
accurately reproduce the solvation structure of each ion in reference to both experimental
observation and atomistic molecular dynamics simulations. Molecular dynamics
simulations of these hydrophilic ion particles bonded to a single hydrophobic methane-like
particle in water surrounded by a vacuum were performed. Methyl-zinc and methyl-mercury
models were found to exhibit more hydrophobic character than smaller charge methylpotassium and methyl-sodium for a range of bond lengths.
CHED 569
Computational study of complexes between mercury (II) and tetra-peptides with Nand C-terminal cysteine amino acids
Diamond Nichols, [email protected], Joshua Watts, John K Merle.Department of
Chemistry, Winston Salem State University, Winston Salem, North Carolina 27110, United
States
Clinical chelation therapy compounds for mercury poisoning usually contain thiol moieties.
Current chelation therapies administer dimercaptosuccinic acid (DMSA) and
dimercaptopropanesulfonic acid (DMPS) as Hg2+ chelators. To improve upon current
therapies, this present study seeks to better understand the complexation interactions of
mercury (II) with cysteine (-CH2-SH side chain) containing tetra-peptides. Density
functional theory (DFT) calculations using the M06-2X/6-31G(d,p)/SDD level of theory have
been conducted to investigate structural and thermodynamic aspects of the interactions of
mercury (II) with these peptide ligands. To improve complexation energy values MP2/6311G**(cc-pVDZ-PP) single-point energies are determined on all structures. All
calculations are performed using the SMD solvation model. To optimize complexation
between mercury (II) and the tetra-peptides, the two internal amino acids are varied. The
primary focus here is placed on the tetra-peptides cys-gly-gly-cys, cys-glu-gly-cys, cys-glyglu-cys, cys-glu-glu-cys, including their stereoisomers.
CHED 570
Computational analysis of bryostatin 1: Difficulties, conformational energies, and
analog reactivity differences
Joshua Dahlke, [email protected], Ron C. Estler.Department of Chemistry, Fort
Lewis College, Durango, CO 81301, United States
Bryostatin 1 is a natural occurring product containing 47 carbon, 17 oxygen, and 68
hydrogen atoms. It is extracted from Bugula neritina, a species of bryozoans and has been
found to be a modulator of protein kinase C. This discovery has lead to the compound
being seen as a possible anti-cancer and memory-enhancing agent. Several analogs of
Bryostatin 1 have been synthesized since its discovery. These analogs have not been as
active medicinally. Using a variety of computational tools, the conformationally difficult
portion of Bryostatin 1 was analyzed to explore reasons for its synthetic challenge. A
variety of its analogs were similarly analyzed and these differences are presented.
CHED 571
Formation of stripe liquid crystal phases in water mixtures
Rita A Okumu, [email protected] of Chemistry, Westminster
College, Salt Lake, Utah 84105, United States
Liquid crystals have widespread applications in nano-optical and nano-electrical
technology. We report simulations of water and a mildly hydrophilic solute that produce
stripe liquid crystal phases. Using classical Molecular Dynamics simulations with the mW
model of water, we determined the range of stability of this liquid crystal phase and
quantified the ratio of water to solute in the stripes as a function of the strength of the
water-solute attraction. In addition we investigated the effect of temperature and excess
solute and water on these structures. These preliminary results contribute towards an
understanding of the mechanism behind the formation of this novel phase of water.
CHED 572
Computational study of substituted anilines and indoles: The effect of
intramolecular hydrogen bonding on N-H stretching frequencies
Shamus Driver, [email protected], Jason W Ribblett.Department of Chemistry,
Ball State University, Muncie, IN 47306, United States
Through-bond and through-space interactions were examined on aniline and indole. On
aniline, different groups were placed in the ortho, meta, and para positions with respect to
the amino group. On indole, the substituents were placed in different positions of the sixmember and five-member rings. Substituents included functional groups which contained a
highly electronegative atom (F,O,N) capable of forming a hydrogen bond with an amino
hydrogen atom as well as functional groups incapable of forming hydrogen bonds with the
amino group. DFT and MP2 methods were used to determine ground state optimized
geometries for multiple conformations of all compounds studied. Correlations found
between the N-H stretching frequencies with the C-N bond length in the meta and para
substituted anilines were not present in the ortho substituted anilines. A similar result was
found in the substituted indoles.
CHED 573
Alkanethiols self-assembled monolayers on a GaAs(100) surface
Alyssa S Manz, [email protected], Heriberto Hernandez.Department of Chemistry,
Grinnell College, Grinnell, IA 50112, United States
A computational study of a pentanethiol self-assembled monolayer adsorbed on a
GaAs(100) surface was performed using the ONIOM method. The interaction of the
pentanethiol and an embed cluster on the surface was optimized using the B3LYP/631+G(d) level of theory. The rest of the surface was model using a universal force field. On
smaller clusters, the pentanethiol adsorbed slightly parallel to the surface, whereas on
larger clusters with several thiols present, the adsorption was almost perpendicular.
Results from this study showed that a large surface and multiple thiols on the surface are
indeed necessary for an accurate description of a self-assembled monolayer.
CHED 574
Conformational analysis of cyclohexanone ring systems by DFT and other
computational methods
Francisco Jimenez, [email protected], Randy M Miller, David B
Ball.Department of Chemistry and Biochemistry, California State University, Chico, Chico,
CA 95929, United States
The chair-chair interconversion of cyclohexane has been well characterized using a variety
of experimental and computational techniques. Less well-studied are the cyclohexanone
systems of increasing complexity including 3,3,5,5-tetramethylcyclohexanone and 2bromo-3,3,5,5-tetramethylcyclohexanone. The potential energy surfaces, including
intermediates an transition states, have been fully described using PM3, HF, DFT, MP2
and MP4 theories. In general, functionalizing cyclohexane to make the cyclohexanone and
tetramethylated versions leads to more intermediates, a more complex energy landscape
and lower transition state barriers.
CHED 575
Engineering novel self-assembling peptide materials by studying diphenylalanine
Carolyn Mills, [email protected], Joohyun Jeon, M. Scott Shell.Department
of Chemical Engineering, University of California, Santa Barbara, Goleta, CA 93117,
United States
The recently-discovered diphenylalanine peptide (FF) self-assembles into nanotubes with
remarkable properties: exceptional stability to heat and solvents, and high mechanical
strength. While experiments have investigated the properties and applications of FF
nanotubes, little is known about their self-assembly mechanism or the intermolecular
interactions underlying their stability.
Here, we use atomic-resolution simulations of FF peptides to gain insight into the early
stages of oligomerization and the driving forces for assembly. Specifically, we use
molecular dynamics simulations to characterize oligomers of FF peptides in aqueous
solution. We measure contacts, dihedral angles, and structures, and compare to the
putative experimental x-ray crystal structure of FF nanotubes. Our results suggest that both
hydrophobic interactions between the phenylalanine side-chains and electrostatic
interactions between their termini drive assembly of small oligomers. Ultimately, a deeper
understanding of FF nanotube assembly should facilitate the functionalization and
engineering of new synthetic peptide-based materials.
