Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Online Resource 1. Primers used in this work Online Resource 2. Assignment for functional traits of HOG1 homologs in Pezizomycotina Online Resource 3. Aligment of amino acid sequences of HOG1 homologs Online Resource 4. Protoplasting efficiencies of the WT strain and the AlHOG1-disrupted mutants Article title: Conserved and divergent roles of the HOG1 kinase of Alternaria longipes in mycelial and conidial development, multi-stress responses, melanin production and pathogenicity Journal name: European Journal of Plant Pathology Author names: Zhiqun Yina, Wei Bib, Qili Mic, Ziteng Kanga, Chenjian Liua, Jinkui Yangb*, Yiyong Luoa* Affiliation: a Laboratory of Applied Microbiology, Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming 650500, China b State Key Laboratory for Conservation and Utilization of Bio-Resources in Yunnan, Yunnan University, Kunming 650091, China c Technology Center, China Tobacco Yunnan Industrial Co., Ltd., Kunming, 650231, China Corresponding author: *E-mail address: [email protected] and [email protected] Online Resource 1. Primers used in this work a Primers Oligo sequence (5'–3')a Description AAP1 AAGAAGATCATGAAGCC Amplify AAP2 ACATCAT(CG)A(CT)(CT)TTCCA(ACGT)GT region TSP5-1 TGGTCCTTGGCTGAACTGTG Amplify the 5' flanking TSP5-2 CTGCTGGTAATCTCGAAAGTGG unknown sequence TSP5-3 TTCCGCCATGATTGTTGG TSP3-1 TGCGATTCGTCCAGTCACTTC Amplify the 3' flanking TSP3-2 GAGGAGAAGTTTGACTGGTCGTTC unknown sequence TSP3-3 GTTGACACGTGGAAAATCATGA HOG-5f GTAACGCCAGGGTTTTCCCAGTCACGACGTACCCCACGACGTCCTACTC Amplify the 5' flanking HOG-5r ATCCACTTAACGTTACTGAAATCTCCAACGGAGAACTGGTTCACGTGGT fragment HOG-3f CTCCTTCAATATCATCTTCTGTCTCCGACGCGGAGGAGAAGTTTGACTG Amplify the 3' flanking HOG-3r GCGGATAACAATTTCACACAGGAAACAGCAGCCATGTTTCCACTTCTGG fragment hphF GTCGGAGACAGAAGATGATATTGAAGGAGC Amplify the HPH cassette hphR GTTGGAGATTTCAGTAACGTTAAGTGGAT YZZJ-F GATACTACCGAGCCCCTG Confirm YZZJ-R ACTTCTCCTCCGCAATCG candidate strains P-hogf TCTTCCACCACCACAACC Make Southern blot probe P-hogr AGACCGAAGTCGCAAATC the the conserved disrupted The nucleotides marked with underlines are tails homologous to the HPH cassette and the linearized vector pRS426. Online Resource 2. Assignment for functional traits of HOG1 homologs in Pezizomycotina Functional traitsa Assignment Sensitivity to salts (SA) No=1 Yes=2 Sensitivity to sugars (SU) No=1 Yes=2 Whether No=1 Yes=2 Whether affects conidial No=1 Yes=2 affects conidial germination rates (WACG) Resistance to dicarboximide numbers (WACN) No=1 Yes=2 and phenylpyrrole (RDP) Sensitivity to H2O2 (SH) spores=3 Whether affects melanin No=1 Yes=2 production (WAPP) No=1 Yes=2 No=1 Yes=2 Sensitivity to menadione (WAHG) Whether related to carbon and No=1 Yes=2 No=1 Yes=2 (SHSS) a affects hyphal No=1 Yes=2 Resistance to cell Yes=2 Whether wall reduces pathogenicity (WRP) Yes and mutants cannot switch to filamentous growth=3 No=1 Yes=2 perturbing agents (RCWP) No=1 No and mutants resistance to menadione=3 morphology (WAHM) nitrogen sensing (WRCN) Sensitivity to heat shock stress Whether Yes and mutants produce more melanin =3 (SM) Whether affects hyphal growth Yes and mutants produce more No and mutants sensitivity to cell wall stress=3 No=1 Yes=2 Yes and virulence=3 The letters in brackets were abbreviation for the corresponding functional traits description. mutants loss Online Resource 3. Alignment of amino acid sequences of HOG1 homologs Online Resource 3 Aligment of amino acid sequences of three HOG1 homologs from the genus Alternaria, AlHOG1 (GenBank: KT362180), AaHOG1 (GenBank: ADC35362) and AbHOG1 (GenBank: Q52PH6), as well as Saccharomyces cerevisiae HOG1 (GenBank: P32485) using the DNAman software package. Identical and similar residues are shadowed in black and gray, respectively. Important regions and sites are marked by two adjacent vertical lines or indicated with the # sign above them, in the following order: the ATP binding region, the Lys and Asp active sites, activation loop containing the TGY motif with the T and Y phosphorylation site residues marked by black arrows, the CD domain responsible for binding Pbs2, and the second Pbs2-binding site, containing motif necessary for HOG1 autophosphorylation marked by grey box. The annotations are based on data from the literatures (Maayan et al. 2012; Murakami et al. 2008) Online Resource 4. Protoplasting efficiencies of the WT strain and the AlHOG1-disrupted mutants C-00 (WT) AlHOG1Δ Standard protoplasting conditions Enzymolysis stepa AlHOG1Δ Low salt protoplasting conditions 2 hb 7.4×106c 6.0×106 2.4×105 0 3h 8.5×106 2.5×106 3.8×105 0 4h 1.8×107 1.9×106 5.5×106 0 5h 8.0×106 1.1×106 2.9×105 0 (2.3–12.0) ×106 0 (1.0–88.0)×104 0 Suspension stepd a C-00 (WT) For standard conditions, 0.5–1.0 g young tender hyphae was incubated at 33 °C in 10 ml lytic solution (0.7 M NaCl, 5.0 mg/ml Driselase, 12.5 mg/ml Snailase, 12.5 mg/ml Cellulase, 7.5 mg/ml Lywallzyme); For low salt conditions, the lytic solution contained 0.35 M NaCl instead of 0.7 M NaCl. b The time of hyphae enzymolysis in lytic solution. cThe number of protoplasts (unit: n/ml) was counted under a light microscope after 2–5 h enzymolysis. dProtoplasts were sequentially washed once with 0.7 M NaCl and SSTC (0.7 M NaCl, 1.2 M sorbitol, 10 mM Tris pH 7.5, 50 mM CaCl2), and suspended in STC (SSTC without NaCl).