CHED 576
Discussion on the pentacoordinate complexes in VSEPR
Chenxi Zhang, [email protected], Xuefeng Wang.Department of Chemistry,
Tongji University, Shanghai, Shanghai 200092, China
The Valence Shell Electron Pair Repulsion (VSEPR) model predicts the arrangement of
five electron pairs is the trigonal bipyramid instead of the square pyramid in order to
minimize their interactions. However, in our calculation, B3LYP/6-311++G(d,p) level of DFT
was employed to comprehensively elucidate TaH5 prefers to the square pyramid
arrangement but TaF5 has the trigonal bipyramid structure as VSEPR predicted. Moreover,
there would be a greater repulsion such as lone pairs, less electronegative ligands and
double bonds on the axial pairs than on the equatorial pairs of a trigonal bipyramid. In this
paper, we attempt to discuss three controlling factors of molecular geometry: 1) the Pauli
repulsion; 2) the metal d orbital participation in σ bonding and 3) ligand electrostatic
repulsion.
Fig 1. a) the square pyramid structure (C4v) of TaH5; b) trigonal bipyramid structure (D3h) of
TaF5
Fig 2. Example of pentacoordinate molecules in which the less electronegative ligands and
double bonds occupy the equatorial positions
CHED 577
Generation of secondary organic aerosol from a beta-phellandrene based essential
oil
Kaylee Gund1, [email protected], Kara Huff Hartz2. (1) Department of Chemistry,
University of Dallas, Irving, TX 75062, United States (2) Department of Chemistry and
Biochemistry, University of Southern Illinois, Carbondale, IL 62901, United States
When released into the atmosphere, volatile organic compounds (VOCs) react with
oxidants to form secondary organic aerosol (SOA). SOA comprises a significant portion of
total organic particulate matter and poses environmental and health hazards with
increasing concentrations. SOA formation from a byproduct of mountain pine beetle
infestations in lodgepole pine tree trunks, a VOC called β-phellandrene, was investigated.
To study this phenomenon, an essential oil containing β-phellandrene and minor amounts
of other VOCs was injected into an environmental smog chamber and allowed to react with
an excess of ozone. SOA formation was measured by monitoring particulate matter
formation using a scanning mobility particle sizer. SOA samples were collected onto filters
for off-line characterization using solvent extract and analysis by gas
chromatography/mass spectroscopy. Based on the kinetics of VOC oxidation and particle
formation, β-phellandrene likely undergoes a two-step oxidation process during which
products from both the endo and the exo carbon carbon double bond are formed. Analysis
of filter samples collected during the experiment revealed that the carbon-carbon double
bonds of β-phellandrene were oxidized to give a variety of products including cryptone. The
measured SOA yields suggest that the β-phellandrene released from mountain pine beetle
infestations has the potential to contribute to organic atmospheric particulate matter
concentrations.
CHED 578
Determination of products formed by the photolysis of 2,4-dinitrotoluene and 2,6dinitrotoluene in solutions containing dissolved ionic compounds
Alec J Kersey, [email protected], Daniel W. O'Sullivan, Dianne J. Luning
Prak.Chemistry, United States Naval Academy, Annapolis, MD 21402, United States
The corrosion of unexploded ordnance casings at shooting ranges or dumping grounds
provides an entry for munitions constituents into the marine environment. Exposure of
these dissolved compounds to sunlight can cause some of them to degrade into products
that are more toxic than the parent compound. In this work, some of the products formed
by photolysis of two common propellants, 2,6-dinitrotoluene (2,6-DNT) and 2,4dinitrotoluene (2,4-DNT), in seawater and salt water solutions were separated and
identified. Solutions containing 2,4-DNT or 2,6-DNT were photolyzed using a solar
simulator. The product mixtures were extracted on amino and C-18 solid phase extraction
cartridges and sequentially eluted using water, acetonitrile and methanol. The extracts
were analyzed using liquid chromatography mass spectrometry. The photolysis products
that have been identified for 2,6-DNT include 2,6-dinitrobenzyl alcohol, 2,6dinitrobenzaldehyde, and 2,6-dinitrobenzyl nitrile. The photolysis products that have been
identified for 2,4-DNT include 2,4-dinitrobenzyl alcohol, 2,4-dinitrobenzaldehyde, and 2,4dinitrobenzyl nitrile.
CHED 579
Determination of the impact of dissolved inorganic and organic substances on the
photolysis of munitions constituents
Elizabeth A. Milewski, [email protected], Dianne J. Luning Prak.Department of
Chemistry, United States Naval Academy, Annapolis, MD 21402, United States
Munitions constituents enter natural waters from the corrosion of unexploded ordnance
casings and from runoff near shooting ranges. Exposure to sunlight can cause some of
these constituents to degrade. In this study, the photolysis rates of two common
propellants, 2,4-dinitrotoluene and 2,6-dinitrotoluene, were measured as a function of
dissolved ionic and organic substances. Samples were exposed to simulated sunlight using
a Suntest CPS+® solar simulator under various filters designed to select specific regions of
the solar spectrum to examine the wavelength dependence of photolysis. After irradiation,
samples were analyzed via HPLC, and first-order rate constants for the photolysis reaction
were determined. The rates of photolysis increased with increasing concentration of
dissolved ionic compounds. Photolysis rates in the presence of dissolved organic
substances were faster than in pure water. This poster will present the rates of degradation
of munitions constituents in waters containing various dissolved substances in varying
concentrations.
CHED 580
Synthesis and oxidative degradation 6-(hydroxymethyl)uracil as a model compound
for cylindrospermopsin (CYN), a potent cyanotoxin
Michelle Luzi, [email protected], Cen Zhao, Kevin O'Shea.Department of Chemistry
and Biochemistry, Florida International University, Miami, Florida 33199, United States
Cylindrospermopsin (CYN) is a toxin produced by several strains of cyanobacteria which
inhabit fresh water lakes and rivers. Algal blooms have received considerable attention
because of the concerns with the elevated levels present in drinking water reservoirs. An
effective and efficient method for eliminating CYN from drinking water supplies is critical to
protect human and environmental health. The limited availability and high cost of high CYN
have inhibited detailed studies on the removal or degradation of CYN by advanced
oxidation technologies. With this in mind, 6-(hydroxymethyl)uracil has been synthesized as
a model compound for CYN. Two synthetic approaches were followed in attempts to obtain
the model compound. The model compound was subjected to photocatalysis using
different types of TiO2 materials. The synthesis and degradation studies will be presented.
We are currently attempting the synthesis of anticipated byproducts of the degradation
reaction for confirmation product structures.
CHED 581
Atrazine degradation in Puerto Rico soil amended with compost and vermicompost
Manuel García, [email protected], Myrna Ríos, Angela Gonzalez.Department of
Biology, Chemistry and Environmental Sciences, Inter American University of Puerto Rico San Germán, San Germán, Puerto Rico 00683, Puerto Rico
Atrazine is a widely used pesticide because its efficiency and low cost to control weeds in
crops. It has been used in Puerto Rico in pineapple, yams, yautias and banana crops.
However, EPA has restricted its use due to its potential health risks for humans and
aquatic ecosystems. Atrazine has been found in surface, ground, and drinking waters,
especially after heavy rains. Soil amendment has been successfully used to stimulate the
degradation of contaminants. This work compared the effectiveness of amending soil with
grass clippings compost or vermicompost to reduce atrazine concentration. Decrease in
the concentration of atrazine was followed using UV detection after extraction of the
pesticide. UV detection allowed a simple way to follow atrazine concentration through the
experiment. Results indicated that vermicompost amendment reduced the atrazine
concentration by more than half, in the period of the study, being the most effective
modification.
CHED 582
Removal of arsenic and chromium in groundwater using a magnetite based
nanocomposite
Manuel García1, [email protected], Tatiana Luna-Pineda2, Oscar Perales-Pérez3,
Félix Román-Velázquez2. (1) Department of Biology, Chemistry and Environmental
Sciences, Inter American University of Puerto Rico, San Germán, PR 00683, Puerto
Rico (2) Department of Chemistry, University of Puerto Rico, Mayaguez, PR 00681,
Puerto Rico (3) Department of Engineering Science & Materials, University of Puerto Rico,
Mayaguez, PR 00681, Puerto Rico
The capacity of meso-dimercaptosuccinic acid functionalized magnetite (DMSA-magnetite)
and magnetic nanocomposite (DMSA-magnetite as disperse phase and calcium alginate
as matrix) to remove oxyanions is presented. For arsenic and chromium sorption a
maximum uptake capacity was observed using a pH of 6.5 and 4.5, respectively. These
results have been obtained using deionized water spiked with arsenic or chromium. Effect
of DMSA-magnetite nanoparticles and magnetic nanocomposite on the removal of arsenic
and chromium from ground water was investigated at pH 6.5 and 4.5, respectively. Water
samples were taken from Mayagüez, Puerto Rico and spiked with different concentrations
of arsenic and chromium. Samples were treated with 1g of sorbent per liter of water. The
samples were shaken and aliquots were taken at regular time intervals (1, 6, 12, 24, 36,
48, 60, and 72 hours). The samples were diluted and concentrations of arsenic and
chromium were determined using EPA method 200.8.
CHED 583
Arsenic sequestration from surface water via ZVI and copper nanoparticle filters
Angelica A Campos1, [email protected], Edgardo O Ortiz1, Jenifier
Olavarria2, Marco A De Jesus2. (1) Department of Biology, Chemistry and Environmental
Science, Inter American University of Puerto Rico, San German, PR 00683, Puerto
Rico (2) Department of Chemistry, University of Puerto Rico, Mayaguez, PR 00681,
Puerto Rico
Organoarsenic drugs, such as roxarsone and arsanilic acid, are commonly administered to
control coccidian intestinal parasites and improve growth and pigmentation in poultry.
These veterinary drugs can promote native bacterial resistance and degrade in the
environment, releasing potentially more toxic arsenic species (As (III) and As (V)). Ninety
five percent of arsenic drugs are released into litter which is commonly used as fertilizer,
thus raising concerns regarding possible dispersion of arsenic to water bodies. Copper and
iron nanoparticles have proven to be highly effective for arsenic absorption; therefore, their
use as isolating materials is attractive. In this work, filters containing metallic Fe and Cu
nanoparticles were developed to evaluate their removal capability of roxarsone and
arsanilic acid. The removal capability of the new filters was assessed by determining the
organoarsenic drugs concentration, by HPLC. Results indicate that zero valent iron filters
(ZVI) were more effective to remove those drugs.
CHED 584
Investigation of toxic heavy metals in the Chattahoochee River water using graphite
furnace atomic absorption spectroscopy
Timothy C Jones, [email protected], Samuel Abegaz.Department of
Chemistry, Columbus State University, Columbus, Ga 31907, United States
The Chattahoochee River is approximately 430 miles long. It is important to Alabama,
Georgia, and Florida. Pollution of the Chattahoochee River is a major concern, especially
for cities such as Columbus which is located downstream from Atlanta. In this study, 15
water samples were collected from Eufaula, Alabama, to Lake Lanier, Georgia, and tested
for the content of heavy metals using graphite furnace atomic absorption spectroscopy.
The pyrolysis and atomization temperatures were optimized with and without matrix
modifiers. The analytical procedure was validated using certified reference material and the
results were in agreement with the certified values. The ranges of heavy metal
concentrations ND – 0.215 μg/L, ND - 2.49 μg/L, ND - 3.2 μg/L, and ND – 4.6 μg/L for
cadmium, chromium, arsenic, and lead, respectively, with a precision better than 5% for
more than 95% of the measurements.
CHED 585
Insights into the solvolytic mechanism of α-chloro-2-(trifluoromethyl)benzyl
chloroformate
Kaylee Miller1, [email protected], Catherine Gross1,
[email protected], Malcolm J D'Souza1, Dennis N Kevill2. (1)
Department of Chemistry, Wesley College, Dover, DE 19901, United States (2)
Department of Chemistry & Biochemistry, Northern Illinois University, DeKalb, IL 60115,
United States
Substituted benzylic chloroformate esters have found wide commercial use in the
agrochemical, pharmaceutical, and the related chemical product industry. Additionally,
peptide chemistry utilizes protecting groups such as the benzyloxycarbonyl group due to its
chemical stability and ease of removal. In this undergraduate research project, the specific
rates of solvolysis of α-chloro-2-(trifluoromethyl)benzyl chloroformate have been measured
in several pure and binary aqueous organic solvents including a variety of fluoroalcohol
mixtures. The kinetic rates of this benzyl chloroformate containing electron-withdrawing
substitution were determined using acid-base and conductometric titrations. Our results
indicate that nucleophilic attack plays an important part in the rate-determining step. The
Wesley College undergraduate research program in chemistry is supported, in part, by the
Delaware INBRE and EPSCoR programs ‐ supported by grants from the National Center
for Research Resources‐NCRR (5P20RR016472‐12) and the National Institute of General
Medical Sciences ‐ NIGMS (8 P20 GM103446‐12) from the National Institutes of Health
(NIH); a National Science Foundation (NSF) Delaware EPSCoR grant EPS‐0814251; and
a NSF ARI‐R2 grant 0960503.
CHED 586
Differentiating electronic effects in substituted aryl chlorothionoformate esters
Brett M Sansbury1, [email protected], Malcolm J. D'Souza1, Dennis N.
Kevill2. (1) Department of Chemistry, Wesley College, Dover, DE 19901, United States (2)
Department of Chemistry & Biochemistry, Northern Illinois University, DeKalb, IL 60115,
United States
Aryl chlorothionoformates (ROCSCl) are derivatizing agents that have also found wide use
in the preparation of thionocarbamates that are effective fungicides. Over the past few
years, our research group has analyzed in detail the solvolyses of p-tolyl-, phenyl-, pchlorophenyl-, p-fluorophenyl-, and pentafluorophenyl chlorothionoformate esters in a
variety of organic mixtures of widely varying nucleophilicity and ionizing power values. Here
we present all of the solvolytic data of pentafluorophenyl chlorothionoformate accumulated
at 25.0°C using the titration method. The rate data show that there is a significant
dependence on substitution effects and an analysis using the extended (two-term)
Grunwald-Winstein equation shows the occurrence of simultaneous side-by-side additionelimination and unimolecular SN1 mechanisms. This work is supported, in part, by the
Delaware INBRE and EPSCoR programs ‐ supported by grants from the National Center
for Research Resources‐NCRR (5P20RR016472‐12) and the National Institute of General
Medical Sciences ‐ NIGMS (8 P20 GM103446‐12) from the National Institutes of Health
(NIH); a National Science Foundation (NSF) Delaware EPSCoR grant EPS‐0814251; and
a NSF ARI‐R2 grant 0960503.
CHED 587
Microbial fuel cell as a tool for chemical education
Venkataramana Gadhamshetty1, [email protected], Wendy M. Willner1,2,
[email protected], Marianne Nyman1, Anne P Hynes3. (1) Department of Civil and
Environmental Engineering, Rensselaer Polytechnic Institute, Troy, NY 12180, United
States (2) Briarcliff High School, Briarcliff Manor, New York 10510, United States (3)
Material Engineering, Rensselaer Polytechnic Institute, Troy, New York 12180, United
States
3,3' Dichlorobenzidine (DCB) represents a carcinogenic compound that was frequently
used in manufacturing of textiles and dyes until 1982. This study evaluates the viability of
bioelectrochemical reduction of DCB compounds in biocathodes of microbial fuel cells
(MFCs). In MFCs, exoelectrogenic bacteria oxidize organics in the anode,and generate
electrons that can be used to reduce oxidized contaminants in the cathode. A glass H-type
reactor, utilizing DCB in a biocathode, was operated for nearly three months. The MFC
produced nearly 1.08 mW/m2 while reducing DCB. The DCB concentration was reduced by
nearly 23.9% within first 24 hours of operation. Impedance analysis indicated a solution
resistance of 150 Ω, a polarization resistance of 650 Ω, and showed presence of two time
constants.
CHED 588
Examining arsenate/arsenite ratios in well water
Daniel S. Mast, [email protected], Arwyn Smalley.Department of Chemistry, Saint
Martin's University, Lacey, Washington 98503, United States
Arsenic is a major water quality issue in communities around the world. Arsenic
is present in natural waters as one of two ions: arsenate(IV) and
arsenite(III). Residents of most counties in Washington State, including San
Juan County, are required to test for total arsenic concentration, without
regard to the speciation, although the two ions have significantly different
toxicities. We used a molybdenum blue method to test for both total arsenic
concentration and the arsenic ion ratios in Lopez Island well water.
CHED 589
Quantitative determination of antidepressants in biosolids destined for land
application
Lydia M Niemi, [email protected], Melissa M Schultz.Department of Chemistry, The
College of Wooster, Wooster, OH 44691, United States
Antidepressants are one of the most widely dispensed class of pharmaceuticals in the
United States. The use of biosolids, sludge produced from wastewater treatment plants, as
fertilizer is a potential route for antidepressants to enter the terrestrial environment. A
microextraction method was developed for the extraction of a suite of antidepressants in
lagoon sludge destined for land application. Liquid chromatography tandem mass
spectrometry was coupled with the extraction technique for quantitative determination. The
method was applied to monthly lagoon sludge collected from June 2012 to February 2013.
Labeled fluoxetine spiked sludge recoveries resulted in 50 ± 9% due to the heterogeneous
nature of the sludge. Sertraline, fluoxetine, and citalopram were the most commonly
detected antidepressants in the sludge samples. Concentrations of the individual
antidepressants in the lagoon sludge ranged from no detect to 0.2 μg/kg (sertraline).
CHED 590
Nickel concentrations in sediments collected from the U.S. continental shelf in the
Gulf of Mexico
Rachel K Gibbs, [email protected], Al C Nichols, David A Steffy, Larry J
Morgan.Department of Physical and Earth Sciences, Jacksonville State University,
Jacksonville, Alabama 36265, United States
Sediment samples were collected during the fall, 2010, along the U.S. continental shelf in
the Gulf of Mexico. Bottom samples were collected using a Shipek grab sampler. Dried
samples were analyzed for nickel using ICP. Nickel is a trace metal component of the
crude oil released from the BP Deepwater Horizon oil spill in April 2010. The release of this
crude oil could provide a new source of trace metals to the sediments forming the
continental shelf. Carbonate sediments collected off of the Gulf coast of Florida had a
mean nickel concentration of 5.31 + 3.81 micrograms of nickel per gram of dry sediment.
Deltaic sediments collected off of the Louisiana coast had a mean nickel concentration of
9.09 + 3.58 micrograms /g.
CHED 591
Alternative mechanism for the kinetics of the aqueous formation of N-chloro-Nmethylacetamide
Bridget J. Gromek, [email protected], Edward T. Gray,.Department of Chemistry,
University of Hartford, West Hartford, Connecticut 06117, United States
The kinetics of the reaction of N-methylacetamide with aqueous chlorine is reinterpreted in
a way that does not require the general-acid catalyzed pathway to proceed through an
acyl-hypochlorite intermediate. This new approach limits the chlorinating species to
aqueous HOCl and Cl2. The Cl2 reaction proceeds without catalysis while the HOCl
pathways are both specific and general-acid catalyzed. However, the catalytic step invokes
a modification of the amide nitrogen to a more amine-like entity which can then react
rapidly with HOCl along the lines of the well-known mechanism of acid catalysis of the
hydrolysis of secondary amides. Rate constants for the reaction with Cl2 will be presented
as well as those for the specific-acid and general-acid catalyzed pathways involving HOCl.
The HOCl reactions are accomplished without the presence of chloride ion to eliminate
interference from the Cl2 pathway.
CHED 592
Kinetics and mechanisms of the reaction of amines with N-chloro-Nmethylacetamide
Sarah C. Wahab, [email protected], Edward T. Gray.Department of Chemistry,
University of Hartford, West Hartford, Connecticut 06117, United States
The kinetics and mechanisms of the transfer of oxidizing chlorine from N-chloro-Nmethylacetamide to primary and secondary amines in aqueous solution will be presented.
The reactions result in the quantitative formation of the respective chloramine over a wide
pH range. The orders of the reaction with respect to each species will be presented along
with a mechanism that includes the various dependencies of hydrogen-ion catalysis. The
results will be discussed in terms of the conditions necessary to generate chloramine
disinfectants in natural water systems using N-chloro-N-methylacetamide as a stable
source of chlorine.
CHED 593
Direct synthesis of biodiesel fuel from tree nuts
Katie E. Benjegerdes, [email protected], John J. Stankus,
[email protected] of Chemistry, University of the Incarnate Word, San
Antonio, TX 78209, United States
Biodiesel fuel was synthesized directly from solid nut sources including pecans and
almonds in the absence of the intermediate step of pressing out the oil. The residual
carbohydrates were fermented to produce the alcohol for the base-catalyzed
transesterification reaction. The biodiesel was characterized by combustion calorimetry,
GC-MS, and FTIR analysis.
CHED 594
Continued studies on the hypochlorite of phenol
Tina Moulton, [email protected], Justin Hsu, [email protected],
Luke Vickers, Vic Heasley.Department of Chemistry, Point Loma Nazarene University, San
Diego, California 92106, United States
The synthesis and isolation of the organic hypochlorite, formed by the reaction of
monochloramine and phenol in water, has been improved. After formation, the hypochlorite
is extracted into ether and isolated by repeated vacuum removal of the monochlorine. The
presence of this structure in the solution was confirmed via iodometric titration, gas
chromatography, and mass spectrometry. The structure of the hypochlorite was confirmed
using 1H-NMR, in which the hypochlorite was isolated under vacuum, placed in the 1HNMR, reduced, dried, and placed again in the 1H-NMR. The structure was also confirmed
using 13C-NMR. The hypochlorite reactivity was probed by analyzing the aqueous reaction
of the hypochlorite with various hydrocarbons commonly found in drinking water. The
hypochlorite did react with these hydrocarbons when in an acidic solution and, to a small
extent, in a neutral solution.
CHED 595
Mercury analysis in Rafinesque big-eared bat populations
Lara J. van der Heiden, [email protected], Cathleen J. Webb.Department of Chemistry,
Western Kentucky University, Bowling Green, Kentucky 42101, United States
Mercury (Hg) from atmospheric deposition from coal-burning power plants and other
anthropogenic sources was analyzed in Rafinesque Big Eared Bats from Mammoth Cave
National Park. The mercury from water progressively moves up the food chain through
insects, and eventually into bats. In 2011, 58 bats were collected and hair samples were
taken for an analysis. The AMA254 Mercury Analyzer was used to determine the mercury
concentration from the bat hair in parts per million. A considerable amount of mercury was
discovered in the bats analyzed. The mercury concentration of juvenile Rafinesque bats
averaged between 0.5-1.0 ppm. Mercury levels in adult Rafinesque bats averaged between
1.0-2.0 ppm, with female bats overall containing the highest amount of mercury. Notably,
the mass and forearm length of Rafinesque bats do not appear to affect the amount of
mercury the bats contain.
CHED 596
Photocatalytic degradation of triclosan
Owen D Williams, [email protected], Dwight J Tshudy, Joel E Boyd.Department of
Chemistry, Gordon College, Wenham, MA 01984, United States
Triclosan is a common substance in personal care products and is an emerging concern
with regard to its potential environmental and human health effects. Triclosan was chosen
as a photocatalytic degradation target because it is often considered to be a representative
compound for the broader class of pharmaceutical waste products. Triclosan will be
quantified using HPLC detection. Novel TiO2-acrylic composite reactors will be applied to
the photocatalytic degradation of triclosan for potential point-of-use applications in high
triclosan usage areas.
CHED 597
Porous TiO2/acrylic composite materials for the photocatalytic oxidation of carbon
monoxide
Lee G Andrews, [email protected], Benjamin D Stewart, Clyde A Daly, Joel E
Boyd.Department of Chemistry, Gordon College, Wenham, MA 01984, United States
TiO2 is well-known as a photocatalyst that can oxidize organic molecules when activated
by UV light. The deposition of TiO2 within UV-transparent porous support materials
facilitates the construction of efficient flow-through photocatalytic reactors for gas-phase
applications. Carbon monoxide (CO), an odorless tasteless gas that can be lethally toxic to
humans, is a byproduct of incomplete combustion reactions such as automobile exhaust.
This study shows that the porous polymer wafer reactors fabricated in our lab can be used
for the photocatalytic oxidation of CO into CO2 in the presence of O2. The photocatalytic
activity of platinized and a non-platinized reactors are compared using various illumination
intensities and wavelengths, in order to investigate the viability of such reactors for use in
industrial and household applications.
CHED 598
Novel solvent bar microextraction of acetaminophen and azithromycin from water
Cody L Smith, [email protected], Edward R Acheson.Department of Chemistry, Millikin
University, Decatur, Illinois 62522, United States
A 2000 study done by the United States Geological Survey (USGS) analyzed 139 water
samples from various streams across the United States. 95 different compounds, ranging
from steroids to antibiotics, were found at part per billion (ppb) levels in the samples. In
order to detect these compounds, it was first necessary to concentrate the analytes using
solid phase extraction (SPE). While SPE is useful for concentrating these analytes, the
process is tedious, time-consuming, and not reproducible. Solvent bar microextraction, first
described in 2004, can be used as a rapid and reproducible alternative to SPE. We have
successfully used solvent bar microextraction to concentrate acetaminophen from water as
a model system for concentrating the antibiotic azithromycin. We will describe our results
with acetaminophen as well as preliminary results concentrating azithromycin.
CHED 599
Determining volatiles produced by decomposing carcasses using GC/MS
Jordan Fauser, [email protected], Donald Wharry, Kendra Abbott.Department of
Chemistry, St. Edward's University, Austin, Texas 78704, United States
The Nicrophorus carolinus is a species of carrion beetle found in the United States which
uses chemical signals to locate carcasses at the ideal age for brood ball formation. Based
on field observations the beetles appeared to be most attracted to carcasses 4 days into
the aging process. The focus of this research was creating a profile of the compounds
produced by the decomposing carcass which attract these carrion beetles using Solidphase micro-extraction and gas chromatography with mass spectroscopy. Volatiles from
chicken and mouse carcasses were tested, aged in the same way, and tested over a one
week period, focusing on days 2-5 of the aging process. Samples from whole carcasses
and parts were tested. Differences were identified in the compounds released based on the
three variables tested. The compounds most consistently observed were identified and
some quantifications were conducted to determine changes in extent of compounds
released over time.
CHED 600
Analysis of heavy metal concentrations within street dust of the Long Creek
watershed
David Finocchietti1, [email protected], Sarah McClain1, Martin Stein1, Lucille
Benedict1, Kate McDonald2. (1) Department of Chemistry, University of Southern Maine,
Portland, Maine 04104, United States (2) Cumberland Country Soil & Water Conservation
District, United States
The objective of this research was to analyze for sources of contamination of the Long
Creek Watershed in South Portland, ME. Pollutants tend to be transported by rainwater
along roadways and into storm drains. The runoff due to this process is a detriment to
aquatic ecosystems. This project aimed to investigate the concentrations of heavy metals
in street dust by monitoring specific locations within the watershed and assessing trends
over time. Samples were analyzed using an x-ray fluorescence spectrophotometer. The
results of this research will be used to determine how to better manage urban runoff
contamination into bodies of water, including the Long Creek Watershed.
CHED 601
Microbial fuel cells: Generating electricity from mud
Wayne Michael Schmitt1,2,3, [email protected], Pu Zheng1,2, Cheng
Wen-Yen2, Yan Cao1,2, Hou-Yin Zhao2, Wei-Ping Pan1,2. (1) Chemistry, Western Kentucky
University, Bowling Green, Kentucky 42101, United States (2) Institute of Combustion
Science and Environmental Technology, Bowling Green, Kentucky 42101, United
States (3) Carol Martin Gatton Academy of Math and Science in Kentucky, Bowling Green,
Kentucky 42101, United States
Our society faces a transition from the traditional fossil fuel energy supply to the extended
wide-spectrum renewable energy supplies. This study explores the likelihood of electricity
generation using bacterium metabolism, while simultaneously cleaning up the wastewater.
Organic contaminants in wastewater are the energy source for the metabolism of
bacterium, yet some trace metal is vital. Demonstrated in the laboratory using test tubes
and beakers filled with mud and water, the naturally-collected bacteria can create electricity
potential through the redox reactions of their metabolic activities. Bacteria generate a flow
of electrons which can be potentially harvested as electricity. By altering the conditions in
which these bacteria reside, it is possible to affect their metabolic activity, thus improving
efficiencies of these microbial fuel cells. At the current stage of this study, only electricity
potential is created, and further studies will focus on maintaining the constant electricity
current in the microbial fuel cells.
CHED 602
Calcite precipitation and geochemistry in a calcareous fen
Krystal L. Woda, [email protected], Joseph J. Piatt.Department of Chemistry and
Biochemistry, Carroll University, Waukesha, Wisconsin 53186, United States
Seasonal calcite precipitation dynamics were investigated at a calcareous fen (Vernon
Marsh) in Mukwonago, Wisconsin. Calcareous fens are fed by groundwater in contact with
dolomite, CaMg(CO3)2. As such, plant life in these fens has adapted to growing in the
presence of high calcium and alkalinity. For each five-week sampling episode over the
summer and fall, marble tiles were placed at a groundwater discharge area and at ten
locations downstream. The tile mass gained or lost was used as an indicator of calcite
precipitation or dissolution. Additionally, measurements of alkalinity, pH, CO 2, dissolved O2,
conductivity, and water temperature also were taken to understand the fen's surface water
geochemical characteristics. Preliminary data suggests that in summer months there is
calcite precipitation which corresponds with CO2 exolution and increases in pH as you
move downstream from the discharge source. In colder temperatures we expect to
measure calcite dissolution.
CHED 603
Amine incorporation into particulate matter at a California dairy
Kopano L Ramsay1, [email protected], Su Anne Lee 1, David R Cocker2,
Philip Silva3, Alam S Hasson4, Shawn Ashkan4, Kathleen L Purvis-Roberts1. (1)
Department of Chemistry, W. M. Keck Science Center, Claremont, California 91711, United
States (2) Center for Environmental Research & Technology, University of California,
Riverside, Riverside, California 92521, United States (3) Agricultural Research Service,
United States Department of Agriculture, Bowling Green, Kentucky 42104, United
States (4) Fresno State University, Fresno, California 93740, United States
Particulate Matter (PM2.5) is a mixture of solid particles and liquid droplets in the
atmosphere. It has adverse effects on the environment and human health. One of the
chemical components of secondary organic particulate matter is alkylamines, but little is
known about how they partition between the gas and particle phase. One of the major
sources of these alkylamine emissions are in places of animal husbandry. A Particle-IntoLiquid-Sampler coupled to two Ion Chromatograms (PILS-IC) was used to identify and
measure the concentrations of ambient inorganic amine cations and anions at Flint Dairy in
Hanford, CA. A weather station was used to measure real-time daily weather conditions,
including relative humidity, temperature, wind speed, and wind direction. Temperature and
humidity fluctuated inversely. Almost all amine concentrations fluctuated over the course of
the day. Sulfate, ethylamine, dimethylamine and triethylamine went up with increasing
temperature, while nitrate concentrations went up with decreasing temperature.
CHED 604
Determination of stimulant use by commercial truck drivers: Wastewater analysis by
LC-MS/MS
Rebecca L. Ferrell, [email protected], Daniel A. Burgard.Department of Chemistry,
University Puget Sound, Tacoma, WA 98416, United States
Professions that require people to stay awake for long shifts, such as commercial truck
drivers, have the incentive to abuse stimulants such as those from the amphetamine
family. Usage statistics of these drugs comes from self-reporting data, police records and
drug testing results. Self-reporting illicit drug use is inherently problematic and the other
methods are invasive and involve catching use of the drugs. For this study wastewater was
collected from portable toilets at a weigh station along Interstate 5 in Washington State.
Daily samples were taken over a week, extracted using Solid Phase Extraction and
analyzed for amphetamine, methamphetamine, pseudoephedrine and ephedrine by LCMS/MS. Concentrations found in the wastewater were normalized using the human marker
compound creatinine as well as a tally of facility users. Levels of amphetamine and
methamphetamine were found to be as high as 120 and 660 ng/ml respectively.
CHED 605
Correlation between formation of alkylaminium salts in particulate matter on dairies
Su Anne Lee1, [email protected], Kopano Ramsay1, David R. Cocker2, Philip
J. Silva3, Alam S. Hasson4, Shawn Ashkan4, Kathleen L. Purvis-Roberts1. (1) W.M. Keck
Science Department, Claremont Colleges, Claremont, California 91711, United States (2)
Center for Environmental Research and Technology, University of California Riverside,
Riverside, California 92507, United States (3) United States Department of Agriculture,
Agriculture Research Service, Bowling Green, Kentucky 42104, United States (4)
California State University Fresno, Fresno, California 93740, United States
Gaseous amines in the atmosphere derive from sources such as sewage treatment and
livestock feeding. These amines react in the atmosphere to form particles, specifically
amine salts. Experiments were conducted at Flint Dairy, Hanford, CA to identify which
amine salts are present in particulate matter, and to explore the possible correlation of
alkylammonium salt formation. A Particle Into Liquid Sampler-Ion Chromatograph (PILS-IC)
was used to identify and measure the concentrations of salts formed during our
experimental period. The amines of interest are methylamine, ethylamine, dimethylamine,
and trimethylamine, as well as the chloride, nitrate and sulphate anions. Data showed that
over the period of a week, ethylamine correlates with the anions more than the other
amines. Our findings also indicate that in the case of trimethylamine, there was a negative
correlation with some of the anions.
CHED 606
Determination of pKa values for synthesized thiosemicarbazone and semicarbazone
ligands
Jacob D Buckner, [email protected], Amanda J Crook, Dale D
Ensor.Department of Chemistry, Tennessee Technological University, Cookeville, TN
38501, United States
Thiosemicarbazone and semicarbazone compounds have been extensively reported in
scientific literature. These compounds are used as chelating agents and are being tested
as possible cancer fighting agents. This research serves to determine the pKa values of
the hydrazinic proton. This proton must be removed prior to metal chelation. These values
provide valuable information in determining what pH range these compounds will be most
effective at remediating metal ions out of aqueous solutions. This allows selection of
ligands that will be successful in chelating metal ions out of natural water supplies at
environmental pH ranges. These determinations will be conducted using spectroscopic
methods that determine changes between protonated and deprotonated forms of the ligand
as pH is varied. This class of compounds is expected to be effective in the pH range of
natural water supplies, as preliminary data places the pKa values of the compounds in the
range of pH 8.
CHED 607
Baseline water quality monitoring in the watersheds of Otsego County, NY
Nicole Daniels, [email protected], Martina Yoshiko, [email protected],
Zsuzsanna Balogh-Brunstad.Department of Chemistry, Hartwick College, Oneonta, New
York 13820, United States
The Marcellus Shale is a Middle Devonian age, black, low density, organic rich shale that
contains about 1.9 trillion cubic feet of natural gas that could be produced by the process of
horizontal hydraulic fracturing (fracking). One of the environmental effects of fracking is
potential surface and ground water contamination. Establishment of baseline water quality
information is essential for various parameters to allow detection of any changes caused by
fracking. The goals of our study are to monitor chemical and physical field parameters and
to establish a baseline database of current heavy metal concentrations of the surface
waters. Water samples are collected every three weeks for nine months at fifty sites in
Otsego County, NY and heavy metal concentrations are determined using atomic
absorption spectroscopy. All collected results will be used to produce maps that show the
current chemical state of the surface waters throughout Otsego County.
CHED 608
Bioremediation technology using Lentinula edodes and Phanerochaete
chrysosporium to remove trace levels of 17-α-ethinylestradiol in wastewater
Hannah A Chappell1, [email protected], Lori Coward2, Greg Gorman2, Denise J
Gregory1. (1) Department of Chemistry and Biochemistry, Samford University,
Birmingham, AL 35229, United States (2) McWhorter School of Pharmacy, Samford
University, Birmingham, AL 35229, United States
The presence of 17-α-Ethinylestradiol (EE2) in the environment is causing harmful effects
on the ecosystems around wastewater. Certain strands of fungi have been proven to
degrade complex molecules such as Bisphenol A and lignin. Two strands of fungi were
used, Lentinula edodes and P. chrysosporium to degrade EE2. Both fungi have lignolytic
enzymes that are important in the degradation process. Lentinula edodes contain the
enzymes lignin peroxidase, manganese peroxidase and lacasse that are important in the
degradation process. P. chrysosporium was chosen because of a recent discovery that it
contains very little or no lacasse enzyme. We have successfully degraded EE2 completely
in 8 days with Lentinula edodes. This process is monitored over time using LC-MS. We are
currently working to determine the degradation products and their level of estrogenic
activity. Prelimary results of P. chrysosporium with EE2 show that degradation is
significantly slower than the drug with Lentinula edodes.
CHED 609
Study of the heterogeneous chemistry of formic acid on mineral dusts by dual
chamber transmission FT-IR flow reaction system
Robert M Weingold, [email protected], Matthew J Christie, Courtney D
Hatch.Department of Chemistry, Hendrix College, CONWAY, Arkansas 72032, United
States
Mineral dust aerosol can impact the chemistry and climate of the Earth's atmosphere by
providing surfaces for heterogeneous reactions and modifying the radiative balance of the
Earth, respectively. Surface/gas reactions can alter the chemical composition of the
mineral surfaces, thereby modifying the chemical and radiative properties of the mineral
aerosol. To study the heterogeneous chemistry of mineral dust aerosol at atmospherically
relevant relative humidities, a transmission Fourier transform infrared (FT-IR) spectrometer
equipped with an Aabspec #S reaction chamber in line with an annular denuders has been
previously designed, developed and characterized. Studies of formic acid uptake on
various dusts and dust analogs will be presented. Gas phase formic acid was extracted in
the form of formate from the annular denuders and quantified off line by ion
chromatography (IC). Changes in the condensed phase reaction products were monitored
using FT-IR spectroscopy and quantified by extraction and analysis by IC. Infrared spectral
features are identified and compared to calculated vibration frequencies of formic acid on
silica.
CHED 610
Impacts of Aeolian dust on phytoplankton growth rates
McKenzie Keller, [email protected], Meredith Miles, Matthew Christie, Courtney D
Hatch.Department of Chemistry, Hendrix College, Conway, Arkansas 72032, United States
Phytoplankton of the world's oceans are important chemical regulators and a major food
source for many marine species. It has long been hypothesized that iron is the main
limiting nutrient for phytoplankton in High-Nutrient Low-Chlorophyll areas. This project
examines the impact of Aeolian dust deposition on the growth rates of phytoplankton in
both iron-enriched and iron-deficient ocean environments. A correlation has been found
between the concentration of Fe-containing montmorillonite clay and growth rates of
phytoplankton within iron-deficient environments. The impacts of ocean deposition of
atmospherically processed clays have also been studied with respect to their effects on
phytoplankton growth rates. Results indicate that the nitrated clay minerals enhance the
growth rates of the phytoplankton such that the phytoplankton in iron-deficient
environments containing nitrated clays exhibits growth rates similar to that of phytoplankton
in iron-enriched environments. This experiment demonstrates the viability of mineral
aerosols as a source of nutrients for phytoplankton.
CHED 611
Application of carbon nanotube filters on abandoned mine drainage
Samantha M Shumaker, [email protected], Caryl Fish.Chemistry,
Saint Vincent College, Latrobe, PA 15650, United States
Acid mine drainage (AMD) is an escalating problem specifically in the Appalachian Region
where water tends to contain high levels of metals such as iron and aluminum. In response
to the increasingly prevalent issue of AMD, various counteractive options for cleaner
waterways have been investigated. One treatment option to explore is using carbon
nanotube (CNT) filters to decrease the concentration of metals in these AMD waters. Upon
the creation of three different types of filters using double walled CNTs, single walled
CNTs, and activated carbon through a suspension-filtering process, AMD waters with
different temperatures, iron and aluminum concentrations, and pH values were run through
the filters. Samples were analyzed for metal concentrations before and after filtration. The
ultimate goal is to find the usefulness of these filters in treatment of AMD.
CHED 612
Passive treatment of abandoned mine drainage and municipal wastewater in a
bioreactor using potential biofuel producing microalgae
Jacob M Hendrick, [email protected], Caryl Fish.Department of
Chemistry, Saint Vincent College, Latrobe, Pennsylvania 15650, United States
Using laboratory-scale bioreactors microalgae, C. vulgaris and C. pyenoldosa, were
cultured in BG-11 medium under constant fluorescent light conditions stirring at 100 rpm.
The cultures were introduced into a wastewater environment of Abandoned Mine Drainage
(AMD) from the Wetlands at St. Vincent College and Municipal Wastewater (MWW) from
Unity Township Latrobe, Pennsylvania to determine the contamination treatment ability.
Using the EPA method 300.0 the levels of nitrates and phosphates using an Ion
Chromatograph and iron levels using a Flame-AA were analyzed before and after a sevenday growth period. The biomass is harvested using vacuum filtration, dried and then
weighed. The biomass is crushed to expose oil, washed with a hexane and ether solution
and allowed to settle. The hexane solution is evaporated off and mixed with sodium
hydroxide in a separatory funnel to produce biodiesel. The percent lipid concentration and
biodiesel production is determined for each alga strain.
CHED 613
Comparison between experimental and theoretical adsorption isotherms of CH4 and
CO2 on montmorillonite
Michael D Kilmer, [email protected], Lorena Tribe.Division of Science, The
Pennsylvania State University - Berks Campus, Reading, Pennsylvania 19610, United
States
Hydraulic Fracturing for natural gas in the United States requires a special fluid composed
of sand, water, and potentially harmful chemicals. Supercritical carbon dioxide may be an
alternative, which would avoid the introduction of hazardous materials. Experimental
isotherms for methane and carbon dioxide are available in the literature because of the
interest in shale gas reservoirs and in carbon sequestration. The synergy of experimental
and theoretical data for adsorption processes will provide a molecular level of
understanding and comparable determinations of ΔGads. Ultimately, the difference in the
ΔGads of both gaseous species will determine if CO2 is able to desorb CH4 from the
surface. Computational chemistry is used here to provide a molecular level interpretation of
the interactions between CH4 and CO2 and the substrate with Density Functional Theory
and the b3lyp/6-311++G(d,p) functional. The models were developed with GaussView,
energy minimized with Gaussian 09, and analyzed with Molden.
CHED 614
Determination of a cation/anion balance in a calcareous fen system
Amanda L Gourlay, [email protected], Jennifer L Fellin, [email protected],
Matthew C Rosera, Joseph J Piatt.Department of Chemistry and Biochemistry, Carroll
University, Waukesha, Wisconsin 53186, United States
In conjunction with a field calcite precipitation study, fen water samples were collected and
analyzed to conduct a cation/anion balance in an effort to understand the geochemical
context of the calcite precipitation/dissolution dynamics. Groundwater and surface water
geochemistry impact the growth and success of plants in a wetland. The groundwater that
feeds this fen is rich in base cations and alkalinity as it is in contact with dolomite,
CaMg(CO3)2. Base cations were analyzed using FAA and the major anions were
determined titrimetrically and using ion-selective electrodes. Additionally, trace metals that
serve as micronutrients were measured using graphite furnace AAS. The geochemical data
collected was modeled using MINEQL, a chemical equilibrium model, to determine if the
dolomitic geology controls the geochemistry of the wetland stream system.
CHED 615
Phytoremediation of lead contaminated water using aqueous plant extracts
Charne Thomas, [email protected], Lovell E Agwaramgbo, Chardai Grays, Tajeve
Wright-Young.Chemistry, Dillard University, New Orleans, Louisiana 70122, United States
There is a growing global concern for the environmental and health hazards posed by
heavy metal contaminants, especially lead in the soil and ground water. Thus, there is
great need to a cheap, efficient, and effective technology to mitigate the growing problem
of heavy metal contaminations. The study presented here was undertaken to evaluate the
potential of using aqueous extracts of Brassica juncea (Mustard Green), Spinacea oleracea
(spinach), Brassica Oleracea (Collard Green), Capsicum Annuum (Red Pepper), Vernonia
Amygdalina, Carota Sativus (Carrot), Lycopersicon esculentum (Tomatoes), Vitis vinifera
(grapes), and Citrus aurantifolia (lime) for the in-situ remediation of lead contaminated
water. After shaking triplicate reaction mixtures of lead contaminated water with each
substrate for 22 hours at room temperature, lead removal by the substrates were analyzed
using Inductively Coupled Plasma-Atomic Emission Spectrometry. The study concludes
that the aqueous extracts of the vegetables and fruits effectively removed lead from
contaminated water.
CHED 616
Lead remediation of contaminated water by charcoal, Louisiana red clay, spinach,
and mustard green
Shelby L. Edwards, [email protected], Tajeve A. Wright-Young,
[email protected], Lovell Agwaramgbo, [email protected], Eric
Buckles.Chemistry, Dillard University, New Orleans, Louisiana 70122, United States
Lead is a toxic and naturally occurring substance with documented neurotoxin, toxic, and
long-lasting adverse health effects. Lead exposure can cause impaired physical and
mental development in children and affects the intestinal tract, kidneys, joints and
reproductive system in adults. This study evaluates the removal of 1500 PPM of lead from
contaminated aqueous solution using Celite, Louisiana Red Clay, Charcoal, and
supernatants from aqueous extracts of Mustard Green (Brassica juncea), and Spinach
(Spinacea oleracea). After shaking triplicate reaction mixtures for each substrate for 22
hours at room temperature, lead removal by the five substrates were analyzed using
Inductively Coupled Plasma-Atomic Emission Spectrometry (ICP-AES). Results suggest
that the order of lead removal is Spinach (98%) > Charcoal (96%) > LA Red Clay (88%)>
Mustard Green (87%) > Celite (4%). The study concludes that some liquid and solid
substrates can efficiently remove lead from contaminated water.
CHED 617
Nutrient level monitoring to determine t